Grid1 Regulates the Onset of Puberty in Female Rats

doi:10.21203/rs.3.rs-134074/v1

Download PDF

Research

Grid1 Regulates the Onset of Puberty in Female Rats

https://doi.org/10.21203/rs.3.rs-134074/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

The present study aimed to investigate whether Grid1, encoding the glutamate ionotropic receptor delta type subunit 1(GluD1), influences the onset of puberty in female rats. First, we detected the expression of Grid1 mRNA and its protein in the hypothalamus from infancy to puberty. Second, we evaluated the suppression of Grid1 expression by Lentivirus-Grid1 (LV-Grid1) in primary hypothalamus cells through measuring the expression level of Grid1. Finally, LV-Grid1 was intracerebroventricular injected (ICV) into 21-day-old rats and to investigate the effect of Grid1 suppression on puberty onset in vivo. Results showed that GluD1 immunoreactivity could be detected in the arcuate nucleus (ARC), paraventricular nucleus (PVN), and periventricular nucleus (PeN). Grid1 mRNA levels were the lowest at prepuberty. Treatment of hypothalamic neurons with LV-Grid1 decreased the mRNA expression levels of Grid1 and Rfrp-3 (encoding RFamide-related peptide 3, RFRP 3), but increased that of Gnrh (encoding gonadotropin-releasing hormone, GnRH). After 7 days of ICV LV-Grid1 into rats, the Grid1 mRNA was significantly reduced (by 46%), Gnrh mRNA expression was significantly increased, but Rfrp-3 mRNA levels were decreased. The time of rat vaginal opening (VO) was earlier in the LV-Grid1 group; the concentrations of luteinizing hormone (LH), estradiol (E₂), and progesterone (P₄) in serum were significantly increased; and the ovaries were significantly larger. Our study revealed that Grid1 affects the onset of puberty by regulating the level of GnRH and RFRP3.

Endocrinology & Metabolism

Sexual & Reproductive Medicine

GnRH

Grid1

puberty

rat

RFRP 3

Puberty plays an important role in the growth and development of animals, and its onset is closely related to the animal's sexual maturity and reproductive ability. The onset of puberty is a well-organized biological process that is controlled by the reproductive neuroendocrine systems [1, 2]. A traditional neuroendocrine study found that the hypothalamus-pituitary-gonadal axis (HPGA) plays a key role in the onset of puberty [3]. At the onset of puberty, the activity of GnRH secreted by neurons become active and GnRH neurons pulse release GnRH. GnRH neurons in the ARC of the hypothalamus synthesize and secrete GnRH, which is stored in the median eminence (ME). GnRH enters the pituitary portal system by pulsed secretion or enters the blood through the cerebrospinal fluid. GnRH stimulates the gonadotroph of the anterior pituitary gland to release LH and follicle stimulating hormone (FSH), which are necessary for regulating the secretion of peripheral target gonadal hormones and promoting the production of mature gametes through blood circulation[4]. This release of GnRH promotes the secretion of gonadotropins, LH, and FSH, which target the gonads to trigger puberty. The secretion of GnRH neurons affected by many factors, for example, GPR54 stimulates GnRH neurons directly[5], γ-aminobutyric acid(GABA) has an inhibiting effect on GnRH secretion[6], and Glutamate (Glu) promotes the secretion of GnRH[7]. Unlike primates, there may be no tonic central inhibition in rats, and the onset of puberty requires the establishment of a glutamatergic system and other auxiliary nervous systems[8]. Over the last few decades, comprehensive studies have demonstrated that hypothalamic control of puberty is not determined by a single gene, rather a complex gene network in the hypothalamus exerts hierarchical control of this event [9].

As the main excitatory neurotransmitters, glutamate is widely distributed in the brain and plays an important role in neurotransmission. It affects the growth and development, maturation, repair of neurons in the brain and affects the process of neurotransmission[10]. The glutamatergic system is the main excitatory neurotransmission system in the central nervous system (CNS) and 40% of synapses function via this system [11]. Glutamate is widely distributed in CNS, of which cerebellum, temporal lobe, frontal lobe, hypothalamus, caudate nucleus, lenticular nucleus and amygdala are most distributed. To date, several putative associated genes (DRD1, DTNBP1, MTHFR and TPH1) have been identified that are not only linked to glutamate conversion and regulation of glutamatergic neurotransmission, but also to structural proteins important in the development or maintenance of glutamatergic synapses [12]. The glutamate receptors in the CNS can be classified into metabotropic glutamate receptors and ionotropic glutamate receptors. The delta family of ionotropic glutamate receptors has two members, GluDl and glutamate ionotropic receptor delta type subunit 2 (GluD2) [13]. Genetic association studies have indicated that the Grid1 gene, encoding GluD1, is a strong candidate gene for bipolar disorder, schizophrenia, and major depressive disorder [14–21]. Copy number variation studies have also suggested that Grid1 is involved in autism spectrum disorders (ASD) [22–24]. Furthermore, the Grid1 gene maps to the human 10q22-q23 genomic region at the site of recurrent deletion associated with cognitive and behavioral abnormalities [25, 26]. Grid1 is widely distributed in the brain of adult mice, and its expression level is higher in cerebral cortex, striatum, cerebellar cortex and limbic system (hippocampus, nucleus accumbens, bed nucleus of stria terminalis). And it was highly expressed in the inner hair cells, spiral ganglion and satellite cells, vestibular ganglion and vestibular hair cells in cavies and rats, but relatively low in Corti's organ cells and vestibular Sertoli cells in the cochlea basement and low expression in other areas of CNS[27, 28].

