Molecular Characterization of Klebsiella Pneumoniae Isolated From Sputum

doi:10.21203/rs.3.rs-1311414/v1

Download PDF

Research Article

Molecular Characterization of Klebsiella Pneumoniae Isolated From Sputum

https://doi.org/10.21203/rs.3.rs-1311414/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: K. pneumoniae is a common opportunistic pathogen responsible in clinical practice and an important pathogen of nosocomial infection. This study aimed to analyze the trend of antimicrobial susceptibility and virulent characteristics of K. pneumoniae isolated from sputum in clinics and to provide data for clinical treatment of K. pneumoniae infection disease.

Results: The resistance rates of the 20 K. pneumoniae isolates against 13 antibiotics ranged from 15.0% to 80.0%. The detection rate of ESBLs was up to 55%, and bla_SHV were the most prevalent ESBLs genes. Four strains (25.0%) of K. pneumoniae presented HMV phenotype, and 18 strains (90.0%) had the stronger biofilm-forming ability. wzi, wab_G, fim_H, mrk_Dwere the most prevalent virulence genes. 10 strains were present capsule typing and the higher genetic diversity of colonizing K. pneumoniae in this region. K₁₉ exhibited a strong positive correlation with imipenem resistance, and K₁ showed strong correlations with mag_A. HMV phenotype show significantly negative correlations with multidrug-resistant.

Conclusions: The antibiotic resistance of K. pneumoniae isolated from sputum in this hospital was serious, and these strains show the higher genetic diversity.

Klebsiella pneumoniae

antimicrobial resistance

resistant genes

virulent genes

biofilm-forming.

Klebsiella pneumoniae (K. pneumoniae) is a common opportunistic pathogen responsible in clinical practice and an important pathogen of nosocomial infection, leading to various types of infection, such as pneumonia, blood infection, urinary tract infection, and osteomyelitis.¹ The detection rate of Gram-negative pathogens was second only to Escherichia coli.² With the widespread use and even abuse of antibiotics in clinic, resistant strains were increasing year by year. In particular, the emergence of multidrug-resistant (MDR) strains led to the failure of clinical antibacterial treatment and the delay of the course of disease.³ This increased the medical costs of patients and the mortality of inpatients, which has emerged as an urgent threat to public health. A variety of virulence factors are utilized in the survival and immune escape of K. pneumoniae infection,⁴ such as capsular polysaccharide (CPS), lipopolysaccharide (LPS), fimbriae, iron acquisition and biofilm, etc. K. pneumoniae carrying different virulence factors show different pathogenic characteristics and clinical characteristics.⁵ The number of studies of clinically isolated K. pneumoniae has been increased dramatically in recent years.^6–8 However, there are limited studies about antibiotic resistance and molecular characteristics of K. pneumoniae isolated from sputum. Here we identify the antibiotic resistance and molecular characteristics of K. pneumoniae isolated from clinical sputum. This study aimed to obtain a better comprehension of the molecular epidemiological characteristics of K. pneumoniae in this region, which is of great clinical significance for the prevention and control of K. pneumoniae infection and transmission.

Antimicrobial susceptibility testing

The resistance of 20 strains of K. pneumoniae to 13 commonly used antibiotics was shown in Table 1. Overall, the antibiotic test range of the 20 strains ranged from 15.0% to 80.0%, with multidrug-resistant strains up to 70.0%. The strains showed the highest resistance to PIP (80.0%), followed by CTX (65.0%) and CIP (65.0%), and the lowest resistance to PIT (15.0%), followed by IPN (20.0%) and CFX (25.0%). The range of other antibiotics tested was around 50.0%.

Table 1. Antibiotic resistance profiles of K. pneumoniae isolated from sputum

Antibiotic agents	Resistance against 13 antibiotics
Antibiotic agents	Number of strains (n=20)	Resistant rates（%）
CAZ	10	50.0
CTX	13	65.0
CFX	5	25.0
PIP	16	80.0
AZT	9	45.0
PIT	3	15.0
CHL	9	45.0
IPN	4	20.0
DOX	8	40.0
K	8	40.0
GAT	10	50.0
LVF	9	45.00
CIP	13	65.0
MDR	14	70.0

