RNA extraction and reverse transcription-quantitative PCR (RT-qPCR). Total RNA extraction from cells and cDNA synthesis were performed as above. Quantitative polymerase chain reaction was performed on an ABI StepOne real-time PCR system (Applied Biosystems) using cDNA as the template with Forget-Me-Not qPCR Master Mix (Biotium). The conditions were as follows: 95°C for 2 min, followed by 35 cycles of 95°C for 5 s and 60°C for 30 s. The RT-qPCR primers included: for CtBP1 forward, 5’-TCACAGGCCGGATCCCAGACAG-3’, and reverse, 5’- GGTACCTATAGGCAGCCCCATTGAGC-3’; CtBP2 forward, 5’-ATCCACGAGAAGGTTCTAAACGA-3’, and reverse: 5’-CCGCACGATCACTCTCAGG-3’; and β-actin forward, 5’- CTCCATCCTGGCCTCGCTGT-3’, and reverse, 5’- GCTGTCACCTTCACCGTTCC -3’.
Western blotting. Total proteins were extracted from the cells and separated by SDS-polyacrylamide gels, and transferred to PVDF membrane. The membranes were blocked with 3% BSA. Target proteins were detected by incubating the membranes with the following primary antibodies at 37˚C for 2 h: anti-human CtBP2 (#8684), anti-human CtBP2 (#13256), anti-human phospho-Stat1 (p-Stat1) (#9167), anti-human Stat1(#14995), anti-human phospho-JAK2(P-JAK2) (#74129), anti-human gp130 (#3732) and anti-human JAK2 (#3230). The antibodies were raised in rabbits and were purchased from Cell Signaling Technology. Following washing 3 times with PBST, the membranes were incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (Cell Signaling Technology, Inc.) at a 1:1,000 dilution for another 2 h. Finally, the proteins were visualized using the Pierce ECL western blotting substrate (Thermo Fisher).
Patients and tissue specimens. The current study was performed with the approval of the Research Ethics Committee of the First Hospital of Jilin University. The participants signed written informed consent prior to their participation in the current study. The tissues including 25 cases of normal human skin, 102 cases of actinic keratosis (AK) specimens and 104 cases of cSCCs specimens were gathered from patients who underwent surgical resection at the First Hospital of the Jilin University between June 2005 and July 2012. The patients were selected based on the following criteria: pathological diagnosis of cSCCs; absence of prior and/or second tumor; no history of chemotherapy and radiotherapy. All excised tissues were immediately frozen in liquid nitrogen and stored at -80˚C. The clinicopathological parameters of the cSCCs patients were clarified in Table I.
Immunohistochemistry. An immunohistochemical assay was carried out as described previously [20]. The antibodies used were as follows: rabbit anti-human CtBP2 (#13256, Cell Signaling Technology, Inc.) and rabbit anti-human p-Stat1 (#9167, Cell Signaling Technology, Inc.). The negative control sample was incubated with isotype antibodies at the same dilution (1:400) as that used for the CtBP2 and the p-Stat1 antibodies. The expression levels of CtBP2 and p-Stat1 in the nucleus were considered as positive expression of CtBP2. Staining was assessed, and scoring of CtBP2 and p-Stat1 protein expression levels was semi-quantified based on the total combined percentage of positively stained tumor cells and the staining intensity, as previously described [21]. All patients who underwent surgery or adjuvant chemotherapy were followed up for a period of 5 years on an outpatient basis or by telephone interviews to confirm the life status of each patient. These data were assessed by Kaplan-Meier survival analysis, which evaluated the 5-year survival rate. Patients who died due to diseases other than cSCCs were excluded from the present study.
Cell culture and transfection. Human benign epidermal keratinocyte cell line (HEKa), and cSCC cell line (A431) were seeded in DMEM containing 10% FBS. All cells were cultured at 37˚C in 5% CO2. CtBP2 vector and control vector were bought from Shanghai Genechem Co., Ltd. CtBP2 vectors were transfected into cSCC cells and using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) following the manufacturer’s instructions. G418 (Sigma-Aldrich; Merck KGaA) was used to expand G418-resistant clones in culture as a monoclonal population.
