The Role of AdeABC, AdeFGH and AdeIJK Efflux Pumps in Reduced Susceptibility to Tigecycline: Emergence of an Outbreak Associated With an International Clone Variant of Acinetobacter Baumannii Isolated From Burn Patients in Iran

doi:10.21203/rs.3.rs-1329296/v1

PDF

Research Article

The Role of AdeABC, AdeFGH and AdeIJK Efflux Pumps in Reduced Susceptibility to Tigecycline: Emergence of an Outbreak Associated With an International Clone Variant of Acinetobacter Baumannii Isolated From Burn Patients in Iran

https://doi.org/10.21203/rs.3.rs-1329296/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted 14 Feb, 2022

You are reading this latest preprint version

Tigecycline is a new therapeutic agent for treating multiple drug-resistant (MDR) Acinetobacter baumannii infections. However, recent reports have suggested the efficacy of tigecycline in fighting A. baumannii infections has been reduced. In this study we investigated the role of resistance-nodulation cell division (RND) efflux pumps in reducing the efficacy of tigecycline against clinical isolates of A. baumannii collected from hospitalized burn patients in Iran. The susceptibility of 100 isolates to 19 antimicrobial agents was determined using the disc diffusion method, with the exception of colistin and tigecycline, which were assessed using the Etest method. PCR was used to detect the prevalence of genes. Real-time PCR was used to analyze the expression levels of genes encoding RND efflux pumps. Additionally, a three loci dual assay and multiple loci variable number tandem repeat analysis (MLVA) were used to deﬁne PCR-based groups (G) and epidemiological studies of isolates, respectively. Colistin (99%), followed by tigecycline (71%) could be effective therapeutic options against A. baumannii. Forty-three percent of all isolates belonged to G variants. The high antibiotic resistance rate and over expression of RND efflux pumps were observed in G variants. MLVA identified 44 distinct types with 11 clusters and 29 singleton genotypes. The mean expression levels of AdeB in 29 tigecycline non-susceptible A. baumannii (TNAB) counterpart 71 tigecycline susceptible A. baumannii (TSAB) increased approximately 7- fold. All TNAB and TSAB isolates were shown to express adeG at higher level than adeB and adeJ, exceptionally TNAB isolates expressed adeB at a greater level than others. Four fold or greater decrease in tigecycline MIC was observed in 20% and 79% of TSAB and TNAB isolates, respectively. We observed an increasing trend in the rate of TNAB isolates and G variants in burn patients. The mechanism of their resistance was mediated by an increase in the expression of AdeABC efflux pump; AdeFGH and AdeIJK were not observed to have a direct role in tigecycline resistance. Also, this is the first study to report on the tendency of increase to spread of TNAB G variants, as the sub-clone of G1, in Iranian burn center.

Acinetobacter baumannii

antimicrobial resistance

efflux pump

PCR-based group

MLVA

tigecycline

Acinetobacter baumannii as an opportunistic pathogen causes a variety of nosocomial infections ranging from pneumonia to serious blood, brain or wound infections in the hospital settings (Dally et al., 2013) and was found to be the second leading cause of nosocomial infection in burn patients in Iran (Farshadzadeh et al., 2015). In recent years, there has been a dramatic increase in the prevalence of A. baumannii that likely has been attributed to emergence of antibiotic resistance among these isolates (Moradi et al., 2015; Dally et al., 2013). Antibiotic treatment failure and the emergence of antibiotic resistance among A. baumannii isolates are increasing and very depending on the geographic region (Moradi et al., 2015). This increasing antibiotic resistance has been attributed to the overuse of antibiotics among patients infected by A. baumannii such as those whom burn infection (Fearshadzadeh et al., 2015; Sharma et al., 2014; Chong et al., 2011). Carbapenems have remained as treatment option for multiple drug-resistant (MDR) infections (Pourhajibagher et al., 2016). However, due to the increased incidence of nosocomial infections caused by carbapenem non-susceptible A. baumannii, the use of other therapeutic options including polymyxin and tigecycline has been considered (Pourhajibagher et al., 2016).

Tigecycline has exhibited to have effective in vitro activity against XDR A. baumannii (Montana et al., 2015) and has been approved for the treatment of complicated skin and intra-abdominal A. baumannii infections (Cai et al., 2012). Several studies introduced tigecycline as treatment option for imipenem- and colistin-resistant A. baumannii. However, the emergence of tigecycline resistant A. baumannii isolates has been reported (Cai et al., 2012; Sarada et al., 2014; Li et al., 2015; Montana et al., 2015; Mavroidi et al., 2015). All A. baumannii isolated from Iran were found to be susceptible to tigecycline in 2006, an increasing trend in the tigecycline resistance among A. baumannii isolates was found in Iran during 2011 through 2013, from 4% to 13‒23%, which is a cause for concern in the medical community (Bahador et al., 2013; Bahador et al., 2014; Farshadzadeh et al., 2015).

Several studies indicated attribution of RND efflux pumps to tigecycline resistance in A. baumannii. These pumps included AdeABC, AdeFGH, and AdeIJK have a wide substrate range, thus could be important in multiple drug resistant (Deng et al., 2014). AdeABC was the first RND efflux pump identified; tigecycline resistance in strains of A. baumannii might be due to the upregulation of the AdeABC efflux pump. The expression of this pump is strongly regulated by a two-component AdeRS system (Xing et al., 2014; Yoon et al., 2013).

Another known RND efflux pump, AdeIJK, is present in all A. baumannii strains. Because the overexpression of AdeIJK is toxic for A. baumannii isolates, its expression is repressed by AdeN, a TetR-type regulator (Rosenfeld et al., 2012; Damier-Piolie et al., 2008). AdeFGH is another RND efflux pump that has been described in A. baumannii. It is responsible for the decreasing susceptibility of A. baumannii to tigecycline. A high level of expression of AdeFGH due to mutations in AdeL, a LysR- type transcriptional regulator, is thought to promote tigecycline resistance (Coyne et al., 2010b). Some studies have shown that only AdeABC and AdeIJK are involved in reducing the susceptibility of A. baumannii to tigecycline (Rosenfeld et al., 2012; Damier-Piolie et al., 2008), while other studies have revealed the role of AdeFGH in tigecycline resistance (Coyne et al., 2010b).

Diverse and complicated mechanisms are involved in tigecycline resistance (Chen et al., 2014). To our knowledge, there are no studies that have reported on the role of the different types of RND efflux pumps involved in tigecycline resistance among clinical isolates of A. baumannii in Iran.

The global population structure of A. baumannii isolates is changing. As a result, molecular typing is essential for tracing the source and transmission pathways of A. baumannii. Three major PCR-based groups (G), I‒III, referred to as the international clone (IC) or sequence group (SG), and G variants of A. baumannii have been shown to be responsible for several hospital outbreaks globally (Diancourt et al., 2010; Karah et al., 2011a; Karah et al., 2011b; Towner et al., 2008). Several G variants have been observed among hospital-acquired strains of A. baumannii in several regions in recent years (Karah et al., 2011a; Karah et al., 2011b; Towner et al., 2008). Various studies have shown 5 to 24% of these variants are resistant to tigecycline ( Bahador et al., 2013; Bahador et al., 2014; Farshadzadeh et al., 2015; Karah et al., 2011b; Grosso et al., 2011).

Because the discriminatory power of multiple-loci variable-number tandem-repeat analysis (MLVA) was higher than PCR-based G typing, MLVA enabled the differentiation of unrelated isolates, which were clustered together by PCR-based G analysis in identical G types (Pourcel et al., 2011). Thus, MLVA was used as a reliable molecular fingerprinting technique to identify epidemiological associations among A. baumannii isolates. The objectives of this study were to (i) determine and identify drug susceptibility patterns and the molecular epidemiology of A. baumannii isolated from burn patients in Iran; and (ii) to assess the role of the various types of RND efflux pumps involved in tigecycline resistance in A. baumannii isolated from burn patients.

Bacterial strains

A total of 100 A. baumannii isolates were identified from burn patients hospitalized at the Shahid Motahari Burn Hospital in Tehran, Iran, from September 2013 to February 2015. After admission, written informed consent was obtained from the burn patients. The study approved by the Ethics Committee of Tehran University of Medical Sciences (Application No. 92-03-30-23186). The initial identification of bacterial species was performed by using the API 20NE system (bioMérieux, Marcy-l’Etoile, France). Final characterization of collected isolates was done by multiplex PCR using gyrB-directed primers (Macrogen, South Korea) according to Higgins et al (Higgins et al., 2010).