ESBL phenotype and resistance genes of K. pneumoniae

Table 2 describes the distribution of antibiotic resistance genes in clinical K. pneumoniae. ESBLs-producing strains were prevalent in the region, with a detection rate of 55.0%, among which bla_SHV was the most widely distributed strain, while the other two strains were less detected. Only 3 bla_KPC positive strains of carbapenase genes were detected, but no other carbapenase genes were detected. Among plasmid-mediated quinolone resistance (PMQR) genes, qnr_A was not detected, while oqx_AB was distributed in almost all strains, aac and qnr_B were scattered, with detection rates of 40.0% and 25.0%, respectively. As shown in Table S1, bla_CTX-M +bla_TEM+aac+oqx_AB strains were widely distributed (30.0%), all of which were multidrug-resistant. 2/3 showed co-production of bla_KPC+bla_SHV+oqx_AB among bla_KPC-producing strains.

Table 2. Distribution of antibiotic resistance genes and ESBL phenotype in 20 strains of K. pneumoniae

Resistance genes	Distribution
Resistance genes	Number of strains(n=20)	Resistant rates (%)
ESBL phenotype	11	55.0
bla_SHV	12	60.0
bla_CTX-M	7	35.0
bla_TEM	8	40.0
bla_KPC	3	15.0
bla_NDM	0	0.0
bla_OXA-48	0	0.0
bla_IMP	0	0.0
qnr_A	0	0.
qnr_B	5	25.0
oqx_A	18	90.0
oqx_B	19	95.0
aac	8	40.0
bla_KPC+bla_SHV+oqx_AB	2	10.0
bla_CTX-M+bla_TEM+aac+oqx_AB	6	30.0

Virulence phenotypes and genes of K. pneumoniae

The results of the crystal violet staining showed that all 20 K. pneumoniae could form biofilms, and 18 strains (90.0%) had strong biofilms. String test showed that 5 strains (25.0%) presented the HMV phenotype. Table 3 characterizes the distribution of the virulence genes of K. pneumoniae strains isolated from sputum. The LPS-encoding wab_Ggene and CPS encoding wzi were present in all strains; The genes encoding type I fim_H, and type III mrk_D were 90% and 85%, respectively, and was pathogenic genes. iucA (35.0%) and iut_A (30.0%) were the genes encoding and regulating the aerobactin. The positive rates of mucoviscosity-associated genes rmp_A and mag_A were 25.0% and 10.0%, respectively.

Table 3. Distribution of virulence genes of K. pneumoniae from sputum

Distribution	Virulence phenotypes		Virulence genes
Distribution	BF	HMV	wzi	rmp_A	mag_A	wab_G	fim_H	mrk_D	iuc_A	iut_A
Number of positive strains	20	5	20	5	2	20	18	17	7	6
positive rates (%)	100	25	100.0	25.0	10.0	100.0	90.0	85.0	35.0	30.0

Abbreviation: BF：Biofilm；HMV：hypermucoviscous phenotype.

Capsular serotypes and wzi phylogenetic tree

Among 20 K. pneumoniae isolates, 10 strains were identified as K1 (2 strains), K19 (2 strains), K17, K23, K24, K46.61, K14.64, and K43 (1 strain). Other 10 strains were unknown capsular serotyping, which belong wzi 168, wzi84, wzi679, wzi206, wzi187, wzi209, wzi150, wzi516, wzi275, and wzi401. Each sequence corresponds to a distinct wzi allele, as indicated. The allele number is followed by the corresponding capsular types. The phylogenetic tree showed more branches and higher genetic diversity (Fig.1).

Figure 1. Phylogenetic tree of wzi sequence of clinical isolates of K. pneumoniae

Analysis of the correlations

Pearson’s correlation analysis was used to assess the existence the potential correlation between antibiotic-resistant phenotypes and molecular characteristics of K. pneumoniae strains. Figure 2 suggests that the MDR was significantly positively correlated with bla_TEM (r = 0.535, p < 0.05), bla_CTX-M (r = 0.480, p < 0.05) and aac (r = 0.535, p < 0.05), and negative correlations with HMV (r = 0.630, p < 0.05) and rmp_A (r = 0.630, p < 0.05). HMV exhibitedpositive correlations with rmp_A(r = 1.000, p < 0.001), iuc_A(r = 0.545, p < 0.05), iut_A(r = 0.630, p < 0.05) and mag_A(r = 0.577, p < 0.05). SBF was positively correlated with mrk_D (r = 0.327, p < 0.05). Some molecular types displayed positive or negative correlations with several resistance and virulence genes. K19 and CR (r = 0.667, p < 0.001), bla_KPC (r = 0.793, p < 0.001) displayed a strong positive correlation with BF (r = -1.000, P < 0.001), and a negative correlation with mrk_D (r = 0.327, p < 0.05). K1 was completely correlated with mag_A(r = -1.000, p < 0.001). According to Figure 2, virulence genes rmp_A and iut_A(r = 0.630, p < 0.05) showed significantly positive correlation, and all antibiotic resistance phenotypes had huge correlation with their genes.

