Conditional Knockout Of Cdc20 Attenuates Osteogenesis In Craniofacial Bones

doi:10.21203/rs.3.rs-1296104/v1

Download PDF

Research Article

Conditional Knockout Of Cdc20 Attenuates Osteogenesis In Craniofacial Bones

https://doi.org/10.21203/rs.3.rs-1296104/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Craniofacial bone defects cause significant problems to patients with harmful consequences. Mesenchymal stem cells (MSCs) can self-renew and exhibit multilineage differentiation, which could be applied to bone regeneration. However, craniofacial bone tissue MSCs have unique properties, differing in their characteristics to MSCs derived from long bones. Cell division cycle protein 20 (CDC20) promotes osteogenic differentiation in long bones; however, its role in craniofacial bone tissues remains unknown.

Results: We successfully constructed Cdc20 conditional knockout mice and confirmed its knockout efficiency in cranial and mandibular bones. In this study, we found that Cdc20 conditional knockout in mice triggered distinctive cranial and mandibular bone loss. Moreover, the osteogenic differentiation potential of cranial suture-derived MSCs and mandibular bone marrow-derived MSCs was impaired in Cdc20 conditional knockout mice.

Conclusions: In general, the conditional knockout of Cdc20 impaired osteogenesis in craniofacial bones. Our findings provide new insights into craniofacial bone regeneration and the treatments of craniofacial bone-related diseases.

CDC20

Cranial bone

Mandibular bone

Mesenchymal stem cells

Osteogenesis

Bone defects are common clinical conditions with severe detrimental effects on the bodily functions and quality of life of patients. Craniofacial bone abnormalities can arise due to tumors, traumas, congenital diseases, or infections, and severely jeopardize mastication, pronunciation, and facial esthetics. Therefore, they cause a considerable medical burden on individuals and society, and advanced treatment strategies for craniofacial bone loss are urgently needed [1]. Craniofacial bone regeneration is a promising and rapidly evolving field. Recent advances in molecular and cell biology enable the development of treatments targeting genes in craniofacial stem cells, providing a novel approach to restoring craniofacial bone tissue.

Cell division cycle protein 20 (CDC20) is an important cell-cycle regulator involved in mitosis. CDC20 activates and binds to anaphase-promoting complex/cyclosome (APC/C), which enables the ubiquitination and degradation of substrates. Therefore, CDC20 serves as an integrator of intracellular signaling cascades, regulating progression through mitosis [2]. Besides regulating the cell cycle, CDC20 is involved in the regulation of other processes such as apoptosis [3], human malignancies [4], neuronal connectivity, and brain plasticity [5]. CDC20 also plays an essential role in osteogenesis in long bones by promoting the ubiquitination and degradation of p65 [6]. However, whether CDC20 exerts unique effects on craniofacial bone tissue remains unknown.

Craniofacial bone tissue stem cells comprise mandibular bone marrow-derived mesenchymal stem cells (MSCs) and cranial bone-derived MSCs. Mandibular bone marrow-derived MSCs play a significant role in mandibular bone remodeling and healing [7, 8]. Cranial sutures serve as the osteogenic front for intramembranous ossification, and the major population of cranial bone-derived MSCs is derived from cranial sutures [9, 10]. Both types of MSCs possess the ability to differentiate into osteoprogenitors and to further give rise to osteoblasts [11]. Sp7-Cre mice enable targeted gene deletion in osteoprogenitors and are used to generate mouse models for investigating the roles of specific genes in bone development [12, 13]. Craniofacial bone-derived MSCs differ from long bone marrow-derived MSCs in terms of developmental origin, clinical performance, proliferation, and differentiation potency [14–16], suggesting that there is a discrepancy between craniofacial and long bone regeneration. Thus, it is essential to investigate whether CDC20 plays a unique role in mandibular and cranial bone regeneration.

In this study, we characterized the function of Cdc20 in the regulation of craniofacial bone formation. Cdc20 contributed to craniofacial bone regeneration, revealing its potential role as a target for improving therapeutic strategies to treat craniofacial bone-related diseases.