Grid1 is involved in the glutamatergic signaling pathway, which directly regulates GnRH [29]. And previous studies in our laboratory showed that the Grid1 mRNA and methylation pattern were different in prepubertal and pubertal goats [30]. Therefore, we speculated that Grid1 may regulate the onset of puberty. In the present study, we first detected the expression of Grid1 and its encoded protein in the hypothalamus of female rats at different developmental stages using quantitative real-time reverse transcription PCR (qRT-PCR) and immunofluorescence (IF). Then, we used RNA interference (RNAi) experiments to verify the inhibitory effect of Grid1 on the hypothalamus in female rats by observing key genes and hormones that are related to the onset of puberty.

Animals

Adult Sprague-Dawley rats were purchased from Anhui Medical University laboratory animals Center [license number: SCKL (Anhui) 2017-001]. The rats were housed in the animal center of the Anhui Agricultural University and allocated into breeding pairs after feeding one week. The rats were reared in individual cages, and provided with a standard rodent diet and water, and were maintained at 22 °C ± 2 °C with a humidity of 55% ± 1.5%), and a 12/12-h light/dark cycle.

Experimental design

Experiment 1. Change of Grid1 mRNA and protein level in the hypothalamus of rats from infant to puberty. The animals were euthanized after anesthesia at infancy (postnatal day 10, PND10, n = 6), prepuberty (PND28, n = 6), and puberty (PND35–40, n = 6). After the rats were euthanized, the hypothalamus was surgically removed, immediately frozen in liquid nitrogen, and stored at − 80 °C until the qRT-PCR or preserved in 4% paraformaldehyde for IF analysis. The anatomical position of ARC, PVN and PeN are refer to The Rat Brain by George Paxinos and Charles Watson[31].

Experiment 2. Effects of Grid1 knockdown on the expression of genes associated with puberty in hypothalamic cells in vitro. Under aseptic conditions, hypothalamic neurons were isolated from PND1 female rats and incubated at 37 °C in an atmosphere of 5% CO₂. LV-Grid1 was added on the third day of culture and total RNAs were extracted on the seventh day. Finally, the expression of Grid1, Gnrh, and Rfrp-3 mRNA were detected using qRT-PCR.

Experiment 3. Effects of Grid1 knockdown on puberty onset, reproductive hormones of rats, litter size, and offspring weight. Eighteen female rats were randomly divided into LV-Grid1 group, negative control (LV-(-) )group, and control group, with six rats in each group. On PND21, all the rats treated with LV-Grid1, LV-(-), or saline by ICV injection. On the one hand, we collected hypothalamus to detect the expression level of Grid1 mRNA and other puberty-related genes, and serum to detected the level of reproductive hormones after at 7 days after ICV injection. On the other hand, we observed the time at VO, the expression of genes related to reproduction and reproductive hormone levels in all rats. Finally, we mated the female rats with normal male rats and analyzed the litter size and offspring weight.

Primary hypothalamic cell culture

Primary hypothalamic cells were isolated from PND1 female rats. After rapid removal of the brain, the hypothalamus was dissected out. The tissues were cut into fragments and dispersed in 0.125% trypsin (Gibco, Grand Island, NY, USA) and DNase I (Biomiga, San Diego, SD, USA) for 20 min at 37 °C. Then, Dulbecco’s modified Eagle’s medium (DMEM) medium (Hyclone, South Logan, UT, USA) with 10% fetal bovine serum (Sijiqing, Huzhou, China) was added for trypsin inactivation and the tissues were disassociated gently by mechanical trituration. About 1 ml of cells were plated onto 6-well plates (coated with poly-D-lysine for 6 hr) for further culture. After 24 hr, DMEM medium was replaced with Neurobasal-A medium (Gibco, Grand Island, NY, USA) supplemented with 2% B-27 serum-free supplement (Gibco, Grand Island, NY, USA) at 37 °C in an atmosphere of 5% CO₂. Primary cells were cultured for 5 days before the experiments.

LV Construction

293T cells were co-transfected with Lentiviral expression particles and three kinds of packaging plasmids (pGag/Pol, pRev, and pVSV-G) using RNAi-Mate (Gene-Pharma, Shanghai, China), and were changed to complete medium at 6 hr after transfection. After 72 hr, the LV particles were collected and concentrated to obtain a high titer lentivirus. Viral titers were subsequently determined in 293T cells. The resulting virus was then stored at -80 °C.

LV transfection

The experiment was performed on primary hypothalamic cells that had been cultured for three days. To 16 µl of LV-Grid1, LV-(-), or saline, we added Neurobasal-A medium supplemented with 2% B-27 serum-free supplement to 100 µl. The mixture was added to the 6-well plates containing the cells, which were then incubated at 37 °C in an atmosphere for 72 hr.

LV construction and selection of the optimal titer

Our primary objective was to design a model that can clearly detect the effect of Grid1 suppression in vitro. As shown in Supplementary Fig. 1A, short hairpin RNA (shRNA) constructs targeting Grid1 were constructed using the lentivirus (LV3) backbone, which contains an enhanced green fluorescent protein gene driven by a separate cytomegalovirus promoter, and the sequencing results verified the correctly cloned construct (Supplementary Fig. 1B). We then optimized the lentivirus titer. Specifically, virus stock solutions were 10-fold serially diluted to obtain four concentrations and were then used to infect 293T cells. Based on the population of GFP-fluorescent cells, the titer of the LV-shRNA was calculated as 1 × 10⁹ TU/ml (Supplementary Fig. 1C).

