DOI: https://doi.org/10.21203/rs.3.rs-1337866/v1
Toxoplasma gondii is a neurotropic single-celled parasite that can infect mammals and birds. Central nervous system infection with T. gondii infection can lead to Toxoplasma encephalitis. Toxoplasma infection can cause endoplasmic reticulum (ER) stress and unfolded protein response (UPR) activation, which ultimately can lead to apoptosis of host cells. The dense granule protein GRA3 has been identified as one of the secretory proteins that contribute to the virulence of T. gondii; however, the mechanism remains enigmatic.
The expression of GRA3 gene in RH, ME49, Wh3 and Wh6 strains were determined using quantitative real-time PCR (qRT–PCR). pEGFP-GRA3Wh6 was created by inserting Chinese 1 Wh6 GRA3 (GRA3Wh6) cDNA into a plasmid encoding the enhanced GFP. Mouse neuro2a (N2a) cells were transfected with either pEGFP or pEGFP-GRA3Wh6 and incubated for 24-36 hr. N2a cell apoptosis- and ER stress-associated proteins were determined using flow cytometry and immunoblotting. Furthermore, N2a cells were pretreated with GSK2656157 and Z-ATAD-FMK before pEGFP-GRA3Wh6 transfection, and the effect of the inhibitors on GRA3Wh6-induced ER stress and apoptosis was investigated.
GRA3 gene expression was higher in the avirulent strains of type II ME49 and type Chinese 1 Wh6 strains compared to the virulent strains of type I RH strain and type Chinese 1 Wh3 strain. Transfection with pEGFP-GRA3Wh6 induced neuronal apoptosis and increased the expression of GRP78, p-PERK, cleaved caspase-12, cleaved caspase-3, and CHOP compared to pEGFP. Pretreatment with GSK2656157 and Z-ATAD-FMK decreased apoptosis in N2a cells, and similarly, ER stress- and apoptosis-associated protein levels were significantly decreased.
GRA3 induces neural cell apoptosis via the ER stress signaling pathway, which could play a role in Toxoplasmic encephalitis.
Toxoplasma gondii is a common intracellular coccidian parasite that infects human beings and animals [1–3]. Most T. gondii infections are usually asymptomatic and result in a self-limiting disease in immunocompetent hosts [4]; however, in chronic immunocompromised individuals, in particular HIV patients, T. gondii can cause severe and fatal tissue damage [4, 5]. In pregnant women, T. gondii can cause miscarriages or deleterious effects to the infants or newborns [6–8]. Due to its preference for neural cells, Toxoplasma infection is responsible for neurological manifestations, including encephalitis, intracranial calcifications, and hydrocephalus [9–11].
Several conditions, including infectious and neurodegenerative diseases, are known to cause a build-up of misfolded proteins within the endoplasmic reticulum that interfere with normal functioning of the ER. This leads to ER stress [12, 13]. To alleviate the effect of the stress, ER-localized transmembrane signaling proteins activate the unfolded protein response (UPR) to restore protein homeostasis [14, 15]. However, an unremitted UPR can activate UPR-mediated inflammatory and apoptotic pathways, resulting in cell death [16, 17].
Previous studies demonstrated that the Chinese 1 Wh3 and type I RH strains can induce apoptotic neural stem cell apoptosis via ER stress-mediated apoptosis signaling pathways [18, 19]. Additionally, secretory proteins such as ROP 18 and GRA 15 have been demonstrated to induce apoptosis of neural cells [10, 19] and carcinoma JEG-3 cells [20]. An and collaborators in a recent study to unravel the host proteins targeted by ROP18 and its molecular mechanisms showed that ROP18 kinase induced neural cell apoptosis by phosphorylating reticulon 1-C, which in turn promotes GRP78 acetylation [11].