Generation and genotyping of mouse models

Cdc20 ^f/f and Sp7-Cre;Cdc20^f/f mice were generated as previously described [6]. In brief, Cdc20-floxed (Cdc20^f/+) mice were generated using a clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9-based extreme genome editing (EGE) system (Biocytogen Co., Ltd., Beijing, China). The targeting vector, single guide RNAs (sgRNAs), and Cas9 mRNA were co-injected into C57BL/6N mouse zygotes. The targeting vector was synthesized in vitro and contained genomic DNA spanning exons 1–7 of the mouse Cdc20 gene flanked by two loxP sites. Homology arms were also incorporated at the 5′ and 3′ regions. Using the CRISPR design tool (http://www.sanger.ac.uk/htgt/wge/) and the UCA™ CRISPR efficiency evaluation kit (Biocytogen Co., Ltd.), two sgRNAs were generated to target the upstream region of exon 1 and the downstream region of exon 7 of Cdc20. After injection, the surviving two-cell stage zygotes were transplanted into KM albino pseudo-pregnant females to generate founder mice bearing the floxed Cdc20 allele. Verification of the mouse genotypes was carried out by PCR amplification, DNA sequencing, and Southern blot analysis.

Sp7-Cre mice were obtained from Biocytogen Co., Ltd. An F2A-iCre sequence cassette was placed between the coding sequence of exon 2 and the 3′ untranslated region of the Sp7 gene in C57BL/6 ES cells. For detailed information on the iB-Sp7-iCre mice, review https://biocytogen.com/products/cre-mouse-rat-models/b-sp7-osx-icre-mice/. Sp7-Cre mice were then bred with Cdc20^f/f mice to generate iCre-positive, loxp-homozygous (Sp7-Cre;Cdc20^f/f) conditional knockout mice and their corresponding littermates. Genotyping primers are shown in Table 1. All animal procedures and experiments were carried out according to the guidelines of the Institutional Animal Care and Use Committee of the Peking University Health Science Center (LA2014233).

Table 1

Sequences of genotyping primers
Name	Primer sequence (5′–3′)
Cdc20 5′loxP-F	CCTAAACTATGTGGAGTTCAAGGCCA	WT:202 bp
Cdc20 5′loxP-R	AGGATCTAGGATCTAGGTGACTCCC	Mut:321 bp
Cdc20 3′loxP-F	GAAGCAGCTCCTGTCTTGGAGTTGT	WT:405 bp
Cdc20 3′loxP-R	CCACAGCCTGGGTGGAATGGATAAA	Mut:490 bp
Sp7-Cre WT-F	TACCAGAAGCGACCACTTGAGC	263 bp
Sp7-Cre WT-R	CGCCAAGAGAGCCTGGCAAG	263 bp
Sp7-Cre Mut-F	TACCAGAAGCGACCACTTGAGC	445 bp
Sp7-Cre Mut-R	GCACACAGACAGGAGCATCTTC	445 bp

Harvesting and culturing of primary cells

Proliferation medium (PM) contained α-minimum essential medium (Invitrogen, Carlsbad, CA, USA), 10% fetal bovine serum (PAA Laboratories GmbH, Linz, Austria), and 1% penicillin/streptomycin (Invitrogen). Osteogenic medium (OM) comprised standard PM and 10 mM β-glycerophosphate, 0.2 mM ascorbic acid, and 100 nM dexamethasone.

Primary mouse cranial suture-derived MSCs were obtained from 4-day-old mice as described previously [17, 18]. Sagittal sutures on cranial bones with 0.5-mm bony margins on either side were harvested to minimize tissue heterogeneity. Then, the underlying dura mater and the overlying pericranium were dissected from the suture mesenchyme, and the remaining suture tissue was minced into tiny blocks to expose the suture mesenchyme and explanted into culture dishes (Corning, Corning, NY, USA) containing PM. After 2 days, cranial suture-derived MSCs migrated from the explant tissue blocks and were observed by microscope.

The separation procedures of primary mouse mandibular bone marrow-derived MSCs were performed as previously described [15]. First, 6-week-old mice were sacrificed, mandibles were excised, and incisors and molars were removed. Subsequently, the bones were cut up, and all nucleated cells from the mandibular bones were isolated by digestion with collagenase type 2 and type 4 (15 mg/mL; Worthington Biochemical Corporation, Lakewood, NJ, USA) for 1 h at 37°C. The dissociated cells were filtered through a 40-mm strainer, and the supernatants were collected and seeded into culture dishes containing PM. Cells were maintained at 37°C with 5% CO₂. The medium was replenished after 2 days to remove non-adherent cells. Cells passaged less than two times were used for all experiments. For osteogenic differentiation, two types of cells were seeded in 12-well plates and induced in PM and OM for 7 days for further experiments.