Figure 2. Pearson’s correlation analysis between phenotypes and genotypes of K. pneumoniae

Reports of antibiotic resistance of K. pneumoniae isolated from sputum have increased year by year.^6-8 But studies on molecular characteristics are still rare. In this study, 20 strains of K. pneumoniae (19 from sputum and 1 from alveolar lavage fluid) were collected from the affiliated people’s hospital of Xinxiang Medical University, Henan Province, China. The antibiotic susceptibility results showed that K. pneumoniae isolated from sputum showed high resistance to 15 antimicrobials. The resistance rate to PIP was the highest (80.0%), IPN and PIT were lower (20.0%,15.0%respectively), ESBLs-producing strains accounted for up to 55.0%. These results are consistent with literature reports.^6,9-10 In previous studies, resistance rates of cephalosporins and quinolone antibiotics were less than 40.0%, and carbapenems were less than 10.0%. In this study, K. pneumoniae strains exhibited a higher prevalence of resistance than in the above study. We analyzed that the differences might be related to the molecular characteristics and prevalent antibiotic usage habits in the region. Therefore, combined with the antimicrobial resistance gene of this study and the investigation of antibiotics in patients, further analysis of the reasons.

Many antibiotic resistance genes are involved in the occurrence of drug resistance of K. pneumoniae, and we studied the mechanism of antibiotic resistance commonly used in clinical practice. β-lactam antibiotics are the most widely used antibiotics in clinic, among which ESBLs production is the main mechanism of antibiotic resistance. In this study, ESBLs-producing strains were absolutely multiresistant, which supports the conclusion that the resistance of ESBLs-producing bacteria was enhanced, consistent with the studies report.^11-12 bla_SHV is more widely distributed among genes encoding ESBLs resistance, which may be the main mechanism of ESBLs epidemic distribution in this region. Carbapenems are the last line of defense for the treatment of ESBLs-producing Gram-negative pathogen infection. The main mechanism of antibiotic resistance is the production of carbapenemases that can hydrolyze penicillins, cephalosporins, monocyclic β lactamides, aminoglycosides, quinolones, and other antibiotics.¹³ Only 3 K. pneumoniae of KPC-producing carbapenemases were detected in this study, which was resistant to all antibiotics except chloramphenicol and doxycycline. Details of antibiotics refer to Table S2. Fluoroquinolones are a class of powerful broad-spectrum antibiotics that have been used to treat severe or antibiotic-resistant infections since the end of the 20th century.¹⁴ However, with the widespread use and abuse of antibiotics in recent years, the resistance rate of the pathogen to fluoroquinolones has been increasing, and in this study has reached about 50%. Studies by Liam S. Redgrave et al showed that the prevalence of PMQR genes among strains was not affected by quinolone antibiotics selection,¹⁴ which may be the key to the rapid spread of resistance. In this study, qnr_Awas not detected, qnr_B and aac were scattered, while the detection rate of oqx_ABwas high, which was consistent with some reports.^15-16

The emergence of MDR strains has caused great difficulties in the clinical treatment of infection caused by K.pneumoniae. The study of MDR mechanism is of great significance for reducing the fatality rate, improving the spread of MDR strains, and delaying the occurrence of pan-resistant strains. In this study, the rate of multidrug-resistant K.pneumoniae has reached 70.0%, and antibiotic resistance genes bla_CTX-M, bla_TEM, and aac are closely related to multidrug-resistant strains. Moreover, these three genes are plasmid-mediated antibiotic resistance genes,¹⁷ and strains co-producing three genes account for 30.0%, which may be crucial genes for spreading multiresistant strains in this region. Studies have reported that PMQR gene is usually carried on the plasmids of other antibiotic resistance genes, especially ESBLs.¹⁵ Therefore, we speculated that the above-mentioned epidemic resistance genes in this region may be located in the same plasmid and spread, the specific mechanism needs further study.