Antimicrobial susceptibility testing:

The disc diffusion method was used to determine the susceptibility of A. baumannii isolates to several antimicrobial agents according to Clinical and Laboratory Standards Institute (CLSI) guideline (CLSI, 2015). The antimicrobial agents (µg per disc; resistance breakpoint in mm) used in this study included piperacillin (100, ≤17); ticarcillin (75, ≤14); imipenem (10, ≤18); meropenem (10, ≤14); cefotaxime (30, ≤14); ceftazidime (30, ≤14); cefepime (30, ≤14); ceftriaxone (30, ≤13); piperacillin-tazobactam (100 + 10, ≤17); ampicillin-sulbactam (10 + 10, ≤11); gentamicin (10, ≤12); amikacin (30, ≤14); tobramycin (10, ≤12); tetracycline (30, ≤11); minocycline (30, ≤12); ciprofloxacin (5, ≤15); and trimethoprim/sulfamethoxazole (1.25 + 23.75, ≤10) (Mast Diagnostics, Bootle, UK). Escherichia coli ATCC 25922 and Pseudomonas aeruginosa ATCC 27853 were used as quality control organisms to ensure accuracy of the antimicrobial susceptibility assays, and E.coli ATCC 35218 was used as a quality control organism for β-lactam/β-lactamase inhibitor combination (piperacillin-tazobactam, ampicillin-sulbactam) antibiotics.

The MICs of all isolates to colistin and tigecycline (both 0.016‒256 µg/ml) were measured using epsilometer test (Etest) strips (Ezy MIC^TM strips, Himedia, India) per CLSI guidelines (CLSI, 2015). Colistin MICs were interpreted according to CLSI breakpoint. There is no breakpoint available for tigecycline in the CLSI guidelines; as a proxy, the criteria for the interpretation of MIC values for members of Enterobacteriaceae were used following the European Committee on Antimicrobial Susceptibility Testing (EUCAST) (MIC ≤1 µg/ml and MIC ≥2 µg/ml defined as susceptible and resistant, respectively) were used (EUCAST, 2014). A. baumannii isolates where characterized as MDR, XDR, or PDR phenotype according to the international expert proposal for Interim standards guidelines (Magiorakos et al., 2012).

Identiﬁcation of PCR-based G types by multiplex PCR:

G types were determined based on the presence or absence of the alleles of outer membrane protein A (ompA), chaperone-subunit usher E (csuE), and the intrinsic carbapenemase (bla_OXA−51-like) encoding genes in the two simultaneously allele specific multiplex PCR as previously described (Turton et al., 2007). Alleles 1 and 2 of ompA, csuE, and bla_OXA−51-like were detected in multiplex PCR reactions 1 and 2, respectively. All isolates were grouped into one of three major G types (I‒III); all other isolates were considered G variants (Turton et al., 2007). All primers are listed in Table 1.

Table 1

List of oligonucleotides used in this study for genes
	Primers		Sequence (5’ to 3’)	References
Primers used in multiplex PCRs for identification of PCR- based groups	Group1ompA306	Forward	GATGGCGTAAATCGTGGTA	Turton et al., 2007
	Group1and2ompA660	Reverse	CAACTTTAGCGATTTCTGG
	Group 1 csuE	Forward	CTTTAGCAAACATGACCTACC
	Group 1 csuE	Reverse	TACACCCGGGTTAATCGT
	Gp1OXA66F89	Forward	GCGCTTCAAAATCTGATGTA
	Gp1OXA66R647	Reverse	GCGTATATTTTGTTTCCATTC
	Group2ompAF378	Forward	GACCTTTCTTATCACAACGA
	Group1and2ompAR660	Reverse	CAACTTTAGCGATTTCTGG
	Group2csuE	Forward	GGCGAACATGACCTATTT
	Group2csuE	Reverse	CTTCATGGCTCGTTGGTT
	Gp2OXA69F169	Forward	CATCAAGGTCAAACTCAA
	Gp2OXA69R330	Reverse	TAGCCTTTTTTCCCCATC
Primers used for MLVA typing	VNTR_3530	Forward	TGCAACCGGTATTCTAGGAAC	Pourcel et al., 2011
	VNTR_3530	Reverse	CCTTGAACAACATCGATTACTGGA
	VNTR_3002	Forward	GACTGAAGCAAGACTAAAACGT
	VNTR_3002	Reverse	TCTGGGCAGCTTCTTCTTGAGC
	VNTR_2240	Forward	CCCGCAGTACATCATGGTTC
	VNTR_2240	Reverse	AGAACATGTATACGCAACTG
	VNTR_1988	Forward	GGCAAGGCATGCTCAAGGGCC
	VNTR_1988	Reverse	CAGTAGACTGCTGGTTAATGAG
	VNTR_0826	Forward	TGACTACTGAAACAGTTTTTG
	VNTR_0826	Reverse	ATGATTGTACCGAGTAAAAGA
	VNTR_0845	Forward	AATTTTAATTCCAAATTGCTCC
	VNTR_0845	Reverse	ACTTAAAATCGCATTTTTATCA
	VNTR_2396	Forward	CAAGTCCAATCAACTCATGATG
	VNTR_2396	Reverse	CTCCTGTAAGTGCTGTTCAGCC
	VNTR_3468	Forward	CAGAAGTCACTGCATCTGCAAC
	VNTR_3468	Reverse	CGGTTGAAATTTTTTATAATGAAG
Primers used for PCR and qRT-PCR	AdeA	Forward	ATCGCTAACAAAGGCTTGAA	Coyne et al., 2010a
	AdeA	Reverse	CGCCCCCTCAGCTATAGAA
	AdeB	Forward	CTTGCATTTACGTGTGGTGT
	AdeB	Reverse	GCTTTTCTACTGCACCCAAA
	AdeC	Forward	TACACATGCGCATATTGGTG
	AdeC	Reverse	CGTAAAATAACTATCCACTCC
	AdeR	Forward	ACTACGATATTGGCGACATT	Rumbo et al., 2013
	AdeR	Reverse	GCGTCAGATTAAGCAAGATT
	AdeS	Forward	TTGGTTAGCCACTGTTATCT
	AdeS	Reverse	AGTGGACGTTAGGTCAAGTT
	AdeF	Forward	GGTGTCGACCAAGATAAACG	Coyne et al., 2010b
	AdeF	Reverse	GTGAATTTGGCATAGGGACG
	AdeG	Forward	TTCATCTAGCCAAGCAGAAG
	AdeG	Reverse	ATGTGGGCTAGCTAACGGC
	AdeH	Forward	CGATCAGCAAATTCAGGCTC
	AdeH	Reverse	GCTTGCAATGATTTGGCTGC
	AdeL	Forward	AGGAGTGTGCGTGTGGATC
	AdeL	Reverse	GAAATCGGCATCGGTGCTG
	AdeN	Forward	GCTGTTAGGTTGGGGTCGTA	Rumbo et al., 2013
	AdeN	Reverse	CGTGACCAAAAGTACGAATCA	Rumbo et al., 2013
	AdeI	Forward	CAAATGCAAATGTAGATCTTGG	Coyne et al., 2010a
	AdeI	Reverse	AAACTGCCTTTACTTAGTTG
	AdeJ	Forward	GGTCATTAATATCTTTGGC
	AdeJ	Reverse	GGTACGAATACCGCTGTCA
	AdeK	Forward	TTGATAGTTACTTGACTGTTC
	AdeK	Reverse	GGTTGGTGAACCACTGTATC
	16sRNA	Forward	TCGCTAGTAATCGCGGATCA	Ruzin et al., 2007
	16sRNA	Reverse	GACGGGCGGTGTGTACAAG	Ruzin et al., 2007

Multiple-loci variable-number tandem-repeat analysis:

A. baumannii isolates were genotyped using the MLVA-8 scheme method developed by Pourcel et al. (Pourcel et al., 2011). With this method, large (L)-repeat VNTRs (Abaum_1988, Abaum_2240, Abaum_3002, and Abaum_3530) and small (S)-repeat VNTRs (Abaum_0826, Abaum_0845, Abaum_2396, and Abaum_3468) were amplified using eight paired primers targeting the 5’and 3’ flanking regions of the mentioned VNTR loci in eight separate PCR tests. After agarose gel electrophoresis, the sizes of amplicons were determined using GeneTools, version 4.1 (Syngene, UK). All primers are listed in Table 1. The MLVA-8 scheme profiles in each isolate were identified by the number of repeats estimated at each VNTR locus according to the previous study (Pourcel et al., 2011). Dendrograms were created using Bionumericus version 7.0 (Applied Maths, Sint-Martens-Latem, Belgium). For clustering analysis, the allele strings were entered into Bionumericus as character values. A cut-off of 95% similarity was used to describe clusters (Pourcel et al., 2011).