Cell counting kit-8 assay

For cell proliferation assays, cells were seeded in 96-well plates and cultured at 2 × 10³ cells per well in PM. At day 0, 1, 3, 5, 7, the cell number was evaluated with a Cell Counting Kit-8 (CCK8, Dojindo Laboratories, Kumamoto, Japan) according to the manufacturer’s instructions. Optical density (OD) at 450nm was measured using a microplate reader (ELX808, BioTek) and growth curves were drawn according to the OD values (n = 3).

RNA isolation and quantitative real-time polymerase chain reaction (qRT-PCR)

Total RNA was extracted with TRIzol reagent (Invitrogen) from cells cultured in PM or OM for 7 days, and a NanoDrop 8000 spectrophotometer (Pierce Thermo Scientific, Waltham, MA, USA) was used to measure the purity and concentration of the total RNA. Reverse transcription was performed with a PrimeScript RT Reagent Kit (#RR037A; Takara, Tokyo, Japan). qRT-PCR was performed using a 7500 Real-Time PCR Detection System (Applied Biosystems, Foster City, CA, USA) and SYBR Green Master Mix (Roche Applied Science, Mannheim, Germany). Gene expression levels were calculated using the ^ΔΔCT method and normalized to glyceraldehyde-3-phosphate dehydrogenase. The primer sequences used are listed in Table 2.

Table 2

Sequences of PCR primers
Name	Sense strand (5′–3′)	Antisense strand (5′–3′)
Gapdh	CAGGAGAGTGTTTCCTCGTCC	TGAAGGGGTCGTTGATGGCA
Cdc20	CTCAAAGGACACACAGCACGG	CGCCACAACCGTAGAGTCTCA
Alp	TGACCTTCTCTCCTCCATCC	CTTCCTGGGAGTCTCATCCT
Runx2	CCGGGAATGATGAGAACTA	ACCGTCCACTGTCACTTT

Alkaline phosphatase (ALP) staining and quantification

Primary mouse cranial suture-derived MSCs and mandibular bone marrow-derived MSCs were seeded in 12-well plates. After 7 days of culture in PM or OM, the cells were washed with phosphate-buffered saline (PBS), fixed in 95% cold ethanol for 30 min, and then washed again with PBS. ALP staining was performed using a nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate staining kit (CoWin Biotech, Jiangsu, China) according to the manufacturer’s instructions. The cells were then gently rinsed with distilled water, and images were taken.

To quantify ALP activity, cells were washed with PBS and lysed with 1% Triton X-100 on ice, and centrifuged at 13,362 × g for 30 min at 4°C. A BCA protein assay kit (Pierce Thermo Scientific) was used to measure the total protein concentration for normalization. ALP activity was quantified using an ALP assay kit (Nanjing Jiancheng Bioengineering Institute, Jiangsu, China). The ALP activity was calculated according to the absorbance at 520 nm.

Micro-computed tomography (micro-CT) and soft X-ray

To evaluate differences in bone mass and microarchitecture in Cdc20^f/f and Sp7-Cre;Cdc20^f/f mice, cranial bones and mandibular bones were scanned using an Inveon MM system (Siemens, Munich, Germany) after fixation in 4% paraformaldehyde for 2 days. Images were acquired at a pixel size of 8.82 µm, current of 220 µA, voltage of 60 kV, and exposure time of 1500 ms. Bone morphometric parameters including bone volume/total volume (BV/TV), trabecular number (Tb.N), trabecular spacing(Tb. Sp), and bone mineral density (BMD) in the region of interest (ROI) were calculated using an Inveon Research Workplace (Siemens).

Soft X-ray images were taken after fixation in 4% paraformaldehyde for 2 days using a Senographe Essential Version ADS_55.20 instrument (GE Medical Systems, Little Chalfont, England) at 22 mA current and 25 kV voltage. The gray value was calculated using ImageJ software.