The main virulence factors of K. pneumoniae included capsular (CPS), lipopolysaccharide (LPS), pili, and iron carriers, which are also the main factors leading to the characteristics of hypervirulent K. pneumoniae (hvKP).¹⁸ Many genes encoding these virulence factors have been reported, and some representative genes were selected for amplification in this study. The results showed that HMV phenotype was strongly correlated with rmp_A, map_A, iuc_A and iut_A, which was consistent with some studies: rmp_A and mag_A regulated the expression of CPS, which was closely related to the high HMV phenotype of K. pneumoniae.^18-19 iuc_A codes aerobactin, and iut_A codes aerobactin transporter,²⁰ closely related to high virulence.¹⁹ wzi and wab_G have been detected in 20 strains of K.pneumoniae, wzi encodes outer membrane protein Wzi and is involved in the attachment of the CPS to the outer membrane²¹and wab_G gene encodes Wab_G protein and is involved in the synthesis of LPS.²² The detection rates of fim_H and mrk_D genes encoding type I and III pili were 90% and 85%, respectively. The detection rate of the above four genes is high, which is consistent with the report.^6,15,23 All K. pneumoniae in this study can form biofilms, which may be related to the source of samples. Type I and III pili are crucial factors for K. pneumoniae colonization, and fim_Hencodes Fim_H adhesion molecule at the tip of type 1 pili,²³ which is closely related to urinary tract infection.²⁴ mrk_D encodes adhesive subunit located at the tip of type 3 hair,²⁵ and mediates the binding of K. pneumoniae with organ cells and lung tissues,²⁶ which is related to lung infection. Studies have shown that type 3 pili have been proved to play a major role in the formation of biofilms,²⁴ which is consistent with the results of this study.

Correlation analysis showed a strong correlation between the distribution of iut_A and rmp_A, which may be related to the fact that both are located in the same pLVPK plasmid.²⁷ Studies have shown that mag_A encodes CPS polymerase specific to K1 type,²⁸ K1 serotype and mag_A also showed an absolute correlation in this study. Serotype K19 was strongly correlated with bla_KPC, which might be the main epidemic serotype of carbapenase in the local area. The antibiotic resistance of K. pneumoniae was generally negatively correlated with the distribution of virulence characteristics, in which the multiresistant strains exhibited negative correlations with virulence phenotypes and genes, and the HMV phenotype was negatively correlated with antibiotic resistance phenotypes and genes, which was consistent with the literature reports.²⁹ KP13 is a multiresistant strain of capsular serotype K1, carrying three types of ESBLs antibiotic-resistant genes in this study, which seriously endangers public health. Studying the prevalence mechanism of antibiotic resistance and virulence factors has crucial implications.

In conclusion, our study describes antibiotic resistance and virulence characteristics of 20 Strains of K.pneumoniae isolated from sputum from Henan, China. The results showed that local K. pneumoniae had severe drug resistance, and antibiotic resistance genes bla_CTX-M, bla_TEM and aac were the main mechanisms. Virulence genes magA, rmpA, iucA and iutA were crucial influencing factors of HMV. In general, virulence exhibited significant negative correlations with antibiotic resistance factors, and some strains exist at the same time. Therefore, investigate their transmission mechanism to effectively slow down the emergence of such strains and reduce medical costs is necessary.

Bacterial isolates

A total of 20 K. pneumoniae (19 from sputum and 1 from alveolar lavage fluid) were collected from the affiliated people’s hospital of Xinxiang Medical University, Henan Province, China. The isolates were identified according to the National Clinical Examination Procedures, and the isolates were numbered KP1-KP20 in sequence.

Antibiotics and Reagents

Following antibiotics were used in this study: Ceftazidime (CAZ,30μg), Ceftazidime-clavulanic acid (CAC,30μg/10μg), Cefotaxime (CTX,30μg), Ceftazidime-clavulanic acid (CTC,30μg/10μg), Cefoxitin (CFX,30μg), Aztreonam (AZT,30μg), Piperacillin-tazobactam (PIT,100μg/10μg), Piperacillin (PIP,100μg)，Imipenem (IPN,10μg)，Doxycycline (DOX,30μg)，Chloramphenicol (CHL,30μg)，Ciprofioxacin (CIP,5μg)， Levofloxacin (LVF,5μg)，Gatifloxacin (GAT,5μg)，Kanamycin（KAN, 30μg）. LB agar plates and Columbia blood agar plates were purchased from Guangzhou Huankai Microbiology Technology Limited Company. The reagents of PCR were purchased from Kangwei Century Co., Ltd. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The primer sequences are shown in Table 4 and Table 5.