Among the extensively studied dense granule proteins (GRAs) in T. gondii, GRA3 is believed to interact with the host cell endoplasmic reticulum (ER) via calcium modulating cyclophilin ligand (CAMLG) [21, 22]. GRA3 is a 29 kDa dense granule protein localized to the parasitophorous vacuole membrane and intravacuolar network. Aside from its physiological role in the uptake of nutrients from host cells, GRA3 in type II strains has also been identified to contribute to its virulence [21, 23]. However, previous studies postulated that the interaction between T. gondii GRA3 and CAMLG of the host ER inhibits host cell apoptosis [24, 25]. We demonstrate for the first time that the interaction between GRA3 and CAML of the host endoplasmic reticulum contributes to T. gondii-induced cell death. We suggest that Toxoplasma GRA3 induces apoptosis in infected N2a cells by activating the PERK pathway to initiate the apoptotic cascade.
T. gondii RH, ME49, Wh6, and Wh3 tachyzoites were cultured in human foreskin fibroblast (HFF) cells in Dulbecco’s modified Eagle’s medium (DMEM) which contained 10% fetal bovine serum (FBS) and 1% penicillin–streptomycin amphotericin B (Biological Industries, Israel). N2a cells were cultured and maintained in DMEM which contained 10% fetal bovine serum (FBS) and 1% penicillin–streptomycin amphotericin B (Biological Industries, Israel) at 37°C in a 5% CO2 humified atmosphere. Cells were serially passaged when they reached 80-90% confluency. HFF and N2a cells were regularly inspected for mycoplasma contamination.
Total RNA from T. gondii tachyzoites (RH, ME49, Wh6 and Wh3 strains) was obtained using TRIzol reagent (Invitrogen, SF, USA) following the manufacturer’s protocols. Extracts with A260/A280 and A260/A230 absorbance ratios between 1.92 and 2.20 were considered pure contaminating reverse transcriptase or DNA polymerase inhibitors and were examined on 1% agarose gels. The concentration of purified RNA was measured using a NanoDrop™ One (Thermo Scientific CA, USA). RNA extracts were stored in -80°C refrigerator for subsequent use. Complementary DNA (cDNA) was synthesized from total RNA samples to using RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher, USA) following the manufacturer’s recommendations. A 1:10 dilution of the cDNA reaction was prepared, measured, and stored at -20°C for use in subsequent steps.
The ORF encoding T. gondii GRA3 (http://toxodb.org) cDNA was amplified from Wh6 tachyzoite RNA using real-time (RT)-PCR. The oligonucleotides used included ME49-GRA3-Ecorl-GFP (5’- CGGAATTCATGGACCGTACCATATG 3’; the EcoR1 site is underlined) and the reverse primer ME49-GRA3- Sal1 -GFP (5’- GTCGACTTATTTCTTGG AGGCTTTG 3’; the Sal1 site is underlined). GRA3 primer synthesis and gene sequencing were performed by General Biosystems Co., Ltd. (Anhui, China). A pEGFP-C2 vector (BD Biosciences Franklin Lakes, NJ, USA) was used to construct the pEGFP-GRA3Wh6 plasmid by inserting digested TgGRA3Wh6 cDNA into the digested pEGFP-C2 vector. The resulting pEGFP-GRA3wh6 plasmid was transformed into E. coli TOP10 (Invitrogen Corp., U.S.A.) and screened.
Plasmid transfection was performed using Lipofectamine 3000 transfection reagent (Thermo Fisher Scientific, China) in 6-well plates following the manufacturer’s instructions. In brief, cells were seeded at a density of 1 × 105 cells/ml in 6-well plates and cultured to reach between 70-90% confluency at the time of transfection. DNA plasmid (2.5 µg) was diluted in 125 µl Opti-MEM containing 5 µl P3000 reagent, and 5 µl Lipofectamine 3000 transfection reagent was diluted in 125 µl Opti-MEM. The diluted Lipofectamine 3000 transfection reagent and diluted DNA were mixed gently and incubated at room temperature for 15 min. Following incubation, a total of 250 µl DNA-lipid complex was gently pipetted into each well. Control wells contained only cultured N2a medium. Cells were incubated between 18-48 hr, and the expression levels of pEGFP and pEGFP-GRA3Wh6 were visualized using an Olympus IX51 fluorescence microscope (Japan). After transfection, the cells were treated and analyzed by immunoblotting unless otherwise indicated.