Histology and hematoxylin and eosin (H&E) staining

After fixing in 4% paraformaldehyde for 2 days, the cranial and mandibular bone specimens were soaked in 0.5 M ethylenediaminetetraacetic acid at 37°C for 3 weeks for decalcification. The decalcifying fluid was changed every 2 days. Afterwards, bone tissues were embedded in paraffin, cut into 5-µm tissue sections, and subjected to deparaffinization and rehydration. Sections were stained with H&E for histological observation.

Statistical analyses

Means and standard deviations presented in text and figures were calculated using at least three experiments per group. Statistical analyses were performed using GraphPad software (GraphPad Software, Inc., La Jolla, CA, USA). In the figures, bar graphs represent means, and error bars represent the standard deviation. Independent two-tailed Student’s t-tests were used to evaluate the differences between two groups, and one-way analysis of variance followed by Tukey’s post hoc tests were performed for comparisons between more than two groups. A two-tailed value of p < 0.05 was considered to represent statistical significance.

Construction and genotyping of the Cdc20 conditional knockout mouse model

We generated a Cdc20 conditional knockout mouse model using the Cre/loxP system to investigate the role of Cdc20 in craniofacial bone in vivo. The Cdc20^f/f and Sp7-Cre;Cdc20^f/f mouse models were developed as previously described [6]. In brief, Cdc20-floxed (Cdc20^f/+) mice were generated using a CRISPR/Cas9-based EGE system. Then, we crossed Cdc20^f/+with Sp7-Cre mice to generate the Sp7-Cre;Cdc20^f/f model. In Sp7-Cre;Cdc20^f/f mice, cre recombinase-mediated removal of the exon 1–7 led to the translation termination of Cdc20 (Fig. 1a). Genotyping was carried out by PCR amplification using mice tail extracts and DNA gel electrophoresis (Fig. 1b). Sp7-Cre;Cdc20^f/f mice were used as the experimental group, whereas Cdc20^f/f were used as the control group. We performed qRT-PCR to examine the efficiency of the Cdc20 conditional knockout mouse model; Cdc20 mRNA expression levels were relatively low in mandibular and cranial bone (Fig. 1c,d). These results showed that we successfully constructed Cdc20 conditional knockout mice and that Cdc20 expression was suppressed in cranial and mandibular bones.

Conditional Cdc20 knockout impaired osteogenesis in mandibular bone

Micro-CT and H&E staining analyses revealed that the mandibular bone microarchitecture of 6-week-old Sp7-Cre;Cdc20^f/f mice exhibited significant deterioration. The BMD and BV/TV parameters of mandibular bones were significantly lower in 6-week-old Sp7-Cre;Cdc20^f/f mice compared to in their Cdc20^f/f littermates. The Tb.N was lower and Tb.Sp was higher in 6-week-old Sp7-Cre;Cdc20^f/f mice compared to in the control mice (Fig. 2a,b). H&E staining and quantitative BV/TV analysis on histological sections revealed mandibular bone impairments in 6-week-old Sp7-Cre;Cdc20^f/f mice compared with their littermates (Fig. 2c,d). Our results suggest that downregulating Cdc20 expression impaired bone formation in the mandible.

Conditional knockout of Cdc20 reduced osteogenesis in cranial bone

Micro-CT and soft X-ray scans revealed that massive bone loss occurred in the cranial bones of 6-week-old Sp7-Cre;Cdc20^f/f mice. The coronal and three-dimensional (3D) reconstruction views displayed a distinct reduction in cranial bone thickness in Sp7-Cre;Cdc20^f/f mice (Fig. 3a). The BMD parameter of cranial bones was significantly lower in 6-week-old Sp7-Cre;Cdc20^f/f mice compared with their Cdc20^f/f littermates (Fig. 3b). Similarly, the gray values calculated from soft X-ray scans were lower in the experimental group compared to the control group, suggesting that the BMD was reduced in the Sp7-Cre;Cdc20^f/f mice (Fig. 3c). H&E staining and quantitative cranial bone thickness measurements revealed that the bone mass was lower in the cranial bones of 6-week-old Sp7-Cre;Cdc20^f/f mice compared with their littermates (Fig. 3d,e). These results suggest that downregulating Cdc20 suppressed osteogenesis in cranial bone.