ESBLs Phenotype confirmation tests

ESBLs phenotypes of 20 Strains of K. pneumoniae were detected by the combined disc test (CDT) recommended by CLSI 2020. Briefly, the bacteria with turbidity equivalent to 0.5 McFarland standards were swabbed onto MH agar plates containing 30 μg of CTX and CAZ, with and without 10 μg of clavulanic acid, were placed independently, 25 mm apart (center to center) on a lawn culture. The plates were incubated at 37 °C for up to 16-18 h. Isolates were considered ESBL positive if the inhibition zone measured around one of the combination discs was at least 5 mm larger than the corresponding cephalosporin disc.

Antimicrobial susceptibility testing

The sensitivity of K. pneumoniae isolates against 13 kinds of antibiotics was determined by the disc diffusion method recommended by CLSI. Drug sensitivity results were determined according to CLSI 2020 criteria. In the antimicrobial sensitivity test results, the strain resistant to more than 3 antibiotics is considered MDR bacteria.

Amplify antimicrobial resistance genes

Bacterial DNA template was extracted by the water boiling method. Briefly, bacteria were inoculated and cultured overnight in LB liquid medium at 37 ℃. 1 ml bacterial culture was added into the 1.5 mL EP tube, centrifuged at 12,000 RPM for 2 min, and the supernatant was discarded and resuspended in 500 μL water, then centrifuged again under the same conditions, and the supernatant was discarded. Add 200 μL water, boiling at 100 ℃, 20-30 min to lysate thallus. Freezing for 10-15 min and centrifugated at 12,000 rmp at 4 ℃ for 15 min. The supernatant (genomic DNA) was extracted into the new EP tube and stored at -20 ℃. The following resistant genes of K. pneumoniae were amply by PCR, including encode ESBLs (bla_CTX-M, bla_TEM, bla_SHV), carbapenemase genes (bla_KPC, bla_NDM, bla_OXA-48, bla_IMP), quinolones resistance genes (qnr_A,qnr_B,oqx_A,oqx_B), aminoglycoside resistance gene (aac). The primers information of these resistance genes is shown in Table 4.

Table 4. PCR primers sequence information of antimicrobial resistance genes

gene	primer sequence	product size (bp)	Ta opt(℃)	references
bla_CTX-M	P1: TCGGGAGGCAGACTGGGTGT P2: CCTTAGGTTGAGGCTGGGTGA	688	57.7
bla_TEM	P1: TCGCCGCATACACTATTCTCAG P2: ACGCTCACCGGCTCCAGATTTAT	445	55.1	30
bla_SHV	P1: ATGCGTTATATTCGCCTGTG P2: TGCTTTGTTATTCGGGCCAA	753	58.4	30
bla_KPC	P1: ATGTCACTGTATCGCCGTC P2: TTACTGCCCGTTGACGCC	882	57.0
bla_IMP	P1: CTTGATGAAGGCGTTTATGT P2: GCCAAGCTTCTATATTTGCGT	496	50.9
bla_NDM	P1: CCAGCTCGCACCGAATG P2: AACGCCGCACCAAACG	564	58.8
bla_OXA-48	P1: ACATAAATCACAGGGCGTAG P2: TATAGTCACCATTGGCTTCG	500	51.4
qnr_A	P1: CAAGAGGATTTCTCACGCCAGGAT P2: TCGGCAAAGGTCAGGTCACAGC	521	58.9
qnr_B	P1: GCACTGAATTTATCGGCTGTC P2: CAACGATGCCTGGTAGTTGT	500	53.4
oqx_A	P1: TCCATACCAACCTCGTCTCCC P2: AGCGTGGCTTTGAACTCTGC	529	59.8
oqx_B	P1: TGGTGGAGAACGTCGAGCGTAA P2: TCGGCGTGTTGGTGAACTGC	648	60.4
aac	P1: AGTACAGCATCGTGACCAACA P2: CTCGAATGCCTGGCGTGTTT	545	55.8	18

PS: Primer sequences without reference were obtained by primer 5.0 design (same below)

Determination of Mucinous phenotype

The mucinous phenotype of K. pneumoniae was analyzed by “String-forming test” according to previous. Briefly, K. pneumoniae was transferred to Columbia blood plate for overnight culture at 37 ℃. Dip the colony was with the inoculum ring, then lift the inoculum ring. If the adhesive wire formed was larger than 0.5 cm, it was judged as positive; otherwise, it was negative. The strain with high mucilage phenotype was positive in the “String-forming test”.