Detection of the AdeRND system:

All isolates were screened for the presence of genes encoding the adeABC (adeA, adeB, adeC), adeIJK (adeI, adeJ, adeK), and adeFGH (adeF, adeG, adeH) efflux pumps by PCR with specific primers as previously designated and listed in Table 1 (Coyne et al., 2010a; Coyne et al., 2010b; Rumbo et al., 2013). PCR was also used to detect adeN, adeL, and adeRS.

Real Time PCR assay:

Because three genes encoding adeABC (adeA, adeB, and adeC), adeFGH (adeF, adeG, and adeH), and adeIJK (adeI, adeJ, and adeK) are co-transcribed (Damier-piolle et al., 2008; Coyne et al., 2010b; Ruzin et al., 2007), this study was performed to verify the expression level of the representative transporter of each efflux pump involved adeB, adeG, and adeJ genes in all isolates positive for at least one RND efflux pump type. Total RNA was extracted using the High Pure RNA Isolation Kit (Roche, Germany) per the manufacturer’s instructions. The extracted RNA was converted to cDNA using a cDNA synthesis kit (Thermo Scientific, USA). The levels of expression of adeB, adeJ, and adeG were measured in triplicate using SYBR Premix Ex Taq II (Takara Bio, Inc. Japan). Real-time PCR was carried out with the following cycle profile: 1 cycle at 95°C for 30 s, followed by 45 cycles at 95°C for 5 s, 63°C for 10 s, and 72°C for 20 s using the ABI Step One^TM system (Applied Biosystems, California, United States) with a total of 25 µl reaction mixture containing 200 ng cDNA. Each experiment was performed in triplicate. The specific primers used are listed in Table 1. 16S rRNA was applied as a housekeeping gene and internal control to normalize levels of adeB, adeJ, and adeG gene transcripts. The fold changes of the target genes expression levels were calculated by the 2^−ΔΔCT method using the relative expression software tool (REST) 2009 software (QIAGEN) (Pfaffl et al., 2002). Changes in expression levels of investigated genes were interpreted as significant if the variation was ≥2-fold.

Determination of RND efﬂux pumps activity:

Activity levels of each RND efflux pump was assessed by measuring the MICs of all isolates when exposed to tigecycline against the efflux pump inhibitor (EPI) and phenyl-arginine-β-naphthylamide (PAβN) (Sigma-Aldrich, Dorset, United Kingdom) as previously (Deng et al., 2014; Hou et al., 2012). PAβN was added to each Muller-Hinton agar plate (Merck, Germany) at a final concentration of 20µg/ml and MIC to tigecycline using Etest before and after exposure to the EPI were recorded. If the MIC values decreased 4- fold or greater in the presence of EPI, this was defined as a significant inhibitory effect.

Statistical analysis:

Data were analyzed using the Student’s t-test, Fisher’s exact tests, and the chi-square test with the SPSS software package (version 22). Results were considered significant if the P-values were less than 0.05.

Isolate identification and antimicrobial susceptibility profiles:

All 100 isolates identified as A. baumannii complex by using the API 20NE system and were confirmed as A. baumannii using multiplex PCR gyrB.

Susceptibility profiles of all A. baumannii isolates are presented in Tables 2 and 3. The highest susceptibility was found to colistin (99%), followed by tigecycline (71%), minocycline (58%), and tetracycline (46%). Resistance rates against the other studied antimicrobial agents, except for amikacin (81%), imipenem (76%), and tobramicin (70%), were higher than 90%. Among a total of 100 isolates, 64 isolates (64%) exhibited the XDR phenotype. The remaining 36% exhibited the MDR phenotype.

Table 2

The MIC of two antimicrobial agents for the 100 *A. baumannii* isolates as determined by E test
Antimicrobial agents^a	A. baumannii isolates			% of non-susceptibility
	MIC (µg/ml)
	Range	MIC50	MIC90
CST	0.016- 2	0.019	1	1
TGC	0.25- 32	1	8	29
^aAbbreviations: CST, colisitin; TGC, tigecycline.

Table 3

Comparison of the rate of non- susceptibility to antimicrobial agents among TNAB versus TSAB isolates
Isolates (No.)	CLSI Antimicrobial groups^a (%)
	A							B									O
	IPM^b	MEM	GEN	TOB	CIP	CAZ	SAM	PIP	TZP	FEP	AMK	SXT	TET	MIN	CTX	CRO	CST	TIC
TNAB^c (29)	83	93	90	66	93	93	55	97	93	97	76	100	100	100	100	100	3	93
TSAB^d (71)	73	93	90	72	89	94	56	99	93	100	83	99	35	18	98	98	0	99
Total (100)	76	93	90	70	90	94	56	98	93	99	81	98	54	42	99	99	1	97
^aAntimicrobial agents are categorized according to CLSI-defined grouping as A, B, and O antimicrobial groups. According to CLSI guideline, considerations in the assignment of agents to Groups A, B, and O include clinical efficacy, prevalence of resistance, minimizing emergence of resistance, cost, FDA clinical indications for usage, and current consensus recommendations for first-choice and alternative drugs. Group A are considered appropriate for inclusion in a routine, primary testing panel, as well as for routine reporting of results for the organism. Group B comprises agents that may warrant primary testing. However, they may be reported only selectively, such as when the organism is resistant to agents of the same class, as in Group A. Group O (other) includes agents that have a clinical indication for the organism, but are generally not candidates for routine testing and reporting in the United States. ^b Abbreviations: AMK, amikacin; CAZ, ceftazidime; CTX, cefotaxime; CRO, ceftriaxone; CIP, ciprofloxacin;CST, colistin; SXT, trimethoprim- sulfamethoxazole; FEP, cefepime; GEN, gentamicin; IPM, imipenem; MEM, meropenem; MIN, minocycline; PIP, piperacillin; SAM, ampicillin-sulbactam; TET, tetracycline; TIC, ticarcillin; TOB, tobramycin; TZP, piperacillin-tazobactam, ^cTNAB, tigecycline non-susceptible A.baumannii; ^dTSAB, tigecycline susceptible A.baumannii.

Based on antimicrobial susceptibility testing, 29 tigecycline non-susceptible A. baumannii (TNAB) and 71 tigecycline susceptible A. baumannii (TSAB) isolates were identified in this study. All TNAB isolates exhibited the XDR phenotype, while 49% of TSAB isolates showed this phenotype and the remaining, 51%, had the MDR phenotype. Among 64% of the isolates exhibited XDR phenotype, 55% were susceptible to tigecycline (XDR-TSAB isolates), while all MDR isolates were tigecycline susceptible. As shown in Table 3, TNAB isolates in comparison with TSAB isolates displayed higher rates of resistance to tetracycline and minocycline (100% for both antibiotics in TNAB isolates versus 35% and 18% for TSAB isolates, respectively; both p < 0.05). However, resistance to imipenem was high in both groups (83% for TNAB versus 73% for TSAB; p = 0.441) (Table 3).

G types:

Table 4 shows the rates of antibiotic susceptibility among PCR-based groups (G) or IC types. Among all isolates, 37%, 19%, and 1% showed the pattern of G1 (IC II), G2 (IC I), and G3 (IC III), respectively (Figure 1 and Table 4). Based on the variations in combination of PCR amplicons, 43% of isolates exhibited a new combination of amplified products; these isolates has not been defined as G1, G2, and G3. These isolates belonged to six PCR-based groups, namely G6, G7, G9, G15, G16, and G17, and have been discussed in previous studies (Table 5) (Farshadzadeh et al., 2015; Karah et al., 2012). G9 (32%) was the most common G variant in this study.