ICV injection

For ICV injections, we adjusted our process according to a previous study [32]. Briefly, 21-day-old rats were deeply anesthetized using 2% sodium pentobarbital (0.2 ml/100 g body weight) and positioned in a stereotaxic apparatus. Under aseptic conditions, the head of the rat was shaved and the skin and periosteum were incised to expose the bregma point. Once the area had been prepared, a microsyringe with 1.5 µl LV-(-), LV-Grid1, or saline was inserted into the skull at a 90° angle in a position 2.5 mm posterior to the bregma, 0.5 mm lateral to the midline, and 8.6 mm inferior to the skull. This was held for 5 min, then slowly injected at a rate of 0.1 µl/min and retained for another 5 min before the syringe was removed.

Reverse transcription and qRT-PCR

The animals were euthanized by chloral hydrate, then collected blood, and whole tissues were excised and snap-frozen in liquid nitrogen. These operations are performed at nine o'clock every morning to ensure the stability of serum hormones. Total RNA was extracted using an OMEGA E.Z.N.A.™ Total RNA Kit II (Omega, Norcross, GA,USA) and reverse-transcribed into cDNA using an EasyScript One-Step gDNA removal and cDNA Synthesis SuperMix (TransScript, Beijing, China) according to the corresponding manufacturer’s specifications. All the reactions were performed in triplicate in a 20 µl total reaction volume. The cDNA obtained after reverse transcription was diluted 10-fold before qPCR. The following qPCR amplification program was used: 95 °C for 10 min; then 40 cycles of 95 °C for 15 sec, and 60 °C for 1 min; with a terminal hold at 4 °C. We used the Primer Premier5 online software to design the primers and evaluated their specificity using BLAST at NCBI. The list of the primers is shown in Table 1 and Gapdh was used as the control housekeeping gene. We collected the cycle threshold (Ct) from each reaction, and the expression level of each gene was evaluated using the 2^−ΔΔCT method[33].

Table 1

Primer sequences for qRT-PCR
Gene	Forward primers	Reverse primers	Product length (bp)
Grid1	GGACTTCAGCAAGCGATAC	AACACGAATATGAGCACACC	104
Gnrh	GCCGCTGTTGTTCTGTTGAC	CTGGGGTTCTGCCATTTGA	133
Rfrp-3	CCAAAGGTTTGGGAGAACAA	GGGTCATGGCATAGAGCAAT	127
Glud1	GACGCATCTCCGCTACTG	CAAATCCCTGAACAACAAACG	129
Gapdh	TCACCACCATGGAGAAGGC	GCTAAGCAGTTGGTGGTGCA	134

Fluorescence immunolocalization of GluD1

The sections were deparaffinized with 100% xylene and rehydrated using a gradient ethanol series. The sections were then dipped in 10% Bull Serum Albumin (BSA, Amresco, Solon, OH, USA) and incubated at room temperature for 20 min to block non-specific antigens. Rat anti-GluD1 primary polyclonal antibodies (Abcam, Cambridge, MA, USA) were then added and incubated for 18 hr at room temperature. Thereafter, the sections were incubated with donkey anti-rat immunoglobulin G-fluorescent dye NL557 (R&D Systems, Minneapolis, MN, USA) secondary antibodies for 1 hr at room temperature. The sections were incubated with Vectashield medium containing 4,6-dimercapto-2-phenylindole (DAPI; blue nuclear dye; Vector Laboratories) for 20 min in the dark. Finally, the sections were blocked with 50% glycerol in the dark. Negative controls were not incubated with primary antibodies, but only treated with secondary antibodies. The sections were observed under the microscope (OLYMPUS IX71, Germany) and mean fluorescence intensities of sections were analyzed by Image-Pro Plus6.0.

Effect of Grid1 knockdown on GluD1, E₂, and P₄ concentrations in serum

Serum GluD1 (XQ-JS2680, Origin Biotech, Hong Kong, China), FSH (CK-E30597R, Origin Biotech, Hong Kong, China), LH (CK-E30623R, Origin Biotech, Hong Kong, China), E₂ (CK-E30581R, Origin Biotech, Hong Kong, China) and P₄ (CK-E30580R, Origin Biotech, Hong Kong, China) concentrations were measured using commercial enzyme-linked immunosorbent assay kits according to the manufacturer’s instructions. Briefly, the test sample were diluted five times with Sample Dilution buffer in 96well plates, and 100 µl of HRP-conjugate reagent was added to each well, which were covered with an adhesive strip and incubated for 60 min at 37 °C. The 50 µl chromogen solution was added to each well, gently mixed and incubated for 15 min at 37 °C. Finally, 50 µl of Stop Solution was added and the optical density was read at 450 nm using a microtiter plate reader for 15 min. The FSH assay had a sensitivity of 0.1 IU/l, for LH it was 1.0 mIU/ml, for E₂ it was 1.0 pg/ml, and for P₄ it was 0.1 ng/ml, with an intra-assay coefficient of variation of less than 15%. The coefficient of the standard curves was 0.9900.

Hematoxylin and eosin (H&E) staining

Ovaries were fixed in 4% paraformaldehyde at 4 °C for more than 8 hr. Subsequently, the ovaries were dehydrated through a series of ethanol concentrations, cleaned in xylene, and embedded in paraffin. Finally, the ovaries sectioned serially at 5 µm. The sections were then deparaffinized in xylene, hydrated through a series of ethanol concentration, and stained with H&E. The method to distinguish primordial follicles, primary follicles and secondary follicles is refer to Andrea S. K. etc.[34].

Statistical analysis

All values are analyzed as the mean ± SD using the SPSS 19.0 software package (IBM Corp., Armonk, NY, USA). Differences were considered to be significant at P < 0.05.