ER stress and apoptosis in N2a cells were induced using 4 µg/ml tunicamycin (TM) and 0.5 µM staurosporine (STS), respectively (MedChemExpress LLC, Shanghai, China), following the manufacturer’s protocols.
After seeding N2a cells for 24 hr, cells were pretreated with 4 µM GSK2656157 (MedChemExpress LLC, Shanghai, China) and 5 µM Z-ATAD-FMK (BioVision Inc., Milpitas, California) for 1.5 hr and 6 hr, respectively. Following pretreatment with inhibitors, Lipofectamine 3000 reagent was used to transfect cells with plasmids as previously described.
Apoptosis of N2a cells was determined using the PE-Annexin V/7-AAD (BD Biosciences, USA) staining method following the manufacturer’s instructions. In brief, cells in each well were washed twice with cold PBS and harvested using 0.25% trypsin solution. Growth medium was added to inactivate trypsin. Supernatants from each well were transferred to Eppendorf tubes and centrifuged at 800 RPM for 3 min. Pellets were then resuspended in 100 µL 1X Annexin V binding buffer. Five µL of PE-Annexin V and 5 µL of 7-AAD were added to the cell suspensions and mixed gently. Cells were incubated in the dark at room temperature for 15 min. After incubation, 300 µL of Annexin V binding buffer was added to each test tube. Apoptosis of N2a cells was detected using a FACSCalibur flow cytometer (BD Biosciences, USA) within 1 hr, and the data were analyzed using FlowJo/CytExpert software. Annexin V+/7-AAD represented cells in the early-stage apoptosis, while annexin V+/7-AAD+ represented cells in the late-stage apoptosis. Mock-transfected cells represented negative control, whereas STS and TM treated cells served as positive controls.
Following transfection and/or pretreatment with inhibitors, 10 µl of CCK-8 reagent was added to cultured N2a cells in a 96-well plate and incubated for 1 hr. The absorbance of each well was determined by an absorbance microplate reader (Tecan Infinite F50, Switzerland) at a wavelength of 450 nm.
N2a cells were harvested 24 hr after plasmid transfection, and the expression levels of GRA3, protein kinase R (PRK)-like ER kinase (PERK), glucose regulated protein (GRP)-78, cleaved caspase 12, cleaved caspase 3 and C/EBP-homologous protein (CHOP) were determined by immunoblotting. In brief, cells were washed with cold PBS and lysed in RIPA lysis buffer (Beyotime Institute of Biotechnology, Jiangsu, China). The cell lysate was centrifuged at 16,000 g for 10 min at 4°C, and the supernatant was collected. Proteins (40 µg) were separated on 10 - 12% SDS–PAGE and transferred onto 0.45 µM nitrocellulose membranes (Millipore, Billerica, MA, USA). The blotting membranes were then blocked with 5% skimmed milk in 1X TBST for an hour and incubated with primary antibodies (1:1000 dilution) overnight at 4 ℃. Blots were subsequently incubated for 1 hr with respective secondary antibodies (1:4000 dilution) at room temperature. Blots were washed and probed with an ECL kit (Affinity Bioscience Ltd., Jiangsu, China). Images from blots were viewed using a Bio–Rad ChemiDoc XRS+ imaging system, and ImageJ software (Rawak Software, Inc., Stuttgart, Germany) was used to calculate the relative optical densities of each band. The relative protein expression levels were normalized to that of β-actin. Mock-transfected cells served as a negative control. Rabbit anti-caspase 12, rabbit anti-caspase 3, mouse anti-CHOP, mouse anti-β-actin, goat anti-rabbit IgG, and goat anti-mouse IgM were all purchased from Proteintech (Wuhan, Hubei, China). Rabbit anti-phospho-PERK (p-PERK) was purchased from Affinity Bioscience Ltd. (Jiangsu, China), and rabbit anti-PERK was purchased from Cell Signaling Technology Inc. (Danvers, Massachusetts, United States), rabbit anti-GRP78 was purchased from Abcam (Cambridge, United Kingdom), and rabbit anti-GFP was purchased from Santa Cruz Biotechnology (Dallas, Texas, USA).