Table 4

Frequency of antimicrobial non-susceptibility in three major PCR- based group lineages and G variants in 100 *A.baumannii* isolates
% of non-susceptibility to antimicrobial agents^a
Isolates (No.)	IPM	MEM	GEN	TOB	AMK	TET	MIN	TGC	CTX	CAZ	CRO	FEP	SAM	TIC	PIP	TZP	CIP	SXT	CST
G^b1 (37)	70	92	89	78	81	41	30	16	97	92	97	97	41	95	95	92	86	95	0
G2 (19)	79	100	95	68	89	47	26	11	100	100	100	100	74	100	100	100	100	100	5
G3 (1)	100	100	100	100	100	100	0	100	100	100	100	100	0	100	100	100	100	100	0
G variant (43)	79	91	88	63	77	67	60	49	100	93	100	100	63	98	100	91	88	100	0
Total (100)	76	93	90	70	81	54	42	29	99	94	99	99	56	97	98	93	90	98	1
^aAbbreviations: AMK, amikacin; CAZ, ceftazidime; CTX, cefotaxime; CRO, ceftriaxone; CIP, ciprofloxacin; CST, colistin; SXT, trimethoprim- sulfamethoxazole; FEP, cefepime; GEN, gentamicin; IPM, imipenem; MEM, meropenem; MIN, minocycline; PIP, piperacillin; SAM, ampicillin-sulbactam; TET, tetracycline; TIC, ticarcillin; TGC, tigecycline; TOB, tobramycin; TZP, piperacillin-tazobactam; ^bG, PCR- based groups.

Table 5

Combination of amplicons obtained from two separate multiplex PCRs used to describe 43 *A. baumannii* G variant
Variant type (No.)	PCR group 1			PCR group 2
Variant type (No.)	csuE 702 bp	bla_OXA−51-like 559 bp	ompA 355 bp	csuE 580 bp	ompA 343 bp	bla_OXA−51-like 162 bp
G 6^a (3)	-	-	-	+	-	-
G 7 (12)	-	-	+	+	-	-
G 9 (14)	-	-	+	+	-	+
G 15 (2)	+	-	-	-	-	+
G 16 (10)	-	+	-	+	-	-
G 17 (2)	+	-	+	-	-	+
^aG; PCR-based group. Two simultaneous multiplex polymerase chain reactions (PCRs) method based on targeting three genes (ompA, csuE and bla_OXA−51-like) is a convenient method for rapid assignment of A. baumannii isolates into three major PCR-based groups (Gs) corresponding to PCR- based group (G) 1 (IC II), G2 (IC I), and G3 (IC III). Using this scheme, additional groups (G4–G14 and putative G15–G17) have been identified according to new combinations of the PCR amplicons.

Susceptibility rates to tetracycline, minocycline, and tigecycline among two major epidemic lineages G1 and G2 is significantly higher than G variants (P<0.05). G variants were highly resistant to tetracycline (67%), minocycline (60%), and tigecycline (49%); while, these antibiotics were the most effective against isolates belonging to G1 and G2 (Table 4). Most TNAB isolates (69%) belonged to the G variant population, whereas only 31% of TNAB isolates belonged to other clonal lineages (p = 0.002). Thirty-five percent of isolates belonging to G1 (IC II) exhibited the XDR phenotype; while 74 and 81% of isolates within G variant and G2 lineages showed this phenotype, respectively. Indeed the rate of XDR phenotype was significantly lower among isolates belonging to clonal lineage G1 than among those belonging to G variants and clonal lineage G2 (P< 0.01).

MLVA typing:

According to the results of the MLVA-8 scheme typing method, 100 A. baumannii isolates were grouped into 44 distinct MLVA types with 11 clusters (named A–K) and 29 single genotypes (Figure 1). All isolates differed in their antibiotic susceptibility profiles. In this study, a lower diversity was recognized in the VNTR loci by using primer pair MLVA-AB_3002 and MLVA-AB_2240 whereas a higher level of diversity was revealed in the VNTR loci by MLVA-AB_2396 and MLVA-AB_3468 (Figure 1).

Forty-five percent of isolates were identified as MLVA type cluster A (n = 24) and F (n = 21). Other clusters including B, C, D, E, G, H, I, J and K were observed to consist of 1- 14 isolates. All isolates within cluster I and K and more than half of isolates within cluster F were G variants, whereas 46% of the G1 (IC II) clones were assigned to the cluster A. As shown in Figure 1, all G variants belonging to G7 were classified in cluster F.

The highest rate of XDR phenotype was found in the clusters G, I and J (100%), followed by the clusters D and C (78%), and K (60%). About 67% of cluster I and 42% of clusters A, B, and C were resistant to tigecycline, and all tigecycline-resistant strains in these clusters showed XDR profiles.

Detection of efflux pump genes:

The distribution of efflux pump genes in all isolates is shown in figures 1 and Table 6. adeIJK and adeN were detected in all isolates (Table 6). All TNAB isolates harbored all RND efflux pumps and their regulatory systems (AdeIJK⁺-AdeN⁺, AdeFGH⁺-AdeL⁺, AdeABC⁺-AdeRS⁺), whereas these pumps was found to exist in 86% of TSAB isolates. This combination significantly was high among TNAB in contrast with TSAB isolates (p=0.02). Other combinations were not statistically different between TNAB and TSAB isolates (p>0.1; Table 6). Ninety-three and ninety-four percent of TSAB isolates were positive for the genes encoding AdeABC and AdeFGH efflux pumps, respectively (figure 1 and Table 6). Ninety-eight percent of adeABC positive isolates, carried the regulatory system adeRS. Of 71 TSAB isolates, 65 isolates (91%) were positive for adeABC and its regulatory system genes (adeRS). The presence of adeABC- adeRS and adeFGH- adeL between TNAB and TSAB isolates was not statistically different (p > 0.1).

Table 6

Distribution of gene encoding RND efflux pumps in 29 TNAB and 71 TSAB isolates
Gene and genotypes	TNAB^a (%)	TSAB^b (%)	P value
Total presence of each efflux pump gene in A. baumannii isolates
AdeIJK	100	100	1
AdeN	100	100	1
AdeFGH	100	94	0.2
AdeL	100	94	0.2
AdeABC	100	93	0.1
AdeRS	100	91	0.1
Combination presence of efflux pump genes in A. baumannii isolates
AdeIJK⁺-AdeN⁺, AdeFGH⁺-AdeL⁺, AdeABC⁺-AdeRS^+c	100	86	0.02
AdeIJK⁺-AdeN⁺, AdeFGH⁺ -AdeL⁺, AdeABC⁻-AdeRS^−d	0	7	0.1
AdeIJK⁺-AdeN⁺, AdeFGH⁻ -AdeL⁻, AdeABC⁺-AdeRS⁺	0	6	0.2
AdeIJK⁺-AdeN⁺, AdeFGH⁺ -AdeL⁺, AdeABC⁺-AdeRS⁻	0	1	0.7
^aTNAB, tigecycline non-susceptible A.baumannii; ^bTSAB, tigecycline susceptible A.baumannii; ^c+, isolates positive for genes; ^d−, isolates negative for genes.

All MDR isolates were susceptible to tigecycline from which 73% were positive for all RND efflux pump genes. XDR-TSAB isolates really constituted 49 percent of the TSAB isolates and were positive for both adeFGH and adeABC.

The prevalence of isolates with all RND efflux pumps (AdeIJK⁺-AdeN⁺, AdeFGH⁺-AdeL⁺, AdeABC⁺-AdeRS⁺) in the G variant lineage (100%) was higher than that in other G clonal lineages (82%) (p = 0.002).

Analysis of adeB, adeG, and adeJ expression:

The expression level of adeB was 6.9- fold higher in TNAB than that in TSAB isolates (p = 0.0001), whereas no significant difference in the expression levels of adeG and adeJ were found between TNAB and TSAB isolates (1.16- and 1.18- fold higher than TSAB, respectively, p < 0.05 for both) (figure 2).

As shown in figure 3, All TNAB isolates had XDR profile and exhibited approximately 6- and 8- fold higher expression levels of adeABC than did XDR- and MDR- TSAB isolates (p <0.001 for both). While, expression level of this gene among XDR- TSAB isolates was significantly no different from MDR isolates (p > 0.1). No significant difference in the expression level of adeG was found between TNAB, XDR- and MDR- TSAB isolates (p> 0.05). Mean expression level of adeJ among TNAB, XDR-and MDR- TSAB isolates was not significantly different (p > 0.1).