Analysis of biofilm formation ability

Biofilm-forming ability was measured by the determination of adhesion to flat-bottomed microtiter plates (96-well).³¹ Briefly, each well of the 96-well microtitration plates was filled with 200 μl sterile broth liquid medium. Bacterial cultures during biofilm formation (18 h incubation) was added to each well(1:100 in liquid medium, 200 μl liquid medium). Only liquid medium was used as a negative control. After incubation at 37 °C for 48 h, total cell mass was measured as absorbance at 570 nm (OD₁) while the blank was OD₁₀. Each well was washed three times with PBS, dried for 1 h at 60 °C and stained for 20 min with 200 μl of 1% crystal violet. After the crystal violet solution was removed, each well was washed with PBS 4 times to remove the remaining stain. Air dried in the aseptic processing table for 30 mins, each well was added with 200 μl of 95% ethanol. After vibrating for 30 min, the absorbance was measured at 570 nm (OD₂), while the blank was OD₂₀. The biofilm formation capacity was calculated by B=(OD₂-OD₂₀)/(OD₁-OD₁₀). All the strains were classified based on the adherence capabilities into the following categories: nonbiofilm producers (B < 0.1) , weak biofilm producers (B ≥ 0.1), moderate biofilm producers (0.1 < B ≤ 1.0)，strong biofilm producers (B > 1.0).

Analysis capsular serotypes and virulence genes

Amplification of wzi genes for detection of capsular polysaccharide (antigen K) serotype is a new method for capsular serotyping, which has been used in the laboratory. In this study, wzi primers were provided for expanded PCR amplification according to document,²¹ and the products were sent to Bioengineering (Shanghai) incorporated company for sequencing. Sequencing results submitted Institut Pasteur website³² for comparative analysis, obtained strain wzi parting and part of capsular serotyping. Virulence genes were detected by PCR, including encoding capsular polysaccharide (wzi), adhesin (fim_H，mark_D), lipopolysaccharide (wab_G), mucous phenotypic related genes (rmp_A,mag_A), and ferritin genes (iuc_A,iut_A). PCR primer information of virulence genes is shown in Table 5.

Table 5. PCR primer sequence information of virulence genes

Gene	Primer sequence	Product size (bp)	Ta opt（℃）	References
wzi	P1:GTGCCGCGAGCGCTTTCTATC TTG GTATTCC P2:GAGAGCCACTGGTTCCAGAA[CorT]TT[CorG]ACCGC	580	55	21
mag_A	P1：GGTGCTCTTTACATCATTGC P2：GCAATGGCCATTTGCGTTAG	1282	58	33
rmp_A	P1：ACTGGGCTACCTCTGCTTCA P2：CTTGCATGAGCCATCTTTCA	516	58	34
iuc_A	P1: CCCGCTTCCCTACTTT P2: ATTCGCTTCGCTGTCC	575	54.8
iut_A	P1：GGCTGGACATCATGGGAACTGG P2：CGTCGGGAACGGGTAGAATCG	300	55	34
wab_G	P1：ACCATCGGCCATTTGATAGA P2：CGGACTGGCAGATCCATATC	683	49	34
fim_H	P1：TGCTGCTGGGCTGGTCGATG P2：GGGAGGGTGACGGTGACATC	688	49	34
mark_D	P1：TTCTGCACAGCGGTCCC P2：GATACCCGGCGTTTTCGTTAC	480	49	34

Statistical analysis

Clustal W 2.1 was used to complete the alignment of wzi gene sequence. Initial phylogenetic trees were constructed using MEGA 7 based on the neighbor-joining method (500 bootstrap replicates) and Jukes-Cantor distance. Pearson correlation analysis was conducted by SPSS software, version 19.0, and data were plotted using Hiplot³⁵ for correlation Heatmap.

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Availability of data and materials

The datasets supporting the conclusions of this article are included within the article (and its additional files).

Competing interests

The authors declare that they have no competing interests

Funding

This research was supported by Science and Technology Research Project of Henan Province (grant 182102310553).