Total RNA was obtained from the cells by the TRIzol method as previously described. cDNA was synthesized from purified RNA using RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, USA). Reverse transcriptase quantitative polymerase chain reactions (RT–qPCR) were performed using SYBR Green ProTaq (Takara, Tokyo, Japan) following the manufacturer’s protocols. The forward and reverse primers listed in Table 1 were synthesized by General Biosystems Co., Ltd. (Anhui, China). Briefly, 1 µg of RNA was reverse transcribed to a 10 µL final volume master mix reaction. Two microliters of cDNA, 0.4 µL of forward and reverse primers, 5 µL of SYBR Green ProTaq and 2.2 µL of ddH2O were added to make a final reaction volume of 10 µL. PCR was carried out for 45 cycles of initial denaturation for 5 sec at 94°C, annealing for 15 sec at 55°C, and extension for 1 min at 72°C using a LightCycler 96 (Roche, Basel, Switzerland). All RT-qPCR reactions were carried out in triplicate. Gene expression levels were normalized to actin levels, and data were quantified with the delta-delta CT (ΔΔCT) method.
Primer Name |
Sequence (5’ to 3’) |
---|---|
Caspase 12-F |
ACAAAGGGATAGCCACTGCT |
Caspase 12-R |
ACCAGTCTTGCCTACCTTCC |
Caspase 3-F |
AAGGAGCAGCTTTGTGTGTG |
Caspase 3-R |
GGCAGGCCTGAATGATGAAG |
PERK - F |
CGGCAGGTCCTTGGTAATCA |
PERK – R |
CGTCCAAATCCCACTGCTTT |
CHOP (C/EBP) - F |
TCGCTCTCCAGATTCCAGTC |
CHOP (C/EBP) – R |
ACTGACCACTCTGTTTCCGT |
GRP78 – F |
GGTGGGCAAACCAAGACATT |
GRP78 – R |
TCAGTCCAGCAATAGTGCCA |
Actin - F |
AACTAGGCTGCTCCCTGAAG |
Actin - R |
TGCAAAGGATCCCGCTTAGA |
GRA3 - F |
TTCTCGCCGCCTACTACATT |
GRA3 - R |
TGTGTCCAATCTGCGTCAAC |
Abbreviations: PERK Protein Kinase R (PRK)-like ER Kinase, GRP78 78-kDa glucose-regulated protein, CHOP C/EBP homologous protein, GRA3 Dense Granule Proteins. |
Data are presented as mean ± SD of three or more independent experiments. A two-tailed independent Student’s t test was used to determine the differences between pEGFP- and pEGFP-GRA3Wh6-transfected N2a cells. One-way ANOVA was used to compare the GRA3 expression levels among RH, ME49, and Wh3 and Wh6 strains. A P value < 0.05 was considered statistically significant. Analysis was performed using GraphPad Prism 8 Version 8.02
High expression of GRA3 in type II ME49 and Chinese 1 Wh6 strains
To understand the role of GRA3 in the virulence of T. gondii, first, GRA3 primers were used to amplify the GRA3 sequence in cDNA obtained from the wild-type (RH), type II strain (ME49) and the Chinese 1 Wh3 (virulent) and Wh6 (avirulent) parasite strains, and GRA3 mRNA expression levels were determined in each strain using RT–qPCR. Significant increases in GRA3 expression were observed in the ME49 (P <0.05) and Wh6 (P<0.0001) strains compared to the RH and Wh3 strains, respectively. However, the expression level of GRA3 in Wh6 strain was higher than in the ME49 strain (P<0.05) (Fig. 1). As such, we sought to compare the DNA sequences between GRA3Wh6 and GRA3ME49, the sequence alignment results revealed that GRA3Wh6 was as same as GRA3ME49, which is consistent with our previous study [26]. Due to the highest expression of GRA3 in Wh6 strain among the RH, ME49 and Wh3 strains, we adopted GRA3Wh6 for subsequent experiments.