The expression of the Grid1 mRNA and level of the GluD1 protein in hypothalamus from infant to pubertal rats

We used qRT-PCR and IF to detect the expression of Grid1 and GluD1 in the hypothalamus at different stage. qRT-PCR revealed that the Grid1 mRNA level in the hypothalamus at infancy was significantly higher (P < 0.05) than that at prepuberty and puberty, and the Grid1 mRNA level at prepuberty was significantly lower than that at puberty (P < 0.05) (Fig. 1A). GluD1 immunoreactivity (IR) was detected in the ARC, PVN, and PeN (Fig. 1B). The fluorescence intensity of GluD1 was similar in the ARC and PVN from infancy to puberty (P > 0.05); however, the GluD1 IR in the PeN of infant rats was significantly lower than that in prepubertal and pubertal animals (P < 0.05) (Fig. 1C).

Transfection of LV-Grid1 into primary hypothalamic cells

To determine the relative efficacy of Grid1 suppression, hypothalamic cells were transfected with LV-Grid1 or LV-(-) in parallel. We diluted the stock lentivirus concentrate 10-fold to obtain four lentivirus concentrations before transfection. Figure 2A shows the fluorescence intensity of the transfected cells, which for the undiluted stock solution reached the maximum at 72 hr (Supplementary Fig. 2). Therefore, we chose to use the stock solution for subsequent transfections of primary hypothalamic cells. Grid1 mRNA levels were measured at 72 hr after transduction. As shown in Fig. 2B, transduction with LV-Grid1 reduced the Grid1 transcriptional level at 72hr relative to that in LV-(-)-transduced or control-transduced cells. Thus, LV-Grid1 could effectively to suppress Grid1 expression and was suitable for use in subsequent experiments. In addition, in LV-Grid1-transfected cells, the expression of Rfrp-3 was also suppressed, while Gnrh expression increased, and the expression of Glud1 (encoding glutamate dehydrogenase 1) was no different (Fig. 2B).

The suppressive efficiency of LV-Grid1, puberty-related gene expression, and serum reproductive hormone concentrations in rats

To verify the knockdown efficiency of the lentiviruses in vivo, we excised the hypothalamus of rats at 7d after ICV, extracted the RNA, and used qRT-PCR to verify the expression of Grid1 mRNA. Compared with the control group and LV-(-) group, Grid1 mRNA levels were reduced by 46% in the hypothalamus of the LV-Grid1 group (Fig. 3A). The Gnrh mRNA increased significantly (P < 0.05) and Rfrp-3 mRNA decreased (P < 0.05), while that of Glud1 was no different compared with the control group after ICV (P > 0.05) (Fig. 3A). Meanwhile, the ovarian follicles were faster in the LV-Grid1 group, and there were more tertiary follicles compared with those in the control and LV-(-) groups. In contrast, there were more primary and secondary follicles in the control and LV-(-) groups than in the LV-Grid1 group (Fig. 3B). The concentrations of GluD1, E₂, P₄, FSH, and LH in serum obtained at 7 d after ICV injection were not significantly different among the groups (P > 0.05) (Fig. 3C-D). Meanwhile, there was no significant difference in ovarian weight and size among the three groups (Table 2, Supplementary Fig. 3a).

Table 2

Ovarian weight and size at 7 days after ICV injection
	Weight (mg)	Transverse diameter (cm)	Longitudinal diameter (cm)	Transverse perimeter (cm)	Longitudinal perimeter (cm)
Control	16.975 ± 0.357	0.416 ± 0.027	0.266 ± 0.012	1.074 ± 0.094	0.787 ± 0.077
LV-(-)	18.500 ± 1.323	0.455 ± 0.012	0.269 ± 0.007	1.185 ± 0.067	0.813 ± 0.034
LV-Grid1	16.00 ± 0.957	0.430 ± 0.020	0.270 ± 0.014	1.129 ± 0.036	0.816 ± 0.037
All data are shown as the mean ± SD.

Effect of Grid1 knockdown on the time of VO, puberty-related genes, and serum reproductive hormone concentrations in rats

We examined the VO every morning from 8:00 to 9:00 after ICV injection of lentivirus in PND21 rats. As shown in Fig. 4A, on average, the time of rat VO occurred significantly earlier in the LV-Grid1 group compared with that of the control group or LV-(-) group (P < 0.05). Then, female rats were mated with normal male rats to study the change of average litter size and weight of their progeny. Interestingly, no differences were found among the groups (P > 0.05) (Fig. 4B, Table 3).

Table 3

The weight of offspring
Groups	Sex (n = 6)	Weight (g)
Control	Male	6.719 ± 0.347
Control	Female	6.434 ± 0.380
LV-(-)	Male	6.578 ± 0.627
LV-(-)	Female	6.271 ± 0.583
LV-Grid1	Male	6.554 ± 0.296
LV-Grid1	Female	6.301 ± 0.120
All data are shown as mean ± SD.

We observed effect of Grid1 knockdown on Grid1, Gnrh, Rfrp-3, and Glud1 mRNAs levels in the hypothalamus, histology of the ovaries and the serum GluD1, E₂, and P₄ concentrations of rats in the LV-Grid1 group showing VO and in the control and LV-(-) groups at matched ages. We found the expression of Grid1 mRNA in the hypothalamus similar in the control and LV-(-) groups (P > 0.05) (Fig. 5A). Meanwhile, the level of Gnrh, Rfrp-3, and Glud1 mRNA after ICV injection of LV-Grid1 in 21 d rats also showed no difference compared with the control and LV-(-) groups (P > 0.05) (Fig. 5A). The number of corpora lutea (CLs) in LV-Grid1 group was more than that in the control and LV-(-) group, and the number of primary and secondary follicles in LV-Grid1 group also similar to the control group and LV-(-) group (Fig. 5B). By contrast, in the serum from rats in the LV-Grid1 group rats with VO, the concentrations of E₂, P₄ and LH were significantly increased (P < 0.05), and the concentrations of GluD1 and FSH not different compared with those in the control group and LV-(-) group at the same age (P > 0.05) (Fig. 5C-D). Interestingly, the weight, transverse diameter, longitudinal diameter, and longitudinal perimeter of the ovaries obtained from the LV-Grid1 group were significantly larger than those of the control and LV-(-) groups (Table 4, Supplementary Fig. 3b).