The expression level of adeG between isolates belonging to G variants was 1.08- fold higher than those belonging to three major epidemic lineages, regardless of tigecycline susceptibility status, while the expression level of the adeB was slightly greater than 2 fold in isolates belonging to G variants than other clonal lineages and was statistically different between them (p=0.003). The expression level of adeJ between isolates belonging to G variant and those belonging to three major epidemic lineages was not significantly different (p = 0.695)

Determination of RND efﬂux pumps activity:

The effect of PAβN on tigecycline MIC in both TNAB and TSAB isolates is shown in Table 7 and figure 1. As previously mentioned, a 4- fold or greater decrease in tigecycline MIC in the presence of EPI, has defined as a considerable inhibitory effect, <4-fold reduction in the MIC values following exposure to PAβN was considered as a partial change. Tigecycline MIC value decreased ≥ 4-fold in 20% and 79% of TSAB and TNAB isolates, respectively. Indeed the tigecycline MIC following exposure to PAβN in TNAB isolates was significantly affected more than that in TSAB isolates (p= 0.0001). As shown in Table 7, the partial reduction in MIC value after treatment with PAβN was significantly different between TSAB isolates (80%) in comparison with TNAB isolates (21%, p=0.0001). The partial reduction in MIC value was also significantly higher between XDR-TSAB isolates (35%) following treatment with PAβN than TNAB isolates (p= 0.0001). So, tigecycline MIC of TNAB isolates after exposure with PAβN was significantly reduced in comparison with both TSAB and XDR-TSAB isolates.

Table 7

Reduction in MIC after addition of PAβN^a
Phenotype	No. (%) of isolates with < 4- fold reduction in MIC		No. (%) of isolates with ≥ 4- fold reduction in MIC
Phenotype	TNAB^b (29)	TSAB^c (71)	TNAB (29)	TSAB (71)	P value
MDR	0	32 (45)	0	4 (5)	N^d
XDR	6 (21)	25 (35)	23 (79)	10 (14)	0.0001
Total	6 (21)	57 (80)	23 (79)	14 (20)	0.0001
^aPAβN, phenyl-arginine-β-naphthylamide; ^bTNAB, tigecycline-nonsusceptible A. baumannii; ^cTSAB, tigecycline-susceptible A. baumannii. ^dN, no statistics are computed.

In recent years, the frequency of the reports of infection by XDR- A. baumannii has increased worldwide, similarity several such reports for hospital acquired infections especially those involving burn wound, have recently presented by previous studies in Iran (Yu et al., 2016; Farshadzadeh et al., 2015; Azimi et al., 2015). According to results of our previous and current studies, prevalence rate of XDR isolates in 2006, 2015 and present has been 24, 77 and 64%, respectively, representing a shift towards higher XDR frequency (Bahador et al., 2013; Bahador et al., 2014). As the development of resistance to further antibiotics leads to an increase in failure risk of antibiotic therapy; the ongoing enhancement of XDR prevalence could be one of the most serious challenges in management of A. baumannii infected patients (Farshadzadeh et al., 2015; Cai et al., 2012; Bahador et al., 2013; Chen et al., 2014; Giannouli et al., 2010). In our study, resistance rates for imipenem, tetracycline and minocycline were higher than that for colistin and tigecycline. In compared with our previous studies, the rates of resistance to these three antibiotics has had an increasing trend during 2006 to now (Bahador et al., 2013; Bahador et al., 2014; Pourhajibagher et al., 2016). Such an increasing trend has been reported for carbapenems from other countries (Lemos et al., 2014; Hassan et al., 2014; Hammood Hussein et al., 2014; Chang et al., 2015; Niumsup et al., 2009; Kuo et al., 2012). In such condition in which treatment options are limited, tigecycline is commonly used as a mono or combination regimen due to its effective potency against A. baumannii infections (Cai et al., 2012). However our previous and current studies have exhibited an increasing trend in the rate of TNAB isolates during recent years similar to that has observed for XDR isolates. No tigecycline non-susceptible isolates were found in Iran in 2006, whereas 8%, 13-23% and 29% of A. baumannii isolates were found to be non-susceptible in 2011, 2013 and present study, respectively (Bahador et al., 2013; Bahador et al., 2014). Therefore, it appears that there has been a simultaneous development of XDR and tigicyclin resistance phenotypes over recent years in Iran. The tigecycline resistance rates in different parts of the world such as Israel (78%), Italy (50%), China (40.5%), Taiwan (19.1‒45%), India (14.2‒57.6%), Turkey (14.3‒47%), Singapore (29%), Korea (23.4%), also indicate that tigecycline resistance is a global challenge and cause for concern (Pournaras et al., 2016).

The G1 (IC II) has been found to the most predominant A. baumannii clonal lineage worldwide (Hojabri et al., 2014; Higgins et al., 2010b), whereas our analysis revealed that the G variant is the most prevalent clonal lineage in Motahari burn center in Iran. All of the 6 variant PCR based-groups (G variants) in the present study, namely G6, G7, G9, and G15‒G17, have been documented previously (Farshadzadeh et al., 2015; Karah et al., 2012). According to our previous and present reports the G variants rates have been 4%, 16%, 45% and 43% in 2006, 2011, 2015 and present study, respectively (Bahador et al., 2014; Farshadzadeh et al., 2015). The rates of tigecycline resistant phenotype among G variant isolates were 22%, 24% and 45% in 2013, 2015 and present study, respectively (Bahador et al., 2013; Farshadzadeh et al., 2015). These results showed an increasing trend in G variant frequency during mentioned years. As prevalence rates of G variants have increased, the rising rates of XDR and tigecycline resistance phenotype among this clonal lineage have been also increased; thus the extended antibiotics resistance phenotypes may be the most probable explanation for the increasing trends in G variant prevalence over time. Accompanying increase in the rising rates of XDR and tigecycline resistance phenotypes in G variants can provide a supportive evidence that underlying mechanisms of these phenotypes may share some overlapping components with each other.

Our prior research has revealed that G variants tend to form strong biofilms (Farshadzadeh et al., 2015). The resistance of G variants in recent years and tendency of G variants to produce a biofilm are responsible for the spread of these bacteria. The based on our findings, the rate of antibiotic resistance of G2 (IC I) strains was higher than G1 (IC II) strains, whereas the frequency of G2 isolates was lower than G1. Since our previous study revealed higher biofilm-forming capacity of G1 than G2 (Farshadzadeh et al., 2015), therefore higher dissemination of G1 than G2 was seen with respect to higher biofilm- forming capacity but not to higher rate of antibiotic resistance. On the basis of these results, it is might that biofilm-forming capacity contributes more to dissemination of A. baumannii than rate of antibiotic resistance.

Since the discriminatory power of MLVA is higher than PCR-based G typing, MLVA enabled the differentiation of unrelated isolates, which were clustered together by PCR-based G analysis in identical G types (Pourcel et al., 2011), MLVA typing was performed. Comparison of the prevalence rate of each MLVA types in this study with its corresponding prevalence rate in our previous study did not show any significant difference (Farshadzadeh et al., 2015). Evaluation of MLVA typing revealed that isolates which were clustered together by PCR-based G analysis in identical G types may be assign as different MLVA types, thus the results of G clonal lineage typing may not reliably predict MLVA results and vice versa.

In present study all TNAB and TSAB isolates were seen to harbor and express at least one of the RND efflux pumps, and their corresponding regulators, including AdeABC- AdeRS, AdeFGH- AdeL, and AdeIJK- AdeN. The AdeIJK efflux pump appeared to play a general, non-specific, role in reducing susceptibility of isolates to tigecycline, because both TNAB and TSAB isolates expressed this pump. In addition, the lower expression level of AdeIJK efflux pump among TNAB and TSAB isolates compared to that of AdeABC and AdeFGH, may be evidence to support an intrinsic role for this pump in A. baumannii. The expression level of AdeIJK has also been reported as lower than AdeABC in other studies (Xing et al., 2014). It was initially thought that overexpression of AdeIJK was toxic for the host cell (Xing et al., 2014). However, in low level resistant mutants, overexpressing AdeIJK have been obtained on drug gradients of tetracycline or cefotaxime (Coyne et al., 2010a). The AdeN system which was observed in all adeIJK-positive strains, can regulate the expression of the AdeIJK efflux pump (Xing et al., 2014). According to previous reports, the AdeIJK efflux pump synergistically with AdeABC and/or AdeFGH acts to export toxic compounds and antibiotics (Damier-Piolle et al., 2008; Potron et al., 2015). In our study, although adeIJK was found to co-existe with adeABC and adeFGH in all TNAB isolates, synergistic activity of adeIJK with others in decreasing susceptibility to tigecycline is not enough evidence; thus further studies appears to be needed for confirming such a claim.

