Participants and Clinical Samples
This case-control study included 65 participants with a BCC or SCC within 3 months of diagnosis who were visited at the dermatology clinics at Razi Hospital of Tehran University of Medical Sciences in a period between September 2016 and April 2018. The controls were composed of 65 unrelated healthy volunteers who were matched for age and sex to the patients with NMSC (Table I). All participants completed a questionnaire including information on marital status, education level, medication and supplement use history, disease history, sunscreen use and mean hours of daily sun exposure. Participants who were taking any nutritional supplement including vitamin D, calcium, omega-3 and antioxidant, or medications that modify vitamin D metabolism (corticosteroids, estrogens and calcitonin) for at least 3 months preceding the study, history of any other cancers and renal or liver diseases were excluded from the study. Fasting blood samples were obtained from all participants for DNA genotyping and biochemical analyses. The study procedures were approved by the Research Council and the Ethical Committee of the National Nutrition and Food Technology Research Institute (NNFTRI), respectively. All participants signed a written informed consent form.
Anthropometry and blood pressure
Weight was measured with light clothing and without shoes using a digital scale (Seca 808; Seca, Hamburg, Germany) to the nearest of 0.1 kg. Height was measured using a stadiometer (Seca 216, Seca, Hamburg, Germany) to the nearest of 0.1 cm. Body mass index (BMI) was calculated using the equation body weight (kg)/height2 (m). BMI was categorized as follows: underweight (< 18.5), normal (18.5–24.9) and overweight (> 25.0) in accordance with the 2004 World Health Organization (WHO) recommendations.
Hip circumference (HC) and waist circumference (WC) were both measured by a measuring tape to the nearest 0.1 cm. WC was measured at the approximate midpoint between the lowest rib and iliac crest after a normal expiration. Hip circumference (HC) was also measured at the level of the greater trochanters. Systolic blood pressure (SBP) and diastolic blood pressure (DBP) were measured using a digital sphygmomanometer (BC08; Beurer GmbH, Ulm, Germany).
Laboratory investigations
Glycemic status and lipid profile
Fasting serum glucose, total cholesterol, triglycerides (TG), high-density lipoprotein cholesterol (HDL-C) and low-density lipoprotein cholesterol (LDL-C) were determined using enzymatic colorimetric methods (all from Pars Azmoon, Tehran, Iran). Serum insulin was measured by means of an enzyme immunoassay (EIA) kit (Demeditec Diagnostics GmbH, Kiel, Germany). Homeostasis model assessment of insulin resistance (HOMA-IR was used as an index of insulin resistance and was calculated by the following formula (37):
HOMA-IR= ((fasting insulin (mU/mL) x fasting glucose (mg/dL))/405)
Serum calcidiol and iPTH measurements
Serum 25(OH)D and iPTH were assayed using EIA kits (both from Euroimmun, Medizinische Labordiagnostika AG, Germany). Subjects were categorized as vitamin D deficient if 25(OH)D concentration was below 20 ng/ml, insufficient with concentrations 20-29 ng/ml and sufficient with concentrations of at least 30 ng/ml (38-41).
2.3. DNA Extraction and Genotyping
Genomic DNA was isolated from whole blood samples using PrimePrep Genomic DNA isolation kit (GeNet Bio, Daejeon, South Korea) according to the manufacturer’s protocol. For VDR FokI polymorphism (rs2228570) the forward primer was 5′- GTCAAAGTCTCCAGGGTCAG -3′, and the reverse primer used was 5′- GCCTGCTTGCTGTTCTTAC -3′. Genotyping was done by high-resolution melting (HRM) assay using Step one plus (Applied Biosystems, Foster City, USA). The PCR reactions were carried out in a final volume of 20 μL using the 5x Hot FIREPol HRM Mix (HRM PCR buffer, HotStarTaq Plus DNA Polymerase, nucleotides and EvaGreen dye), 0.3 nM of forward and reverse primers each (final concentration) and 30 ng DNA under the following conditions: initial denaturation-activation step at 95°C for 15 min, followed by a 40-cycle program (denaturation at 95°C for 15 s, annealing at 61°C for 20 seconds, 72°C for 20 seconds) and HRM step from 60 to 95°C rising at 0.1°C per second. Curves for each duplicate were checked on the shape and peak height to meet reproducibility. Normalized and temperature-shifted melting curves from HRM, suggestive of SNP, were distinguished, and direct Sanger sequencing was used to confirm genotyping results from the samples.
Statistical analyses
Data were expressed as mean±SD for continuous variables and frequencies for categorical variables. Normality of data was checked using Kolmogrov-Smirnov test. For between-group comparison of variables, independent sample t test, Mann–Whitney, or χ2 tests were used when appropriate. Means of variables were compared among the different polymorphism groups using ANOVA or Kruskal-Wallis tests for data with normal or non-normal distribution, respectively. Tukey's HD correction for multiple comparisons was applied, as required. The associations between VDR FokI polymorphism and risk of NMSC were estimated by computing odds ratios (ORs) and 95% confidence intervals (CIs) using logistic regression analyses. The Hardy-Weinberg equilibrium (HWE) was tested by a goodness-of-fit chi-squared test to compare the observed genotype frequencies with the expected frequencies among controls. All statistical analyses were done with SPSS software IBM SPSS Statistics version 23.A two-tailed value of less than 0.05 was considered statistically significant.