Table 4

Ovarian weight and size of rats which LV-*Grid1* group showing VO and the control group and LV-(-) group at matched age after ICV injection
	Weight (mg)	Transverse diameter (cm)	Longitudinal diameter (cm)	Transverse perimeter (cm)	Longitudinal perimeter (cm)
Control	42.550 ± 0.519	0.430 ± 0.035	0.3288 ± 0.022	1.211 ± 0.103	0.881 ± 0.085
LV-(-)	42.350 ± 0.777	0.493 ± 0.012	0.3672 ± 0.013	1.259 ± 0.031	0.885 ± 0.068
LV-Grid1	50.900 ± 0.528*	0.566 ± 0.018*	0.436 ± 0.014*	1.410 ± 0.063	1.205 ± 0.033*
All data are shown as mean ± SD.*P < 0.05

Glutamate is widely distributed in the brain and is a major excitatory neurotransmitter. It plays an important role in neurotransmission and affects the growth, maturation, repair and neurotransmission of neurons in the brain [10]. Glutamate participates in the regulation of various functions of the nervous system. The HPGA can be reactivated in the juvenile stage by treatment with neurotransmitters such as glutamate and kisspeptin [35]. The mechanism of the onset of the puberty is believed to involve initiation of the HPGA [36]. In this process, pulsatile GnRH secretions from specialized hypothalamic neurons stimulate hormone cascades and gonadal activation [37]. Combined with previous studies in our laboratory, the methylation level of Grid1 changes during the onset of puberty in rats and goats [30, 38]. In the present study, we found that GluD1 IR localized to hypothalamic nuclei, especially in the PVN, PeN, and ARC, which are implicated in GnRH secretion [39–41]. The fluorescence intensity in PeN of infant rat is low than pubertal rat, it remind there are affinity between different nucleus of hypothalamus and puberty onset. In addition, the level of Grid1 mRNA in the hypothalamus of prepubertal rats was significantly lower than that during puberty. These results indicated that Grid1 might modulate hypothalamic and pituitary hormones, but how Grid1 regulates the hormone secretion and affect onset of puberty require further research.

Lentiviral vectors have been developed as replication-defective retroviral vectors that can infect non-dividing and mitotic cells. Lentiviral vectors have two distinct properties: Long-term stability and the reduced likelihood of eliciting an immune response; therefore, they are ideal for in vivo genetic experiments. Lentiviral vector-mediated RNA interference technology combines the advantages of a lentiviral vector with those of RNA interference when using a sequence that is specifically targeted to inhibit gene expression. These tools have been proven to be effective in a variety of mammalian cells and in many disease models [42–46].

In the present study, to investigate whether Grid1 is involved in the regulation of GnRH, we constructed a lentiviral vector expressing an shRNA targeting Grid1, which was transduced into primary neurons of the hypothalamus, resulting in significant suppression of Grid1 expression. Suppression of Grid1 caused an increase in the expression level of Gnrh mRNA in hypothalamic cells, whereas the expression level of Rfrp-3 mRNA decreased. Grid1, as a glutamate receptor on neurons, acts as an excitatory neurotransmitter in many synapses in the CNS. When the expression of Grid1 is decreased, it might affect the secretion of RFRP 3. Studies have shown that RFRP 3 inhibits the secretion of GnRH from nerve cells [47, 48], and reduce the secretion of LH[12]. Therefore, we speculated that when the Grid1 expression is suppressed, the expression of Rfrp-3 mRNA is decreased, thereby promoting GnRH secretion, resulting in an increase in the expression of GnRH mRNA. Therefore, the results indicated that Grid1 knockdown might affect the key genes related to puberty in female rats.

One of the most important neuroendocrine events associated with reproduction, leading to an increase in LH, requires hypothalamic synthesis of progesterone [49]. In this study, we observed that the concentrations of E₂, P₄, GluD1, FSH and LH in serum obtained from the rats after ICV injection with LV-Grid1 7 days similar to those of the LV-(-) and control groups, we speculated that the ovaries are immature and insensitive to hormonal stimulation at PND28. Interestingly, in the serum from rats in LV-Grid1 group with VO, the concentrations of E₂, P₄, and LH were significantly increased, while the concentrations of GluD1 and FSH were similar to those in the age-matched control and LV-(-) groups. At this stage, the LV-Grid1 group showed higher concentrations of E₂ and P₄, which would cause the LH surge and estrous cyclicity. The change of LH secretion pattern is the result of pulsed release of GnRH with the development, because the pulsed GnRH release also increases in puberty[50]. Hypothalamus release GnRH, which promotes pituitary release LH and FSH, and they stimulate gonadal release gonadal hormone. At puberty, hypothalamus sensitivity to gonadal decreased, and then the inhibitory effect of inhibiting factors which inhibit release of GnRH was relieved, and the sexual center changed from inhibitory to excitatory stage.