Authors' contributions

YH completed the acquisition, analysis, interpretation of data and the creation of new software used in the work,and was a major contributor in writing the manuscript.

YJ completed the methodology,the data curation,the formal analysis and the visualization.

HMI completed language editing and polishing.

Wenke Liu completed the data curation,the resources and the investigation.

Wei Liao completed the conceptualization,the supervision，the validation and the writing - review & editing.

CP completed the supervision，the validation and the writing - review & editing.

FY completed the conceptualization,the funding acquisition，the validation and the writing - review & editing.

All authors read and approved the final manuscript.

Acknowledgements

Not applicable.

1. Martin RM, Bachman MA. Colonization, Infection, and the Accessory Genome of Klebsiella pneumoniae. Front Cell Infect Microbiol. 2018;8:4.

2. Tantry BA, Rahiman S. Antibacterial resistance and trend of urinary tract pathogens to commonly used antibiotics in Kashmir Valley. West Indian Med J. 2012;61(7):703-707.

3. Karaiskos I, Giamarellou H. Multidrug-resistant and extensively drug-resistant Gram-negative pathogens: current and emerging therapeutic approaches. Expert Opin Pharmacother. 2014;15(10):1351-1370.

4. Li B, Zhao Y, Liu C, Chen Z, Zhou D. Molecular pathogenesis of Klebsiella pneumoniae. Future Microbiol. 2014;9(9):1071-1081.

5.Russo TA, Marr CM. Hypervirulent Klebsiella pneumoniae. Clin Microbiol Rev. 2019;32(3):e00001-19.

6. Wyres KL, Nguyen TNT, Lam MMC, et al. Genomic surveillance for hypervirulence and multi-drug resistance in invasive Klebsiella pneumoniae from South and Southeast Asia. Genome Med. 2020;12(1):11.

7. Imai K, Ishibashi N, Kodana M, et al. Clinical characteristics in blood stream infections caused by Klebsiella pneumoniae, Klebsiella variicola, and Klebsiella quasipneumoniae: a comparative study, Japan, 2014-2017. BMC Infect Dis. 2019;19(1):946.

8. Zhang H, Zhang G, Yang Y, et al. Antimicrobial resistance comparison of Klebsiella pneumoniae pathogens isolated from intra-abdominal and urinary tract infections in different organs, hospital departments and regions of China between 2014 and 2017. J Microbiol Immunol Infect. 2021;54(4):639-648.

9.Vuotto C, Longo F, Pascolini C, et al. Biofilm formation and antibiotic resistance in Klebsiella pneumoniae urinary strains. J Appl Microbiol. 2017;123(4):1003-1018.

10.Soltani E, Hasani A, Rezaee MA, et al. Virulence characterization of Klebsiella pneumoniae and its relation with ESBL and AmpC beta-lactamase associated resistance. Iran J Microbiol. 2020;12(2):98-106.

11.Gautam V, Thakur A, Sharma M, et al. Molecular characterization of extended-spectrum β-lactamases among clinical isolates of Escherichia coli & Klebsiella pneumoniae: A multi-centric study from tertiary care hospitals in India. Indian J Med Res. 2019;149(2):208-215.

12.Yazdansetad S, Alkhudhairy MK, Najafpour R, et al. Preliminary survey of extended-spectrum β-lactamases (ESBLs) in nosocomial uropathogen Klebsiella pneumoniae in north-central Iran. Heliyon. 2019;5(9):e02349.

13.Queenan AM, Bush K. Carbapenemases: the versatile beta-lactamases. Clin Microbiol Rev. 2007;20(3):440-458.

14.Redgrave LS, Sutton SB, Webber MA, Piddock LJ. Fluoroquinolone resistance: mechanisms, impact on bacteria, and role in evolutionary success. Trends Microbiol. 2014;22(8):438-445.

15.Silva-Sánchez J, Cruz-Trujillo E, Barrios H, et al. Characterization of plasmid-mediated quinolone resistance (PMQR) genes in extended-spectrum β-lactamase-producing Enterobacteriaceae pediatric clinical isolates in Mexico. PLoS One. 2013;8(10):e77968.

16.Yuan J, Xu X, Guo Q, et al. Prevalence of the oqxAB gene complex in Klebsiella pneumoniae and Escherichia coli clinical isolates. J Antimicrob Chemother. 2012;67(7):1655-1659.