The expression of GRA3Wh6 in N2a cells
To determine whether pEGFP-GRA3Wh6 plasmid could be efficiently expressed in neural cells, we transfected both pEGFP and pEGFP-GRA3Wh6 plasmids into the mouse neuroblastoma line N2a cells and determined the expression of GRA3Wh6 protein. Twenty-four hours after transfection, GFP fluorescence was observed in both pEGFP- and pEGFP-GRA3Wh6-transfected N2a cells. The fluorescence signal in pEGFP-GRA3Wh6-transfected N2a cells was higher than that in pEGFP-transfected cells (Fig. 2a). To further confirm the presence of pEGFP and pEGFP-GRA3Wh6 plasmids in N2a cells, proteins were extracted from the transfected cells 24 hr after transfection, and the expression of GFP and GFP-GRA3Wh6 fusion protein was determined by immunoblotting. GFP and GFP-GRA3Wh6 fusion proteins were blotted at 28 kDa and 58 kDa, respectively (Fig. 2b). We noted that the observed molecular weight of GRA3 was ~30 kD, which was similar to previous studies [21, 23].
Reduced cell viability and apoptosis of neuronal cells transfected with GRA3Wh6 In Vitro
To investigate whether GRA3 could impact the survival of neural cells, the cell viability and rate of apoptosis in N2a cells transfected with either pEGFP or pEGFP-GRA3Wh6 were analyzed. Mock-transfected N2a cells showed no loss of viability (100%), whereas STS, which represented a positive control, decreased viability of N2a cells to 27.9%. On the other hand, pEGFP-GRA3Wh6-transfected N2a cells significantly decreased cell viability (t(2) =6.099, P =0.0009, 46.2% vs 78.4%) compared to pEGFP-transfected N2a cells (Fig. 3a). To further determine the rate of apoptosis, flow cytometry analysis using Annexin V-PE/7-AAD staining assay was performed. The results showed that pEGFP-GRA3Wh6-transfected N2a cells significantly promoted apoptosis (t(2) =54.09, P =0.0001, 44.8% vs 6.1%) compared to pEGFP-transfected N2a cells. The apoptotic rate in the mock-transfected cells was 5.2%, which was similar to that in pEGFP-transfected N2a cells (Fig. 3b).
ER stress-mediated apoptosis induced by GRA3Wh6 in N2a cells
Our previous studies have identified certain effector proteins that can induce programmed cell death in mouse N2a and human choriocarcinoma JEG-3 cells via ER stress signaling pathways [10, 11, 20]. Here, we sought to determine whether the dense granule effector protein GRA3 activated ER stress-induced cell death. N2a cells were transfected with either pEGFP or pEGFP-GRA3Wh6 vectors, and the expression levels of ER stress-related proteins and apoptosis-associated proteins were assessed. Immunoblotting showed significantly increased ER stress-associated proteins, such as GRP78, an ER associated molecular chaperone (t(2) =7.937, P = 0.0014), and p-PERK (t(2) =5.422, P = 0.0056), in pEGFP-GRA3Wh6-transfected cells compared with pEGFP-transfected cells. Consistent with the results obtained from ER stress-associated proteins, cells transfected with pEGFP-GRA3Wh6 showed elevated levels of apoptosis-mediated proteins such as C/EBP homologous protein (CHOP) (t(2) = 3.514, P = 0.0246), cleaved caspase 12, (t(2) = 7.542, P = 0.0017) and cleaved caspase 3 (t(2) = 3.154, P = 0.0344) compared to pEGFP-transfected N2a cells (Fig. 4). These results suggested that GRA3 of Wh6 strain might induce ER stress-mediated apoptosis in neural cells.