In the present study, at 7 days after ICV injection of LV-Grid1, Grid1 mRNA expression was reduced by 46% compared with that in the control group, whereas the Gnrh mRNA level was significantly increased, and the Rfrp-3 mRNA expression was significantly reduced. These results implied that suppression of Grid1 might cause changes of in the process of puberty in female rats. In rats, the effect of Grid1 appears to continue into the onset of puberty. Our study indicate that Grid1 may affect HPGA by regulating GnRH neurons. However, there was no difference in the level of Grid1, Glud1, Rfrp-3, and Gnrh mRNA between in the LV-Grid1 group showing VO and in the control and LV-(-) groups at matched ages. Despite this, ICV injection to suppress Grid1 significantly advanced the time of puberty onset in rats. Combing the time of VO and the change of reproduction-related genes, we speculate that the effect of LV-Grid1 may be time-sensitive after puberty onset, which no effect on Gnrh, Rfrp-3 and Glud1 mRNA when puberty onset. This was accompanied by enhanced ovarian development, as reflected by CLs formation or the promotion of follicle development, during early-stage puberty.

Li et al. [32] reported that hypothalamic suppression of Enhance at puberty-1 (Eap1) delayed the onset of rat VO and Eap1-regulation of puberty may not necessitate KISS1/GPR54 signaling. This implied the Eap1 plays an important role in the regulation of puberty, which, together with GnRH, forms a new pathway of puberty regulation. Combined with the results our study, further studies are required to determine the effect of Grid1 suppressed on additional genes such as Eap1 or other signaling pathways during the onset of puberty.

In summary, Grid1 and its associated proteins are altered during the development of puberty, and Grid1 knockdown in vivo and in vitro affected the expression of genes related to puberty, as well as advancing the time of VO, changing the secretion of reproductive hormones, and increasing the weight and size of the ovaries. These results suggest that Grid1 regulates the onset of puberty in female rats; however, the mechanism remains be further studied.

GluD1: glutamate ionotropic receptor delta type subunit 1; LV-Grid1: Lentivirus-Grid1; ICV : intracerebroventricular injected; ARC: arcuate nucleus; PVN: paraventricular nucleu; PeN: periventricular nucleus; RFRP-3: RFamide-related peptide 3; GnRH: gonadotropin-releasing hormone; VO: vaginal opening; LH: luteinizing hormone; E2: estradiol; P4:progesterone; HPGA: hypothalamus-pituitary-gonadal axis; ME: median eminence; FSH: follicle stimulating hormone; GABA: γ-aminobutyric acid; Glu: Glutamate; CNS: central nervous system; GluD2: glutamate ionotropic receptor delta type subunit 2; qRT-PCR: quantitative real-time reverse transcription PCR; IF: immunofluorescence; RNAi: RNA interference; PND: postnatal day; H&E: Hematoxylin and eosin; IR: immunoreactivity; CLs: corpora lutea

Acknowledgements

We would like to thank the members of Anhui Provincial Laboratory of Animal Genetic Resources Protection and Breeding, Anhui Provincial Laboratory for Local Livestock and Poultry Genetic Resource Conservation and Bio-Breeding for their abundant discussions and valuable sggestions.

Authors’ contributions

Conceived and designed the experiments: F.F.G., and Y.J.; Performed the experiments: Q.P., and L.H.L.; Analyzed the data: Y.J., and S.W.Y. and Y.Z.Q.; Contributed reagents/materials/analysis tools: L.Y., Y.T., Z.Y.H., L.Y.H., C.H.G., W.J.H., L.Y.S., F.G.F.; Wrote the manuscript: Y.J

Funding

This work was supported by grants from the National Natural Science Foundation of China [grant number 31972629 and 31772566].

Availability of data and materials

All data generated through this study are included in this article.

Ethics approval and consent to participate

All procedures involving animals were approved by the Animal Care and Use Committee of Anhui Agricultural University.

Consent for publication

Not applicable.

Competing interests

The authors declare no conflicts of interest.