17.Wang G, Zhao G, Chao X, Xie L, Wang H. The Characteristic of Virulence, Biofilm and Antibiotic Resistance of Klebsiella pneumoniae. Int J Environ Res Public Health. 2020;17(17):6278.

18.Piekarska K, Wołkowicz T, Zacharczuk K, et al. Co-existence of plasmid-mediated quinolone resistance determinants and mutations in gyrA and parC among fluoroquinolone-resistant clinical Enterobacteriaceae isolated in a tertiary hospital in Warsaw, Poland. Int J Antimicrob Agents. 2015;45(3):238-243.

19.Clegg S, Murphy CN. Epidemiology and Virulence of Klebsiella pneumoniae. Microbiol Spectr. 2016;4(1):10.1128.

20.Russo TA, Olson R, Macdonald U, et al. Aerobactin mediates virulence and accounts for increased siderophore production under iron-limiting conditions by hypervirulent (hypermucoviscous) Klebsiella pneumoniae. Infect Immun. 2014;82(6):2356-2367.

21.Brisse S, Passet V, Haugaard AB, et al. wzi Gene sequencing, a rapid method for determination of capsular type for Klebsiella strains. J Clin Microbiol. 2013;51(12):4073-4078.

22.Izquierdo L, Coderch N, Piqué N, et al. The Klebsiella pneumoniae wabG gene: role in biosynthesis of the core lipopolysaccharide and virulence. J Bacteriol. 2003;185(24):7213-7221.

23.Kline KA, Dodson KW, Caparon MG, Hultgren SJ. A tale of two pili: assembly and function of pili in bacteria. Trends Microbiol. 2010;18(5):224-232.

24.Hornick DB, Thommandru J, Smits W, Clegg S. Adherence properties of an mrkD-negative mutant of Klebsiella pneumoniae. Infect Immun. 1995;63(5):2026-2032.

25.Clegg S, Murphy CN. Epidemiology and Virulence of Klebsiella pneumoniae. Microbiol Spectr. 2016;4(1):10.1128.

26.Paczosa MK, Mecsas J. Klebsiella pneumoniae: Going on the Offense with a Strong Defense. Microbiol Mol Biol Rev. 2016;80(3):629-661.

27.Tang HL, Chiang MK, Liou WJ, et al. Correlation between Klebsiella pneumoniae carrying pLVPK-derived loci and abscess formation. Eur J Clin Microbiol Infect Dis. 2010;29(6):689-698.

28.Lin TL, Yang FL, Yang AS, et al. Amino acid substitutions of MagA in Klebsiella pneumoniae affect the biosynthesis of the capsular polysaccharide. PLoS One. 2012;7(10):e46783.

29.Lee CR, Lee JH, Park KS, et al. Antimicrobial Resistance of Hypervirulent Klebsiella pneumoniae: Epidemiology, Hypervirulence-Associated Determinants, and Resistance Mechanisms. Front Cell Infect Microbiol. 2017;7:483.

30.Monstein HJ, Ostholm-Balkhed A, Nilsson MV, Nilsson M, Dornbusch K, Nilsson LE. Multiplex PCR amplification assay for the detection of blaSHV, blaTEM and blaCTX-M genes in Enterobacteriaceae. APMIS. 2007;115(12):1400-1408.

31.Rode TM, Langsrud S, Holck A, Møretrø T. Different patterns of biofilm formation in Staphylococcus aureus under food-related stress conditions. Int J Food Microbiol. 2007;116(3):372-383.

32.Institut Pasteur website. https://bigsdb.pasteur.fr/klebsiella/klebsiella.html Accessed 1 June 2021.

33.Fang CT, Chuang YP, Shun CT, Chang SC, Wang JT. A novel virulence gene in Klebsiella pneumoniae strains causing primary liver abscess and septic metastatic complications. J Exp Med. 2004;199(5):697-705.

34.Candan ED, Aksöz N. Klebsiella pneumoniae: characteristics of carbapenem resistance and virulence factors. Acta Biochim Pol. 2015;62(4):867-874.

35.Hiplot. https://hiplot.com.cn Accessed 28 August 2021.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Molecular Characterization of Klebsiella Pneumoniae Isolated From Sputum

Status:

Version 1

Abstract

Figures

Background

Results

Discussion

Conclusions

Methods

Declarations

Authors' contributions

Acknowledgements

References

Additional Declarations

Supplementary Files

Status:

Version 1