In this research, 64 of 100 isolates were seen to have XDR phenotype and all 29 TNAB isolates also were XDR. XDR isolates were found to harbor all three pumps, while some of the MDR isolates did not possess one of the AdeABC or AdeFGH efflux pumps. Besides, the higher expression levels of both these pumps were found in XDR, in comparison with MDR isolates.

All TNAB isolates were shown to express adeB at a statistically higher levels than did TSAB (XDR and MDR) isolates, while adeG expression in TNAB isolates was found to be significantly no different from that TSAB (XDR and MDR) isolates; thus the higher level of adeG expression in all isolates may be associated with MDR and XDR phenotype, but not tigecycline non- susceptibility. By contrast, adeB expression level among XDR-TSAB was significantly no different from MDR -TSAB and was lower than XDR-TNAB isolates. All these results together suggest that there appears to be an association between tigecycline non- susceptibility and increasing adeB expression, but not adeG or adeJ. In agreement with our present study, the results of other studies have shown that the increasing expression of adeABC in TNAB isolates is the most likely mechanism which has led to a reduction in the susceptibility of A. baumannii to tigecycline (Peleg et al., 2007; Hornsey et al., 2010; Yoon et al., 2013; Ruzin et al., 2007). By contrast, the results of other study showed that increasing expression of adeFGH in TNAB isolates is an additional mechanism for reducing susceptibility of A. baumannii to tigecycline (Coyne et al., 2010b).

It is clear that efflux pumps can be targets for new antimicrobial agents. Peptidomimetic compounds such as phenylalanine arginyl β-naphthylamide (PAβN) have been introduced as efflux pump inhibitor (EPI); their mechanism of action is through competitive inhibition with antibiotics on the efflux pump resulting in increased intracellular concentration of antibiotic (Askoura et al., 2011). Accordingly, in this study the role of efflux pumps was analyzed using the efflux pump inhibitor (PAβN). The MIC levels of tigecycline showed ≥ 4 folds reduction in presence of PAβN in TNAB than in TSAB isolates. Since mean expression of adeABC among TNAB was higher than others, these results suggest importance of AdeABC in the increase of tigecycline resistance.

The presence of adeRS and adeL in TNAB and TSAB isolates containing adeABC and adeFGH, respectively, was not statistically different. The higher levels of expression of adeB in TNAB and adeG in all isolates could stem from other factors other than the presence of the adeRS and adeL regulatory systems. It was found by several studies that the functional point mutation, or insertion of ISAba1 into the two-component regulatory system adeRS, may be related to the overexpression of the AdeABC pump in TNAB strains (Deng et al., 2014; Chen et al., 2014; Ruzin et al., 2007; Yoon et al., 2013). Here we also observed the overexpression of adeG in isolates that were positive for adeL, which is consistent with the results of past research. adeL was found to be located upstream of the adeFGH operon, and a mutation in this gene led to the overexpression of adeFGH (Coyne et al., 2010b; Xing et al., 2014). One limitation of this study was the lack of sequence analysis in order to identify functional mutations in AdeRS and AdeL as regulatory systems of AdeABC and AdeFGH, respectively.

TNAB and TSAB isolates, despite exhibiting significant differences in expression levels of RND efflux pumps, had no significant difference in resistance to carbapenem which can indicate that other factors in addition to RND efflux pumps might contribute toward carbapenem resistance. In agreement with our results, previous studies suggested that carbapenem hydrolyzing oxacillinases (e.g., OXA-24 and OXA-58) act synergistically with RND efflux pumps to promote carbapenem resistance (Rumbo et al., 2013; Hammoudi et al., 2015; Jia et al., 2015; Azimi et al., 2015). It appears that overexpression of adeFGH, which extrudes carbapenems and aminoglycosides, combined with enzymatic resistance to these two classes of drugs, contributes in a more than additive fashion to the level of resistance of the host (Azimi et al., 2015).

As aforementioned, in various regions, of three major G types, G1 has been identified as the most commonly occurring G type, while in our previous and current studies the isolates belonging to G variant were found to be the most frequent G type among A. baumannii infections. Our results showed that the resistance rates to tigecycline in the G variants were significantly higher than those in other three major G types. As expression level of AdeABC in the G variants was greater than that in three major G types, the increasing trend in prevalence of G variants over recent years in our region could be explained by increase in ability to express this gene. To our knowledge, there has been no study to completely investigate the phenotypic and genotypic resistance of the three major G types and G variants to tigecycline. However, in numerous prior researches direct association between the increased expression level of efflux pumps and the resistance to carbapenems and tigecycline have been reported (Deng et al., 2014; Hou et al., 2012). Since the resistance of G1 and G variants to tetracycline and minocycline is high, further research into presence and expression of genes involved in tetracycline resistance are needed to clarify the underlying mechanisms of resistance to this antibiotic in our region.

Several studies introduced tigecycline as treatment option due to in vitro susceptibility of imipenem- and colistin-resistant A. baumannii to this antibiotic (Cai et al., 2012; Sarada et al., 2014). However, the emergence of tigecycline resistant A. baumannii isolates has been reported and is on the rise (Li et al., 2015; Montana et al., 2015; Mavroidi et al., 2015). Our findings suggest that there appears to be an association between tigecycline non susceptibility and increasing AdeABC efflux pump expression, but not AdeFGH or AdeIJK.

In current report, the majority of isolates were shown to present extreme drug resistance phenotype, which is a challenge in treatment of A. baumannii infections. Besides, the increasing rise of tigecycline non- susceptible strains has led to a condition in which therapeutic options are limited. Increase of G variant rate, as the most frequent G types, that has accompanied by acquisition tigecycline resistance phenotype and adeB overexpression can provide an evidence for effect of this phenotype on A. baumannii dissemination, especially burn wound infections. The AdeABC efflux pump appeared to play a potential role in tigecycline non-susceptibility phenotype, because there was a significant association between adeB expression level and this phenotype in TNAB isolates. A greater decrease in tigecycline MIC in the presence of EPI in TNAB isolates can provide another evidence for the role of adeABC efflux pump in decrease susceptibility of A. baumannii to tigecycline. It seemed the AdeFGH efflux pump did not play a considerable role in tigecycline non-susceptibility, because there apeared no significant difference in the mean adeG expression between TNAB and TSAB isolates.

Ethics approval and consent to participate:

This study was approved by the ethics committee of Ahvaz Jundishapur University of Medical Sciences (Ethical code: IR.AJUMS.REC.1400.255) for human participants. All methods were performed in accordance with the relevant guidelines and regulations. All experiments in this study were performed in accordance with ARRIVE guidelines (https://arriveguidelines.org)

Acknowledgement:

Not applicable

Funding:

No funding was received.

Conflict of Interests:

The authors declare that there is no conflict of interests regarding the publication of this paper.