Toxoplasma GRA3 elevated the expression of ER stress- and apoptosis-associated genes
Following immunoblotting, we performed RT–qPCR to further compare the mRNA expression levels of the associated apoptosis and ER stress genes between pEGFP- and pEGFP-GRA3Wh6-transfected N2a cells. The results showed that pEGFP-GRA3Wh6-transfected cells had elevated mRNA levels of GRP78 (t(2) = 2.800, P = 0.0488), PERK (t(2) = 7.186, P = 0.0020), CHOP (t(2) = 7.052, P = 0.0021), caspase-12 (t(2) = 21.090, P = 0.0003) and caspase-3 (t(2) = 4.066, P = 0.0153) compared to pEGFP-transfected N2a cells (Fig. 5).
Attenuation of GRA3-induced N2a cell apoptosis following pretreatment with GSK2656157 and Z-ATAD-FMK
Cell viability and apoptosis were analyzed in pEGFP-GRA3Wh6-transfected N2a cells pretreated with GSK2656157 (PERK inhibitor, 4 µM, 1.5 hr) and Z-ATAD-FMK (Caspase-12 inhibitor, 5 µM, 6 hr). Mock-transfected N2a cells showed 100% viability and 8.4% apoptosis. pEGFP-transfected cells showed 89.6% viability and 12.3% apoptosis. treatment with TM decreased N2a cell viability to 48.6% and increased apoptosis to 61%. N2a cells transfected with pEGFP-GRA3Wh6 significantly reduced cell viability (t(2) = 27.86, P <0.0001, 59.5% vs 89.6%) and increased cell apoptosis (t(2) = 40.74 P <0.0001, 37.7% vs 12.3%) when compared to pEGFP-transfected N2a cells. Our results showed that pretreatment with GSK2656157 and Z-ATAD-FMK significantly increased cell viability (t(2) = 10.22, P = 0.0005 and t(2) = 12.86, P = 0.0062) and significantly decreased apoptosis (t(2) = 29.56, P <0.0001 and t(2) = 12.86, P = 0.0002) in pEGFP-GRA3Wh6−transfected cells (Fig. 6a, 6b). Furthermore, we analyzed the related proteins expressions of ER stress associated apoptosis in pEGFP-GRA3Wh6-transfected cells following pretreatment with GSK2656157 and Z-ATAD-FMK. Immunoblotting results revealed that GRA3 increased the expression of cleaved caspase-12 (t(2) = 4.613, P = 0.0099), cleaved caspase-3 (t(2) = 8.118, P = 0.0013), p-PERK (t(2) = 5.989, P = 0.0039) and CHOP (t(2) = 8.373, P = 0.0011) when compared to pEGFP-transfected cells. Compared to pEGFP-GRA3Wh6-transfected cells, the expression levels of p-PERK, cleaved caspase-12 (t(2) = 4.771, P = 0.0088), cleaved caspase-3 (t(2) = 10.110, P = 0.0005) and CHOP (t(2) = 5.668, P = 0.0048) were significantly decreased in pEGFP-GRA3Wh6-transfected cells pretreated with GSK2656157. Similarly, the protein expression levels of cleaved caspase-12 (t(2) = 3.471, P = 0.0256) and cleaved caspase-3 (t(2) = 6.980, P = 0.0022) were significantly decreased in Z-ATAD-FMK-pretreated pEGFP-GRA3Wh6-transfected N2a cells (Fig. 6c). Collectively, these results demonstrated that GRA3Wh6 induces ER stress-associated apoptosis via PERK pathway.
Toxoplasmosis is known to be one of the most common parasitic infections that infects warm-blooded animals, including humans and pets. Nearly a third of the human population have been chronically infected with T. gondii [27]. T. gondii can infect neural cells, where it forms cysts that remain for a lifetime in the host, causing chronic subclinical neuroinflammation [3, 28].
During cell invasion, secretory proteins such as dense granule proteins and rhoptry proteins (ROPs) are released into the host nucleus and cause considerable harm [29]. Several studies have explored how parasite proteins such as ROP16, ROP18, GRA15 and GRA60 contribute to T. gondii virulence either by activating or subverting host defense mechanisms [10, 20, 30].