The transfer plasmid pCDH-ECMV-MCS-3×FLAG-EF1α-ZsGreen1-T2A-Puro, the pCDH-CtBP2 transfer plasmid, the helper plasmids psPAX2 and pMD2.G were purchased from MiaoLingBio, Wuhan, China. To product the CtBP2 overexpression lentivirus, the pCDH-CtBP2 transfer plasmid, the helper plasmids psPAX2 and pMD2.G were transfected into HEK-293T cells by using Lipofectamine 3000 (Invitrogen) according to the manufacturer's instructions. Two days after transfection, the supernatant of the cell culture was collected and filtered through 0.45 μm filter membrane (Millipore) to obtain the packaged lentivirus particles. The HEKa cells were infected using the packaged lentivirus particles in the presence of 6 μg/ml polybrene (Sigma). After infection for 24 h, the medium was changed to RPMI-1640 with 4 μg/ml of puromycin. In the next week, the medium was changed to RPMI-1640 with 2.5 μg/ml of puromycin. The CtBP2-overexpression stable cells (named CtBP2) were obtained after five passages. The HEKa cells infected with the empty lentivirus were used as the control.
Immunofluorescence. The cells were washed 3 times with PBS, fixed with 4% paraformaldehyde for 10 min at room temperature, permeabilized with 0.1% Triton X-100, and blocked in PBS with 2% bovine serum albumin for 1 h. The staining was performed with a rabbit anti-human CtBP2 antibody. Images were obtained using an Olympus IX81 microscope with an MT20/20 illumination system.
Cell Counting Kit-8 (CCK8) assay. Cell proliferation was analyzed using a CCK-8 kit (Beyotime). In brief, cells were cultured in 96 well culture plates. After certain time periods, 10 μl-aliquots of the CCK-8 reagent were added to the wells and incubated at 37°C for 2 h. The absorbance values were then measured at 450 nm using a Multiskan GO microplate reader (Thermo Scientific).
Colony formation assays under 2D culture conditions. Colony formation assays were carried out as described previously [20]. The cells were maintained in 60-mm cell dishes at a density of 600 cells per dish until visible colonies had formed.
Transwell matrix penetration assay. The cell invasive activity was evaluated using transwell chambers (BD Biosciences) in 24-well plates. Briefly, A431, Huh1 and HEKa cells supplemented with serum-free medium were added into the upper chambers, which were pre-coated with Matrigel (BD Biosciences; #356234) and incubated at 37C for 30 min. The bottom chambers were filled with complete medium containing 10% FBS. Approximately 16 h after the initial incubation, the cells on the top side of the membrane were removed with a cotton swab, and those on the basal side were fixed and stained with hematoxylin & eosin (Sigma). Subsequently, the invaded cells were counted in six random visual fields using a microscope (Olympus).
Cell Scratch assay. The cells were incubated in RPMI 1640 medium (Gibco) containing 10% FBS (Gibco) at 37˚C. The monolayer was cultured to 90% confluence in 6-well plates (Costar). Subsequently, the monolayer was scratched using a 20 μl pipette tip and washed three times with PBS. The scratches were imaged in the same field of view at 0, 12 and 24 h using a light microscope (E100; Nikon Corporation; magnification, x200).
Short hairpin RNA (shRNA) transfection. Silencing of CtBP2 or gp130 in cSCCs cells was conducted using shRNA. The pGCSIL-CtBP2-shRNA or pGCSIL-gp130-shRNA plasmid was used to silence the expression of CtBP2 or gp130, and the pGCSIL-scramble plasmid was used as negative control. The pGCSIL-CtBP2-shRNA, pGCSIL-gp130-shRNA, pGCSIL-scramble, pGCSIL-green fluorescent protein (GFP), the VSVG expression plasmid, the virion-packaging elements (pHelper 1.0), and the frozen glycerol bacterial stocks were purchased from Shanghai GenePharma Biotech Co., Ltd. Transfection was performed as described previously [22].
Statistical analysis. P<0.05 was considered to indicate a statistically significant difference. The data are presented as the mean ± standard deviation. The comparisons between the two groups were assessed using a Student’s t-test. One-way analysis of variance followed by a Dunnett's multiple comparison test were used for multiple group comparisons. The association between the survival rate of cSCCs patients and CtBP2 expression levels was investigated using Kaplan-Meier survival curves and the log-rank test. The χ2 test was used to assess the association of clinical case indicators with the survival rate of the patients.