Loss of Cdc20 attenuated the osteogenic differentiation of mandibular bone marrow-derived MSCs

To further explore the effect of CDC20 on mandibular bone marrow-derived MSCs, we obtained primary cells through collagenase dissociation. The Cell counting kit-8 assay revealed that there was no distinctive difference of cell proliferation rate in mandibular bone marrow-derived MSCs from Sp7-Cre;Cdc20^f/f mice and their Cdc20^f/f littermates (Fig. 4a). ALP staining (Fig. 4b) and ALP activity quantification (Fig. 4c) of the primary cells indicated that CDC20 silencing in mandibular bone marrow-derived MSCs inhibited their osteogenic differentiation. The relative mRNA expression levels of the osteogenic differentiation markers Runx2 and Alp revealed that osteogenic differentiation was downregulated in the mandibular bone marrow-derived MSCs of Sp7-Cre;Cdc20^f/f mice compared with those of their Cdc20^f/f littermates after 7 days of osteogenic culture (Fig. 4d,e). Our results suggested that the Cdc20 knockdown reduced the osteogenic differentiation potential without affecting the proliferation of mandibular bone marrow-derived MSCs.

Cdc20 silencing inhibited osteogenic differentiation of cranial suture-derived MSCs

Primary cranial suture-derived MSCs were separated from cranial bone tissue to evaluate the impact of Cdc20 silencing. Determined by CCK8 assay, cell proliferation of cranial suture-derived MSCs from Sp7-Cre;Cdc20^f/f mice and their Cdc20^f/f littermates didn’t show a significant difference (Fig. 5a). The primary cranial suture-derived MSCs were subjected to ALP staining (Fig. 5b) and ALP activity quantification (Fig. 5c) after 7 days of osteogenic induction, which revealed that Cdc20 silencing reduced the osteogenic differentiation potential of cranial suture-derived MSCs. Furthermore, the relative Runx2 and Alp mRNA expression levels were lower in the experimental group compared to in the control group (Fig. 5d,e). These results suggest that, similar to mandibular bone marrow-derived MSCs, Cdc20 downregulation impairs osteogenic differentiation in cranial suture-derived MSCs.

During cell division, CDC20 plays a key role in the formation of the checkpoint complex, which prevents mitotic exit and regulates the biochemical functions of several proteins [19]. CDC20 expression is also elevated in high-grade cancers and has been linked to poor prognoses. Furthermore, CDC20 is highly expressed in breast cancer patients, and Cdc20 overexpression is associated with aggressive breast cancer [20]. Silencing of CDC20 induces G2/M cell cycle arrest, inhibits cell growth, and retards colony formation in lung cancer cells [21]. Migration and invasion inhibitor protein interacts with CDC20 and inhibits APC/C-mediated degradation of cyclin B1, which in turn inhibits glioma development and progression [22]. Therefore, specific CDC20 inhibitors may be a strategy for the treatment of human cancers. However, few studies have reported the relationship between CDC20 and bone formation. Conditionally knocking out CDC20 decreases long bone formation in mice, and reduces the osteogenic differentiation of bone marrow MSCs via p65 degradation [6]. In the present study, we examined the role of CDC20 in cranial and mandibular bone, and the results were consistent with the previous research outlined above.

Sp7 transcription factor 7/Osterix (Sp7/Osx) is a C2H2-type zinc finger transcription factor, which is a putative master regulator of osteoblast lineage progression. Generated by osteoprogenitors, Sp7/Osx is essential for MSCs to differentiate into osteoblasts and is involved in bone formation during postnatal growth [23–25]. The Cre/loxP system has been widely used to generate conditional gene knockout mice [26]. Sp7-Cre mice can be used to specifically target skeletal tissues, including craniofacial bone. For example, autophagy-related genes were knocked down in craniofacial bone using the Sp7-Cre strain, leading to compromised craniofacial bone development and indicating the significant role of autophagy in craniofacial bone formation [27]. Fgfr3 was specifically activated by knocking out the NEO sequence in osteoprogenitors, which showed that Fgfr3 impairs craniofacial bone growth [28]. The targeted deletion of Dicer in cranial osteoblast precursor cells using the Sp7-Cre system rescued suture defects and increased cranial bone mass [29]. By contrast, osteoblast-specific Irx3 knockout mice (Irx3^fl/fl/Osx-Cre⁺ mice) exhibited decreased cranial bone mineralization [30]. Reduced IFT140 expression specifically in Osx-positive cells delayed healing processes in alveolar bone sockets and reduced differentiation and proliferative potency in alveolar bone marrow-derived MSCs [31]. Osteoblastic cell lineages are required during craniofacial development to regulate bone formation [32]. In this study, Sp7-driven Cdc20 knockout mice were an effective tool to investigate the role of CDC20 on craniofacial bones.