Although Toxoplasmic GRA3 participates in nutrient acquisition for the parasite, it has also been identified to be closely associated with strain virulence [23]. However, the mechanism is enigmatic. This study aimed to determine the mechanism by which GRA3 contributes to T. gondii virulence.
An important finding from the present study was that the GRA3 expression levels in avirulent type II ME49 and Chinese 1 Wh6 strains were significantly higher (P< 0.05 and P< 0.001, respectively) compared with those in the virulent type I RH and Chinese I Wh3 strains (Fig. 1). This was consistent with our previous study, which revealed that the expression level of GRA3 in the Wh6 strain was significantly higher than that in the RH and Wh3 virulent strains [31, 32].
The ER is responsible for the production of cellular organic molecules, including proteins, sterols, carbohydrates, and lipids [33–36]. Its role in protein folding is critical for cell survival. Cellular disturbances such as infections and reactive oxygen species can interfere with the normal functions of the ER. These cellular disturbances cause ER stress [37]. To alleviate this stress, the ER-localized transmembrane signaling proteins, i.e., inositol-requiring protein 1 (IRE1)-α, protein kinase R (PRK)-like ER kinase (PERK) and activating transcription factor 6 (ATF6), activate UPR to restore cellular homeostasis [14, 15]. However, an unremitted UPR can activate UPR-mediated inflammatory and apoptotic pathways, resulting in cell death [16, 17]. We, for the first time in this study, demonstrate that the ER-Toxoplasma GRA3 interaction activates downstream apoptotic cascades in T. gondii-infected mouse N2a cells via the ER stress pathway.
The protein folding function of the ER requires the presence of Ca2+-dependent ER molecular chaperone proteins. GRP78, commonly known as BiP, is one of the most-studied ER chaperone proteins [38]. Aside from being critical for protein quality control and thus sensing and targeting misfolded and/or unfolded proteins for degradation, GRP-78 controls the activation of ER-stress transducers and acts as an ER stress sensor [39]. Within the cell, GRP78 levels are kept relatively low; however, they are upregulated in response to stressors that alter ER and Ca2+ homeostasis [40]. In our study, we demonstrated that T. gondii GRA3Wh6 induced ER stress in N2a, which significantly increased GRP78 mRNA and protein levels after a 24 hr transfection with GRA3Wh6 (Fig. 4, 5). This observation is similar to our previous study, which involved the transfection of carcinoma JEG-3 cells with Toxoplasma GRA15II. In that study, pEGFP-GRA15II increased the expression levels of GRP78. This suggests that the ER-GRA3 interaction induces ER stress and that the levels of GRP78 are upregulated in an attempt to restore homeostasis.
Caspase-12 plays a crucial role in ER stress-mediated cell death. Under ER stress conditions, procaspase-12 is cleaved, and the activated forms accumulate (Nakagawa et al., 2000). Here, GRA3Wh6 was found to cleave pro-caspase-12 into active caspase-12, accelerating apoptosis. Having demonstrated that GRA3-induced ER stress activates caspase 12, we next examined the downstream targets of GRA3-induced apoptosis following caspase 12 activation. We observed that the activation of caspase 12 resulted in the activation of caspase 3, as demonstrated by the increased cleaved caspase-3 expression in GRA3Wh6-transfected mouse N2a cells. Our results showed that GRA3 induced the activation of caspase-12 which contributes to the pathogenesis of encephalitis during T. gondii infection. Moreover, pretreatment of N2a cells with the caspase-12 inhibitor Z-ATAD-FMK significantly decreased cleaved caspase-12 and cleaved caspase-3 protein expression levels; consequently, Z-ATAD-FMK downregulated apoptosis in GRA3Wh6 N2a cells.