Askoura, M., Mottawea, W., Abujamel, T., and Taher, I. (2011). Efflux pump inhibitors (EPIs) as new antimicrobial agents against Pseudomonas aeruginosa. Libyan. J. Med. 6. doi: 10.3402/ljm.v6i0.5870.
Azimi, L., Talebi, M., Pourshafie, M.R., Owlia, P., and Rastegar Lari, A. (2015). Characterization of Carbapenemases in Extensively Drug Resistance Acinetobacter baumannii in a Burn Care Center in Iran. Int. J. Mol. Cell. Med. 4, 46-53.
Bahador, A., Raoofian, R., Taheri, M., Pourakbari, B., Hashemizadeh, Z., and Hashemi, F. B. (2014). Multidrug resistance among Acinetobacter baumannii isolates from Iran: changes in antimicrobial susceptibility patterns and genotypic profile. Microb. Drug. Resist. 20, 632-640. doi: 10.1089/mdr.2013.0146.
Bahador, A., Taheri, M., Pourakbari, B., Hashemizadeh, Z., Rostami, H., Mansoori, N., et al. (2013). Emergence of rifampicin, tigecycline, and colistin-resistant Acinetobacter baumannii in Iran; spreading of MDR strains of novel international clone variants. Microb. Drug. Resist. 19, 397-406. doi: 10.1089/mdr.2012.0233.
Cai, Y., Chai, D., Wang, R., Liang, B., and Bai, N. (2012). Colistin resistance of Acinetobacter baumannii: clinical reports, mechanisms and antimicrobial strategies. J. Antimicrob. Chemother. 67, 1607-1615. doi: 10.1093/jac/dks084.
Chang, Y., Luan, G., Xu, Y., Wang, Y., Shen, M., Zhang, C., et al. (2015). Characterization of carbapenem-resistant Acinetobacter baumannii isolates in a Chinese teaching hospital. Front. Microbiol. 6, 910. doi: 10.3389/fmicb.2015.00910.
Chen, Q., Li, X., Zhou, H., Jiang, Y., Chen, Y., Hua, X., et al. (2014). Decreased susceptibility to tigecycline in Acinetobacter baumannii mediated by a mutation in trm encoding SAM-dependent methyltransferase. J. Antimicrob. Chemother. 69, 72-76. doi: 10.1093/jac/dkt319.
Chong, S. J., Ahmed, S., Tay, J. M., Song, C., and Tan, T. T. (2011). 5 year analysis of bacteriology culture in a tropical burns ICU. Burns. 37, 1349-1353. doi: 10.1016/j.burns.2011.07.020.
Clinical and laboratory standards institute. Performance standards for antimicrobial susceptibility testing: twenty fourth informational supplement M100-S25. CLSI, Wayne, PA, USA, 2015.
Coyne, S., Guigon. G., Courvalin, P., and Périchon, B. (2010a). Screening and quantification of the expression of antibiotic resistance genes in Acinetobacter baumannii with a microarray. Antimicrob. Agents. Chemother. 54, 333-340. doi: 10.1128/AAC.01037-09.
Coyne, S., Rosenfeld, N., Lambert, T., Courvalin, P., and Périchon, B. (2010b). Overexpression of resistance-nodulation-cell division pump AdeFGH confers multidrug resistance in Acinetobacter baumannii. Antimicrob. Agents. Chemother. 54, 4389-4393. doi: 10.1128/AAC.00155-10.
Dally, S., Lemuth, K., Kaase, M., Rupp, S., Knabbe, C., and Weile, J. (2013). DNA microarray for genotyping antibiotic resistance determinants in Acinetobacter baumannii clinical isolates. Antimicrob. Agents. Chemother. 57, 4761-4768. doi: 10.1128/AAC.00863-13.
Damier-Piolle, L., Magnet, S., Brémont, S., Lambert, T., and Courvalin, P. (2008). AdeIJK, a resistance-nodulation-cell division pump effluxing multiple antibiotics in Acinetobacter baumannii. Antimicrob. Agents. Chemother. 52, 557-562.
Deng, M., Zhu, M. H., Li, J. J., Bi, S., Sheng, Z. K., Hu, F. S., et al. (2014). Molecular epidemiology and mechanisms of tigecycline resistance in clinical isolates of Acinetobacter baumannii from a chinese university hospital. Antimicrob. Agents. Chemother. 58, 297-303. doi: 10.1128/AAC.01727-13.
Diancourt, L., Passet, V., Nemec, A., Dijkshoorn, L., and Brisse, S. (2010). The population structure of Acinetobacter baumannii: expanding multiresistant clones from an ancestral susceptible genetic pool. PLoS One 5, e10034. doi: 10.1371/journal.pone.0010034.
European committee on antimicrobial susceptibility testing: version 4.0, valid from 2014.
Farshadzadeh, Z., Hashemi, F.B., Rahimi, S., Pourakbari, B., Esmaeili, D., Haghighi, M.A., et al. (2015). Wide distribution of carbapenem resistant Acinetobacter baumannii in burns patients in Iran. Front. Microbiol. 6, 1146. doi: 10.3389/fmicb.2015.01146. eCollection 2015.
Giannouli, M., Cuccurullo, S., Crivaro, V., Di Popolo, A., Bernardo, M., Tomasone, F., et al. (2010). Molecular epidemiology of multidrug-resistant Acinetobacter baumannii in a tertiary care hospital in Naples, Italy, shows the emergence of a novel epidemic clone. J. Clin. Microbiol. 48, 1223-1230. doi: 10.1128/JCM.02263-09.
Grosso, F., Quinteira, S., and Peixe, L. (2011). Understanding the dynamics of imipenem-resistant Acinetobacter baumannii lineages within portugal. Clin. Microbiol. Infect. 17, 1275-1279. doi: 10.1111/j.1469-0691.2011.03469.x.
Hammood Hussein, N., Jabbar, F., Al-Mathkhury, H., and Arsheed Sabbah, M.(2014). Identification of imipenem-resistant genes in Acinetobacter baumannii isolated from Baghdad hospitals. J. Med. Microb. Diagn. 3, 6.
Hammoudi, D., Moubareck, C. A., Hakime, N., Houmani, M., Barakat, A., Najjar, Z., et al. (2015). Spread of imipenem-resistant Acinetobacter baumannii co-expressing OXA-23 and GES-11 carbapenemases in Lebanon. Int. J. Infect. Dis. 36, 56-61. doi: 10.1016/j.ijid.2015.05.015.
Hasan, B., Perveen, K., Olsen, B., and Zahra, R. (2014). Emergence of carbapenem-resistant Acinetobacter baumannii in hospitals in Pakistan. J. Med. Microbiol. 63, 50-55. doi: 10.1099/jmm.0.063925-0.
Higgins, P. G, Lehmann, M., Wisplinghoff, H., and Seifert, H. (2010a). gyrB multiplex PCR to differentiate between Acinetobacter calcoaceticus and Acinetobacter genomic species 3. J. Clin. Microbiol. 48, 4592-4594. doi: 10.1128/JCM.01765-10.
Higgins, P.G., Dammhayn, C., Hackel, M., and Seifert, H. (2010b). Global spread of carbapenem-resistant Acinetobacter baumannii. J. Antimicrob. Chemother. 65, 233-238. doi: 10.1093/jac/dkp428.
Hojabri, Z., Pajand, O., Bonura, C., Aleo, A., Giammanco, A., and Mammina, C. (2014). Molecular epidemiology of Acinetobacter baumannii in Iran: endemic and epidemic spread of multiresistant isolates. J. Antimicrob. Chemother. 69, 2383-2387. doi: 10.1093/jac/dku045.
Hornsey, M., Ellington, M. J., Doumith, M., Thomas, C. P., Gordon, N. C., Wareham, D. W., et al. (2010). AdeABC-mediated efflux and tigecycline MICs for epidemic clones of Acinetobacter baumannii. J. Antimicrob. Chemother. 65, 1589-1593. doi: 10.1093/jac/dkq218.
Hou, P. F., Chen, X. Y., Yan, G. F., Wang, Y. P, and Ying, C. M. (2012). Study of the correlation of imipenem resistance with efflux pumps AdeABC, AdeIJK, AdeDE and AbeM in clinical isolates of Acinetobacter baumannii. Chemotherapy. 58, 152-158. doi: 10.1159/000335599.
Jia, W., Li, C., Zhang, H., Li, G., Liu, X., and Wei, J. (2015). Prevalence of Genes of OXA-23 carbapenemase and AdeABC efflux pump associated with multidrug resistance of Acinetobacter baumannii isolates in the ICU of a comprehensive hospital of Northwestern China. Int. J. Environ. Res. Public. Health. 12, 10079-10092. doi: 10.3390/ijerph120810079.
Karah, N., Haldorsen, B., Hermansen, N. O., Tveten, Y., Ragnhildstveit, E., Skutlaberg, D. H., et al. (2011a). Emergence of OXA-carbapenemase- and 16S rRNA methylase-producing international clones of Acinetobacter baumannii in Norway. J. Med. Microbiol. 60, 515-521. doi: 10.1099/jmm.0.028340-0.