In this study, we examined the role of CDC20 specifically in craniofacial MSCs due to site specificity during MSC fate commitment. Mandibular bone marrow-derived MSCs are involved in bone healing [7, 8]. Cranial suture-derived MSCs undergo intramembranous growth to expand cranial bone [10, 33]. Similar to long bone marrow-derived MSCs, mandibular bone marrow-derived MSCs and cranial suture-derived MSCs can differentiate into osteoblasts and can be used in tissue engineering. However, they differ in their embryonic, phenotypic, and pathological characteristics [34–39]. Cranial suture-derived MSCs and mandibular bone marrow-derived MSCs develop from cranial neural crest cells. However, the molecular mechanisms regulating osteogenesis in craniofacial bones differ to those of long bones [14]. Therefore, it is necessary to elucidate whether CDC20 promotes osteogenesis in craniofacial bones; our findings were consistent with those of a previous study [6]. Nevertheless, the underlying mechanisms remain elusive and should be explored further in subsequent studies.

In this study, we demonstrated that conditional knockout of Cdc20 led to reduced craniofacial bone mass in mice. Osteogenic differentiation in craniofacial bone-derived MSCs was also downregulated. Our results suggest that CDC20 promotes osteogenesis in craniofacial bones, providing a novel target for developing strategies to treat craniofacial bone defects. These findings, which provide insight into the function of CDC20 in craniofacial bone, may advance medical restoration and reconstruction of craniofacial bone defects, providing a promising future for craniofacial bone regeneration.

ALP: Alkaline phosphatase APC/C: Anaphase-promoting complex/cyclosome BV/TV: Bone volume/total volume BMD: Bone mineral density CCK8: Cell Counting Kit-8 CDC20: Cell division cycle protein 20 CRISPR: Clustered regularly interspaced short palindromic repeats EGE: Extreme genome editing H&E: Hematoxylin and eosin Micro-CT: Micro-computed tomography MSCs: Mesenchymal stem cells OD: Optical density OM: Osteogenic medium Osx: Osterix PBS: Phosphate-buffered saline PM: Proliferation medium qRT-PCR: Quantitative real-time polymerase chain reaction ROI: Region of interest sgRNAs: Single guide RNAs Sp7: Sp7 transcription factor 7 Tb.N: trabecular number Tb. Sp: Trabecular spacing

Ethics approval and consent to participate

All animal procedures and experiments were approved by the Institutional Animal Care and Use Committee of the Peking University Health Science Center (approval number: LA2021006). All procedures of in vivo study on the animals were carried in accordance with the institutional animal guidelines and ARRIVE guidelines.

Consent for publication

Not applicable.

Availability of data and materials

Data sharing not applicable to this article as no datasets were generated or analysed during the current study.

Competing interests

The authors declare that they have no competing interests.

Funding

This study was supported by grants from the National Natural Science Foundation of China (No. 82170929 and 81970908 to YL)

Authors’ contributions

P.Z. , X.Z. and Y.L.: conception and design, financial support, and manuscript writing. Y.D. and Y.C.: laboratory work, collection and analyses of data, manuscript writing. All authors read and approved the final manuscript.

Acknowledgements

Not applicable.