Grumbach MM: The neuroendocrinology of human puberty revisited. Horm Res 2002, 57 Suppl 2:2-14.
Ojeda SR, Lomniczi A, Mastronardi C, Heger S, Roth C, Parent AS, Matagne V, Mungenast AE: Minireview: the neuroendocrine regulation of puberty: is the time ripe for a systems biology approach? Endocrinology 2006, 147:1166-1174.
Kakarla N, Bradshaw KD: Disorders of pubertal development: precocious puberty. Semin Reprod Med 2003, 21:339-351.
Ramirez VD, Sawyer CH: Advancement of Puberty in the Female Rat by Estrogen. Endocrinology 1965, 76:1158-1168.
Pineda R, Aguilar E, Pinilla L, Tena-Sempere M: Physiological roles of the kisspeptin/GPR54 system in the neuroendocrine control of reproduction. Prog Brain Res 2010, 181:55-77.
Watanabe M, Fukuda A, Nabekura J: The role of GABA in the regulation of GnRH neurons. Front Neurosci 2014, 8:387.
Iremonger KJ, Constantin S, Liu X, Herbison AE: Glutamate regulation of GnRH neuron excitability. Brain Res 2010, 1364:35-43.
Bourguignon JP, Gerard A, Franchimont P: Maturation of the hypothalamic control of pulsatile gonadotropin-releasing hormone secretion at onset of puberty: II. Reduced potency of an inhibitory autofeedback. Endocrinology 1990, 127:2884-2890.
Roth CL, Mastronardi C, Lomniczi A, Wright H, Cabrera R, Mungenast AE, Heger S, Jung H, Dubay C, Ojeda SR: Expression of a tumor-related gene network increases in the mammalian hypothalamus at the time of female puberty. Endocrinology 2007, 148:5147-5161.
Konradi C, Heckers S: Molecular aspects of glutamate dysregulation: implications for schizophrenia and its treatment. Pharmacol Ther 2003, 97:153-179.
Monaghan DT, Bridges RJ, Cotman CW: The excitatory amino acid receptors: their classes, pharmacology, and distinct properties in the function of the central nervous system. Annu Rev Pharmacol Toxicol 1989, 29:365-402.
Allen NC, Bagade S, McQueen MB, Ioannidis JP, Kavvoura FK, Khoury MJ, Tanzi RE, Bertram L: Systematic meta-analyses and field synopsis of genetic association studies in schizophrenia: the SzGene database. Nature Genet 2008, 40:827-834.
Schmid SM, Hollmann M: To gate or not to gate: are the delta subunits in the glutamate receptor family functional ion channels? Mol Neurobiol 2008, 37:126-141.
Fallin MD, Lasseter VK, Avramopoulos D, Nicodemus KK, Wolyniec PS, McGrath JA, Steel G, Nestadt G, Liang KY, Huganir RL, et al: Bipolar I disorder and schizophrenia: a 440-single-nucleotide polymorphism screen of 64 candidate genes among Ashkenazi Jewish case-parent trios. Am J Hum Genet 2005, 77:918-936.
Guo SZ, Huang K, Shi YY, Tang W, Zhou J, Feng GY, Zhu SM, Liu HJ, Chen Y, Sun XD, He L: A case-control association study between the GRID1 gene and schizophrenia in the Chinese Northern Han population. Schizophr Res 2007, 93:385-390.
Venken T, Alaerts M, Souery D, Goossens D, Sluijs S, Navon R, Van Broeckhoven C, Mendlewicz J, Del-Favero J, Claes S: Chromosome 10q harbors a susceptibility locus for bipolar disorder in Ashkenazi Jewish families. Mol Psychiatr 2008, 13:442-450.
Treutlein J, Muhleisen TW, Frank J, Mattheisen M, Herms S, Ludwig KU, Treutlein T, Schmael C, Strohmaier J, Bosshenz KV, et al: Dissection of phenotype reveals possible association between schizophrenia and Glutamate Receptor Delta 1 (GRID1) gene promoter. Schizophr Res 2009, 111:123-130.
Greenwood TA, Lazzeroni LC, Murray SS, Cadenhead KS, Calkins ME, Dobie DJ, Green MF, Gur RE, Gur RC, Hardiman G, et al: Analysis of 94 candidate genes and 12 endophenotypes for schizophrenia from the Consortium on the Genetics of Schizophrenia. Am J Psychiatry 2011, 168:930-946.
Orsetti M, Di Brisco F, Rinaldi M, Dallorto D, Ghi P: Some molecular effectors of antidepressant action of quetiapine revealed by DNA microarray in the frontal cortex of anhedonic rats. Pharmacogenet Genomics 2009, 19:600-612.
Zhu YL, Kalbfleisch T, Brennan MD, Li Y: A MicroRNA gene is hosted in an intron of a schizophrenia-susceptibility gene. Schizophr Res 2009, 109:86-89.
Orsetti M, Di Brisco F, Canonico PL, Genazzani AA, Ghi P: Gene regulation in the frontal cortex of rats exposed to the chronic mild stress paradigm, an animal model of human depression. Eur J Neurosci 2008, 27:2156-2164.
Smith M, Spence MA, Flodman P: Nuclear and mitochondrial genome defects in autisms. Ann N Y Acad Sci 2009, 1151:102-132.
Cooper GM, Coe BP, Girirajan S, Rosenfeld JA, Vu TH, Baker C, Williams C, Stalker H, Hamid R, Hannig V, et al: A copy number variation morbidity map of developmental delay. Nature Genet 2011, 43:838-846.
Glessner JT, Wang K, Cai GQ, Korvatska O, Kim CE, Wood S, Zhang HT, Estes A, Brune CW, Bradfield JP, et al: Autism genome-wide copy number variation reveals ubiquitin and neuronal genes. Nature 2009, 459:569-573.
van Bon BWM, Balciuniene J, Fruhman G, Nagamani SCS, Broome DL, Cameron E, Martinet D, Roulet E, Jacquemont S, Beckmann JS, et al: The phenotype of recurrent 10q22q23 deletions and duplications. Eur J Hum Genet 2011, 19:400-408.
Balciuniene J, Feng N, Iyadurai K, Hirsch B, Charnas L, Bill BR, Easterday MC, Staaf J, Oseth L, Czapansky-Beilman D, et al: Recurrent 10q22-q23 deletions: a genomic disorder on 10q associated with cognitive and behavioral abnormalities. Am J Hum Genet 2007, 80:938-947.
Safieddine S, Wenthold RJ: The glutamate receptor subunit delta1 is highly expressed in hair cells of the auditory and vestibular systems. The Journal of Neuroscience 1997, 17:7523-7531.
Konno K, Matsuda K, Nakamoto C, Uchigashima M, Miyazaki T, Yamasaki M, Sakimura K, Yuzaki M, Watanabe M: Enriched expression of GluD1 in higher brain regions and its involvement in parallel fiber-interneuron synapse formation in the cerebellum. J Neurosci 2014, 34:7412-7424.
Herbison AE: Control of puberty onset and fertility by gonadotropin-releasing hormone neurons. Nat Rev Endocrinol 2016, 12:452-466.
Yang C, Ye J, Li X, Gao X, Zhang K, Luo L, Ding J, Zhang Y, Li Y, Cao H, et al: DNA Methylation Patterns in the Hypothalamus of Female Pubertal Goats. PLoS One 2016, 11:e0165327.
Paxinos, George, Paxinos G, Watson C, Watson, Charles: - The Rat Brain in Stereotaxic Coordinates. Elsevier Academic Press; 2007.
Li CX, Li P: Enhanced at Puberty-1 (Eap1) Expression Critically Regulates the Onset of Puberty Independent of Hypothalamic Kiss1 Expression. Cell Physiol Biochem 2017, 43:1402-1412.
Livak KJ, Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 2001, 25:402-408.
Jones ASK, Shikanov A: Follicle development as an orchestrated signaling network in a 3D organoid. J Biol Eng 2019, 13.
Herbison AE: Control of puberty onset and fertility by gonadotropin-releasing hormone neurons. Nat Rev Endocrinol 2016, 12:452-466.
Terasawa E: Postnatal remodeling of gonadotropin-releasing hormone I neurons: toward understanding the mechanism of the onset of puberty. Endocrinology 2006, 147:3650-3651.
Harris GC, Levine JE: Pubertal acceleration of pulsatile gonadotropin-releasing hormone release in male rats as revealed by microdialysis. Endocrinology 2003, 144:163-171.
Luo L, Yao ZQ, Ye J, Tian Y, Yang C, Gao XX, Song M, Liu Y, Zhang YH, Li YS, et al: Identification of differential genomic DNA Methylation in the hypothalamus of pubertal rat using reduced representation Bisulfite sequencing. Reprod Biol Endocrinol 2017, 15.
Clarkson J, Herbison AE: Postnatal development of kisspeptin neurons in mouse hypothalamus; sexual dimorphism and projections to gonadotropin-releasing hormone neurons. Endocrinology 2006, 147:5817–5825.
Gottsch ML, Cunningham MJ, Smith JT, Popa SM, Acohido BV, Crowley WF, Seminara S, Clifton DK, Steiner RA: A role for kisspeptins in the regulation of gonadotropin secretion in the mouse. Endocrinology 2004, 145:4073-4077.
Nestor CC, Bedenbaugh MN, Hileman SM, Coolen LM, Lehman MN, Goodman RL: Regulation of GnRH pulsatility in ewes. Reproduction 2018, 156:R83-R99.
Zhou SS, Li P: Effects of NELL2 on the regulation of GnRH expression and puberty in female rats. Genet Mol Res 2014, 13:6672-6682.
Gonzalez-Alegre P, Bode N, Davidson BL, Paulson HL: Silencing primary dystonia: lentiviral-mediated RNA interference therapy for DYT1 dystonia. J Neurosci 2005, 25:10502-10509.
Nishitsuji H, Ikeda T, Miyoshi H, Ohashi T, Kannagi M, Masuda T: Expression of small hairpin RNA by lentivirus-based vector confers efficient and stable gene-suppression of HIV-1 on human cells including primary non-dividing cells. Microbes Infect 2004, 6:76-85.
Raoul C, Abbas-Terki T, Bensadoun JC, Guillot S, Haase G, Szulc J, Henderson CE, Aebischer P: Lentiviral-mediated silencing of SOD1 through RNA interference retards disease onset and progression in a mouse model of ALS. Nat Med 2005, 11:423-428.
Rawls AS, Gregory AD, Woloszynek JR, Liu FL, Link DC: Lentiviral-mediated RNAi inhibition of Sbds in murine hematopoietic progenitors impairs their hematopoietic potential. Blood 2007, 110:2414-2422.
Jadhao AG, Pinelli C, D'Aniello B, Tsutsui K: Gonadotropin-inhibitory hormone (GnIH) in the amphibian brain and its relationship with the gonadotropin releasing hormone (GnRH) system: An overview. Gen Comp Endocrinol 2017, 240:69-76.
Tsutsui K, Ubuka T: GnIH Control of Feeding and Reproductive Behaviors. Front Endocrinol (Lausanne) 2016, 7:170.
Mittelman-Smith MA, Rudolph LM, Mohr MA, Micevych PE: Rodent Models of Non-classical Progesterone Action Regulating Ovulation. Front Endocrinol (Lausanne) 2017, 8:165.
Watanabe G, Terasawa E: In vivo release of luteinizing hormone releasing hormone increases with puberty in the female rhesus monkey. Endocrinology 1989, 125:92-99.