Karah, N., Giske, C. G., Sundsfjord, A., and Samuelsen, Ø. (2011b). A diversity of OXA-carbapenemases and class 1 integrons among carbapenem-resistant Acinetobacter baumannii clinical isolates from Sweden belonging to different international clonal lineages. Microb. Drug. Resist. 17, 545-549. doi: 10.1089/mdr.2011.0089.
Karah, N., Sundsfjord, A., Towner, K., and Samuelsen, Ø. (2012). Insights into the global molecular epidemiology of carbapenem non-susceptible clones of Acinetobacter baumannii. Drug. Resist. Updat. 15, 237-247. doi: 10.1016/j.drup.2012.06.001.
Kuo, S. C., Chang, S. C., Wang, H. Y., Lai, J. F., Chen, P. C., Shiau, Y. R., et al. (2012). Emergence of extensively drug-resistant Acinetobacter baumannii complex over 10 years: nationwide data from the Taiwan surveillance of antimicrobial resistance (TSAR) program. BMC. Infect. Dis. 12, 200. doi: 10.1186/1471-2334-12-200.
Lemos, E.V., de la Hoz, F.P., Einarson, T.R., McGhan, W.F., Quevedo, E., Castañeda, C., et al. (2014). Carbapenem resistance and mortality in patients with Acinetobacter baumannii infection: systematic review and meta-analysis. Clin. Microbiol. Infect. 20, 416-423. doi: 10.1111/1469-0691.12363.
Li, H., Wang, X., Zhang, Y., Zhao, C., Chen, H., Jiang. S., et al. (2015). The role of RND efflux pump and global regulators in tigecycline resistance in clinical Acinetobacter baumannii isolates. Future. Microbiol. 10, 337-346. doi: 10.2217/fmb.15.7.
Magiorakos, A. P., Srinivasan, A., Carey, R. B., Carmeli, Y., Falagas, M. E., Giske, C. G., et al. (2012). Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 18, 268-281. doi: 10.1111/j.1469-0691.2011.03570.x.
Mavroidi, A., Likousi, S., Palla, E., Katsiari, M., Roussou, Z., Maguina, A., et al. (2015). Molecular identification of tigecycline- and colistin-resistant carbapenemase-producing Acinetobacter baumannii from a Greek hospital from 2011 to 2013. J. Med. Microbiol. 64, 993-997. doi: 10.1099/jmm.0.000127.
Minandri, F., D'Arezzo, S., Antunes, L. C., Pourcel, C., Principe, L., Petrosillo, N., et al. (2012). Evidence of diversity among epidemiologically related carbapenemase-producing Acinetobacter baumannii strains belonging to international clonal lineage II. J. Clin. Microbiol. 50, 590-597. doi: 10.1128/JCM.05555-11.
Montaña, S., Vilacoba, E., Traglia, G. M., Almuzara, M., Pennini, M., Fernández, A., et al. (2015). Genetic variability of AdeRS two-component system associated with tigecycline resistance in XDR-Acinetobacter baumannii isolates. Curr. Microbiol. 71, 76-82. doi: 10.1007/s00284-015-0829-3.
Moradi, J., Hashemi, F. B., and Bahador, A. (2015). Antibiotic resistance of Acinetobacter baumannii in Iran: a systemic review of the published literature. Osong. Public. Health. Res. Perspect. 6, 79–86. doi: 10.1016/j.phrp.2014.12.006.
Niumsup, P. R., Boonkerd, N., Tansawai, U., and Tiloklurs, M. (2009). Carbapenem-resistant Acinetobacter baumannii producing OXA-23 in Thailand. Jpn. J. Infect. Dis. 62, 152-154.
Pfaffl, M. W., Horgan, G. W., and Dempfle, L., (2002). Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic. Acids. Res. 30, e36.
Peleg, A. Y., Adams, J., and Paterson, D. L. (2007). Tigecycline efflux as a mechanism for non-susceptibility in Acinetobacter baumannii. Antimicrob. Agents. Chemother. 51, 2065-2069.
Potron, A., Poirel, L., and Nordmann, P. (2015). Emerging broad-spectrum resistance in Pseudomonas aeruginosa and Acinetobacter baumannii: mechanisms and epidemiology. Int. J. Antimicrob. Agents. 45, 568-585. doi: 10.1016/j.ijantimicag.2015.03.001.
Pourcel, C., Minandri, F., Hauck, Y., D'Arezzo, S., Imperi, F., Vergnaud, G., et al. (2011). Identification of variable-number tandem-repeat (VNTR) sequences in Acinetobacter baumannii and interlaboratory validation of an optimized multiple-locus VNTR analysis typing scheme. J. Clin. Microbiol. 49, 539-548. doi: 10.1128/JCM.02003-10.
Pourhajibagher, M., Hashemi, F. B., Pourakbari, B., Aziemzadeh, M., and Bahador, A. (2016). Antimicrobial resistance of Acinetobacter baumannii to imipenem in iran: a systematic review and meta-analysis. Open. Microbial. J. 10, 32- 34. doi: 10.2174/1874285801610010032.
Pournaras, S., Koumaki, V., Gennimata, V., Kouskouni, E., and Tsakris, A. (2016). In vitro activity of tigecycline against Acinetobacter baumannii: global epidemiology and resistance mechanisms. Adv. Exp. Med. Biol. 897, 1-14. doi: 10.1007/5584_2015_5001.
Rosenfeld, N., Bouchier, C., Courvalin, P., and Périchon, B. (2012). Expression of the resistance-nodulation-cell division pump AdeIJK in Acinetobacter baumannii is regulated by AdeN, a TetR-type regulator. Antimicrob. Agents. Chemother. 56, 2504-2510.
Rumbo, C., Gato, E., Lopez, M., Ruiz de Alegria, C., Fernandez-Cuenca, F., Martinez-Martinez, L., et al. (2013). Contribution of efflux pumps, porins, and beta-lactamases to multidrug resistance in clinical isolates of Acinetobacter baumannii. Antimicrob. Agents. Chemother. 57, 5247-5257. doi: 10.1128/AAC.00730-13.
Ruzin, A., Keeney, D., and Bradford, P. A. (2007). AdeABC multidrug efflux pump is associated with decreased susceptibility to tigecycline in Acinetobacter calcoaceticus-Acinetobacter baumannii complex. J. Antimicrob. Chemother. 59, 1001-1004.
Sarada, V., Rao, R., Mani, R., and Ramana, K. V. (2014). Colistin, polymyxin B and tigecycline suspectibility to metallo betalactamase producing Acinetobacter baumannii isolated from tertiary health care hospital. Am. J. microbial. Res. 2, 60-62.
Sharma, S., Kaur, N., Malhotra, S., Madan, P., and Hans, C. (2014). Control of an Outbreak of Acinetobacter baumannii in Burn Unit in a Tertiary Care Hospital of North India. Advances. Public. Health. 2014. http://dx.doi.org/10.1155/2014/896289.
Towner, K. J., Levi, K., and Vlassiadi, M. (2008). ARPAC steering group. Genetic diversity of carbapenem-resistant isolates of Acinetobacter baumannii in Europe. Clin. Microbiol. Infect. 14, 161-167.
Turton, J. F., Gabriel, S. N., Valderrey, C., Kaufmann, M. E., and Pitt, T. L. (2007). Use of sequence-based typing and multiplex PCR to identify clonal lineages of outbreak strains of Acinetobacter baumannii. Clin. Microbiol. Infect. 13, 807-815.
Xing, L., Barnie, P. A., Su, Z., and Xu, H. (2014). Development of Efflux Pumps and Inhibitors (EPIs) in A. baumanii. Clin. Microbial. 3, e1000135.
Yoon, E. J., Courvalin, P., and Grillot-Courvalin, C. (2013). RND-type efflux pumps in multidrug-resistant clinical isolates of Acinetobacter baumannii: major role for AdeABC overexpression and AdeRS mutations. Antimicrob. Agents. Chemother. 57, 2989-2995. doi: 10.1128/AAC.02556-12.
Yu, Y., Chen, m., Jinli, L., and Su, J. (2016). Clinical and molecular epidemiological characterization of extensively drug-resistant Acinetobacter baumannii in patients with liver disease. Int. J. Clin. Exp. Med. 9, 13127-13134.

PDF

Version 1

posted 14 Feb, 2022

You are reading this latest preprint version

The Role of AdeABC, AdeFGH and AdeIJK Efflux Pumps in Reduced Susceptibility to Tigecycline: Emergence of an Outbreak Associated With an International Clone Variant of Acinetobacter Baumannii Isolated From Burn Patients in Iran

Status:

Version 1

Abstract

Figures

Introduction:

Material And Methods:

Results:

Discussion:

Declarations:

References:

Status:

Version 1