Fliefel R, Kühnisch J, Ehrenfeld M, Otto S. Gene Therapy for Bone Defects in Oral and Maxillofacial Surgery: A Systematic Review and Meta-Analysis of Animal Studies. Stem Cells and Development. 2017;26(4):215–30.
Yu H. Cdc20: a WD40 activator for a cell cycle degradation machine. Mol Cell. 2007;27(1):3–16.
Harley ME, Allan LA, Sanderson HS, Clarke PR. Phosphorylation of Mcl-1 by CDK1-cyclin B1 initiates its Cdc20-dependent destruction during mitotic arrest. Embo j. 2010;29(14):2407–20.
Chang DZ, Ma Y, Ji B, Liu Y, Hwu P, Abbruzzese JL, et al. Increased CDC20 expression is associated with pancreatic ductal adenocarcinoma differentiation and progression. J Hematol Oncol. 2012;5:15.
Yang Y, Kim AH, Yamada T, Wu B, Bilimoria PM, Ikeuchi Y, et al. A Cdc20-APC ubiquitin signaling pathway regulates presynaptic differentiation. Science. 2009;326(5952):575–8.
Du Y, Zhang M, Liu X, Li Z, Hu M, Tian Y, et al. CDC20 promotes bone formation via APC/C dependent ubiquitination and degradation of p65. EMBO reports. 2021;22(9):e52576.
Chung IH, Yamaza T, Zhao H, Choung PH, Shi S, Chai Y. Stem cell property of postmigratory cranial neural crest cells and their utility in alveolar bone regeneration and tooth development. Stem Cells. 2009;27(4):866–77.
Lee DJ, Kwon J, Current L, Yoon K, Zalal R, Hu X, et al. Osteogenic potential of mesenchymal stem cells from rat mandible to regenerate critical sized calvarial defect. J Tissue Eng. 2019;10:2041731419830427.
Zhao H, Chai Y. Stem Cells in Teeth and Craniofacial Bones. J Dent Res. 2015;94(11):1495–501.
Li B, Wang Y, Fan Y, Ouchi T, Zhao Z, Li L. Cranial Suture Mesenchymal Stem Cells: Insights and Advances. Biomolecules. 2021;11(8):1129.
Kaltschmidt B, Kaltschmidt C, Widera D. Adult craniofacial stem cells: sources and relation to the neural crest. Stem Cell Rev Rep. 2012;8(3):658–71.
Liu J, Liang C, Guo B, Wu X, Li D, Zhang Z, et al. Increased PLEKHO1 within osteoblasts suppresses Smad-dependent BMP signaling to inhibit bone formation during aging. Aging Cell. 2017;16(2):360–76.
Chen Y, Fan Q, Zhang H, Tao D, Wang Y, Yue R, et al. Lineage tracing of cells expressing the ciliary gene IFT140 during bone development. Developmental Dynamics. 2021;250(4):574–83.
Helms JA, Schneider RA. Cranial skeletal biology. Nature. 2003;423(6937):326–31.
Yamaza T, Ren G, Akiyama K, Chen C, Shi Y, Shi S. Mouse mandible contains distinctive mesenchymal stem cells. J Dent Res. 2011;90(3):317–24.
Lloyd B, Tee BC, Headley C, Emam H, Mallery S, Sun Z. Similarities and differences between porcine mandibular and limb bone marrow mesenchymal stem cells. Arch Oral Biol. 2017;77:1–11.
Xu Y, Malladi P, Chiou M, Longaker MT. Isolation and characterization of posterofrontal/sagittal suture mesenchymal cells in vitro. Plast Reconstr Surg. 2007;119(3):819–29.
James AW, Xu Y, Wang R, Longaker MT. Proliferation, osteogenic differentiation, and fgf-2 modulation of posterofrontal/sagittal suture-derived mesenchymal cells in vitro. Plast Reconstr Surg. 2008;122(1):53–63.
Lara-Gonzalez P, Kim T, Oegema K, Corbett K, Desai A. A tripartite mechanism catalyzes Mad2-Cdc20 assembly at unattached kinetochores. Science. 2021;371(6524):64–7.
Karra H, Repo H, Ahonen I, Löyttyniemi E, Pitkänen R, Lintunen M, et al. Cdc20 and securin overexpression predict short-term breast cancer survival. Br J Cancer. 2014;110(12):2905–13.
Kidokoro T, Tanikawa C, Furukawa Y, Katagiri T, Nakamura Y, Matsuda K. CDC20, a potential cancer therapeutic target, is negatively regulated by p53. Oncogene. 2008;27(11):1562–71.
Ji P, Smith SM, Wang Y, Jiang R, Song SW, Li B, et al. Inhibition of gliomagenesis and attenuation of mitotic transition by MIIP. Oncogene. 2010;29(24):3501–8.