Supplement1.docx
Supplementary Figure 1 Lentivirus sequence results and titer detection.
Supplement2.docx
Supplementary Figure 2 Four serial diluents of the virus stock solution were used to infect hypothalamus neurons. (A1-3) Control group; (B1-3) LV-(-) group; (C1-3)1 × 109 TU/ml; (D1-3) 1 × 108 TU/ml; (E1-3) 1 × 107 TU/ml; (F1-3) 1 × 107 TU/ml.
Supplement3.docx
Supplementary Figure 3 Pictures of ovaries after 7 days (a) and VO in the LV-Grid1 group rats and in the control group and LV-(-) group at the same age (b).

Download PDF

Version 1

posted

You are reading this latest preprint version

Grid1 Regulates the Onset of Puberty in Female Rats

Status:

Version 1

Abstract

Figures

Background

Methods

Animals

Experimental design

Primary hypothalamic cell culture

LV Construction

LV transfection

LV construction and selection of the optimal titer

ICV injection

Reverse transcription and qRT-PCR

Fluorescence immunolocalization of GluD1

Effect of Grid1 knockdown on GluD1, E₂, and P₄ concentrations in serum

Hematoxylin and eosin (H&E) staining

Statistical analysis

Results

Discussion

Conclusion

Abbreviations

Declarations

References

Supplementary Files

Status:

Version 1

Grid1 Regulates the Onset of Puberty in Female Rats

Status:

Version 1

Abstract

Figures

Background

Methods

Animals

Experimental design

Primary hypothalamic cell culture

LV Construction

LV transfection

LV construction and selection of the optimal titer

ICV injection

Reverse transcription and qRT-PCR

Fluorescence immunolocalization of GluD1

Effect of Grid1 knockdown on GluD1, E2, and P4 concentrations in serum

Hematoxylin and eosin (H&E) staining

Statistical analysis

Results

Discussion

Conclusion

Abbreviations

Declarations

References

Supplementary Files

Status:

Version 1

Effect of Grid1 knockdown on GluD1, E₂, and P₄ concentrations in serum