As an important initiator of the unfolded protein response (UPR), PERK dimerizes and autophosphorylates upon dissociation from GRP78. The kinase domain is then activated by phosphorylation of PERK, which then targets substrates such as eIF2a to activate the cascade [41]. The PERK signaling pathway is activated in response to excessive amounts of misfolded proteins in the ER and temporarily blocks protein translation, which results in neuronal cell death [42, 43]. Our results showed that GRA3 significantly activated ER stress and UPR, as observed by the significantly increased levels of phosphorylated PERK proteins following immunoblotting. Similarly, qPCR results showed that the mRNA levels of PERK were elevated in GRA3-infected N2a cells. Consistent with previous findings, our immunoblotting results showed that pretreatment of N2a cells with GSK2656157, a PERK inhibitor, significantly suppressed phosphorylated PERK expression. CCK8 and Annexin V-PE/7-AAD apoptosis assays revealed that N2a cells that were pretreated with GSK26561157 also suppressed neuronal cell death 24 hr after GRA3 transfection. Furthermore, inhibition of PERK downregulated CHOP, cleaved caspase-12, and cleaved caspase-3 expression. GSK2606414 was shown to have neuroprotective effects by rescuing the loss of dendritic development and number of synapses in neurons following traumatic brain injury and decreasing the expression of downstream targets such phospho-eIF2a, ATF4, and CHOP [44, 45]. Therefore, initiation of UPR by signaling through the PERK pathway appears to play a crucial role in GRA3-mediated ER stress apoptosis.
CHOP plays a pathologic role in ER stress-related diseases. During unremitted UPR, activation of PERK results in phosphorylation of the eukaryotic translation initiation factor (eIF2), resulting in general translational block. However, ATF4 (activating transcription factor 4) is translated, activating downstream targets such as C/EBP homologous protein (CHOP) [46]. PERK-ATF4-CHOP pathway activation during prolonged UPR induces apoptosis [47]. Our results showed that the mRNA and protein expression levels of CHOP in N2a cells were significantly increased 24 hr after T. gondii GRA3Wh6 transfection, which translated into increased N2a cell death, as observed in cell viability and cell apoptosis flow cytometry assays. This further indicates that GRA3Wh6 induces ER stress and activates the PERK-ATF4-CHOP signaling pathway to induce apoptosis in neuronal cells.
In conclusion, we have come a long way in our understanding of this protozoan parasite and its interaction with host cells. Our study highlights the mechanism by which dense granule protein (GRA3) increases the virulence of T. gondii. GRA3Wh6 induces neuronal apoptosis via the endoplasmic reticulum stress-mediated apoptosis pathway. This study provides further understanding of the mechanisms by which T. gondii causes neuropathology.
GRA 3: Dense granule protein 3
CAML: Calcium modulating cyclophilin ligand
ER: Endoplasmic reticulum
UPR: Unfolded protein response
HIV: Human immunodeficiency virus
N2a: Neuro2a
ROP: Rhoptry protein
cDNA: complementary DNA
mRNA: messenger RNA
DNA: deoxyribonucleic acid
RNA: Ribonucleic acid
GRP78: glucose regulated protein-78
PERK: protein kinase R (PRK)-like ER kinase
CHOP: C/EBP-homologous protein
SDS–PAGE: sodium dodecyl sulfate-polyacrylamide gels
Acknowledgements
The authors would like to thank members of our laboratories for their thoughtful discussions.
Availability of data and materials
Data are available from the corresponding authors upon reasonable request.
Funding
This study was financially supported by the National Natural Science Foundation of China (No. 82072300, No. 81902084, and No. 81871674).
Author Contributions
Jian Du, Jilong Shen: Conceived and designed the experiments. Cudjoe Obed: Performed experiments, Data analysis, Writing - review & editing. Minmin Wu, Jie Wang and Fang Liu performed the experiments and data analysis. Ying Chen: Review & editing. Ran An, Haijian Cai, Qingli Luo, Li Yu: Formal analysis. All authors read and approved the final version of the manuscript.
Declaration of Competing Interest
There are no competing interests with regard to the work reported in this manuscript.