Nakashima K, Zhou X, Kunkel G, Zhang Z, Deng JM, Behringer RR, et al. The novel zinc finger-containing transcription factor osterix is required for osteoblast differentiation and bone formation. Cell. 2002;108(1):17–29.
Celil AB, Campbell PG. BMP-2 and insulin-like growth factor-I mediate Osterix (Osx) expression in human mesenchymal stem cells via the MAPK and protein kinase D signaling pathways. J Biol Chem. 2005;280(36):31353–9.
Zhou X, Zhang Z, Feng JQ, Dusevich VM, Sinha K, Zhang H, et al. Multiple functions of Osterix are required for bone growth and homeostasis in postnatal mice. Proc Natl Acad Sci USA. 2010;107(29):12919–24.
Rodda SJ, McMahon AP. Distinct roles for Hedgehog and canonical Wnt signaling in specification, differentiation and maintenance of osteoblast progenitors. Development. 2006;133(16):3231–44.
Thomas N, Choi HK, Wei X, Wang L, Mishina Y, Guan JL, et al. Autophagy Regulates Craniofacial Bone Acquisition. Calcif Tissue Int. 2019;105(5):518–30.
Biosse Duplan M, Dambroise E, Estibals V, Veziers J, Guicheux J, Legeai-Mallet L. An Fgfr3-activating mutation in immature murine osteoblasts affects the appendicular and craniofacial skeleton. Disease models & mechanisms. 2021;14(4): dmm048272.
Atsawasuwan P, Ouibaidin M, Dalal B, Khan H, Mohammed A. Calvarial bone development and suture closure in Dicer-deficient mice. Orthodontics & Craniofacial Research. 2017;20:26–31.
Cain CJ, Gaborit N, Lwin W, Barruet E, Ho S, Bonnard C, et al. Loss of Iroquois homeobox transcription factors 3 and 5 in osteoblasts disrupts cranial mineralization. Bone reports. 2016;5:86–95.
Zhou S, Li G, Zhou T, Zhang S, Xue H, Geng J, et al. The role of IFT140 in early bone healing of tooth extraction sockets. Oral Dis. 2021; doi: 10.1111/odi.13833.
Percival CJ, Richtsmeier JT. Angiogenesis and intramembranous osteogenesis. Developmental Dynamics. 2013;242(8):909–22.
James AW, Levi B, Commons GW, Glotzbach J, Longaker MT. Paracrine interaction between adipose-derived stromal cells and cranial suture-derived mesenchymal cells. Plast Reconstr Surg. 2010;126(3):806–21.
Chai Y, Jiang X, Ito Y, Bringas P, Jr., Han J, Rowitch DH, et al. Fate of the mammalian cranial neural crest during tooth and mandibular morphogenesis. Development. 2000;127(8):1671–9.
Jiang X, Iseki S, Maxson RE, Sucov HM, Morriss-Kay GM. Tissue origins and interactions in the mammalian skull vault. Dev Biol. 2002;241(1):106–16.
Mackie EJ, Ahmed YA, Tatarczuch L, Chen KS, Mirams M. Endochondral ossification: how cartilage is converted into bone in the developing skeleton. Int J Biochem Cell Biol. 2008;40(1):46–62.
Aghaloo TL, Chaichanasakul T, Bezouglaia O, Kang B, Franco R, Dry SM, et al. Osteogenic potential of mandibular vs. long-bone marrow stromal cells. J Dent Res. 2010;89(11):1293–8.
Le Douarin NM, Dupin E. The neural crest in vertebrate evolution. Curr Opin Genet Dev. 2012;22(4):381–9.
Li C, Wang F, Zhang R, Qiao P, Liu H. Comparison of Proliferation and Osteogenic Differentiation Potential of Rat Mandibular and Femoral Bone Marrow Mesenchymal Stem Cells In Vitro. Stem Cells Dev. 2020;29(11):728–36.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Conditional Knockout Of Cdc20 Attenuates Osteogenesis In Craniofacial Bones

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Generation and genotyping of mouse models

Harvesting and culturing of primary cells

Cell counting kit-8 assay

RNA isolation and quantitative real-time polymerase chain reaction (qRT-PCR)

Alkaline phosphatase (ALP) staining and quantification

Micro-computed tomography (micro-CT) and soft X-ray

Histology and hematoxylin and eosin (H&E) staining

Statistical analyses

Results

Discussion

Conclusion

Abbreviations

Declarations

References

Additional Declarations

Status:

Version 1