Silibinin, Synergistically Enhances Vinblastine-Mediated Apoptosis in Triple Negative Breast Cancer Cell Line: Involvement of Bcl2/Bax and Caspase-3 Pathway

doi:10.21203/rs.3.rs-1341486/v1

Download PDF

Research Article

Silibinin, Synergistically Enhances Vinblastine-Mediated Apoptosis in Triple Negative Breast Cancer Cell Line: Involvement of Bcl2/Bax and Caspase-3 Pathway

https://doi.org/10.21203/rs.3.rs-1341486/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Triple-negative breast cancer with poor prognosis and survival is the most invasive breast cancer subtype. Usually, TNBC requires a chemotherapy regime at all stages, but chemotherapy drugs showed many side effects. We assumed that combination therapy of vinblastine and silibinin might reduce the vinblastine toxicity and dose.

Methods

The MDA-MB-231 cells subjected to MTT assay for IC50 determination and combination effects were measured based on Chou-Talalay's methods. The type of cell death determined by using Flow-cytometric assay. Cell death pathway markers as, Bcl-2, Bax, and caspase-3 were analyzed by western blot and QPCR.

Results

The treatment of MDA-MB-231 cells exhibited IC50 and synergism at combination of 30µM of silibinin and 4µm of vinblastine in cell viability assay (CI = 0.69). YO-PRO-1/PI double staining results showed a significant induction of apoptosis when MDA-MB-231 cells were treated with silibinin and vinblastine combination (p < 0.01). Protein levels of Bax and cleaved caspase-3 upregulated and Bcl-2 downregulate significantly. Significant upregulation of Bax (2.96-fold) and caspase-3 (3.46-fold) while Bcl-2 2-fold downregulated.

Conclusion

Findings established a preclinical rationale for silibinin and vinblastine combination. This combination produces synergistic effects in MDA-MB-231 cells via the alteration of pro and anti-apoptotic genes and may decrease toxicity and side effects of vinblastine.

Vinblastine

Silibinin

Drug combination

Triple negative breast cancer (TNBC)

Apoptosis

Lack of progesterone receptor (PR), estrogen receptor (ER), and human epidermal growth factor receptor 2 (HER2) characterized a heterogenous subtype of breast cancer named Triple-negative breast cancer (TNBC). Although TNBC comprises only 15–20% of all diagnosed breast cancer patients, it is associated with poor prognosis, metastasis, and high recurrence rate (1, 2). Due to lack of receptors expression, TNBC is unresponsive to targeted therapies, and management of this type has been mainly limited to chemotherapy and surgery (3).

Microtubules possess highly dynamic structures and play a crucial role in cellular physiology and cell division. This dynamic structure makes them appropriate candidate for anticancer therapeutic development like vinca alkaloids, epothilones, taxanes and eribulin (4). Vinblastine is a natural alkaloid derived from Catharanthus roseus that perturbs tubulin polymerization and induces cell death. Also, vinblastine interferes with spindle formation, leading to chromosome segregation. It is used to treat some solid tumors such as breast cancer, bladder, brain, melanoma, and testicular tumors. Vinblastine in combination with other chemotherapy agents exhibit its effectiveness in patients with metastatic breast cancer or patients with relapse after adjuvant therapy (5). In addition to the benefits of vinblastine, side effects of this therapeutic agent including white blood cells and platelet loss, anemia, hair loss, gastrointestinal problems, sweating, hypertension, muscle cramps, depression, headache, dizziness, and cardiac problems limit its use in the realm of clinical application (6, 7).

Silibinin, a natural polyphenolic flavonoid, is the foremost bioactive flavanone found in milk thistle seeds. Silibinin has a wide range of phytotherapeutic applications. It was reported that this compound showed antioxidant, anti-inflammatory, and anti-cancer properties (8). On the other hand, it has been reported that consumption of silibinin can be safe and non-toxic in animals and humans. By reviewing recent pubications against different cancers, it is clearly evident that silibinin showed its efficacy mainly through targeting proliferation, inflammation, angiogenesis, apoptosis, and tumor cell metabolism. It was described that silibinin targets a range of cellular signaling cascades and molecules, including NF-kappaB transcription factor (NF-κB), MAPK (mitogen-activated protein kinase), epidermal growth factor receptor, HIF-1α (hypoxia-inducible factor 1-alpha), transcription factor AP-1, cyclooxygenase, phosphoinositide 3-kinase/Akt, and β-catenin. Accordingly, silibinin's biological effects happen by these molecular alterations (9, 10).

Nowadays, researchers are focused on the investigation of dietary supplements and other phytotherapeutic agents for their synergistic efficacy in combination with anticancer drugs to minimize the systemic toxicity of chemotherapeutic agents (11). Research has shown combined treatment of dietary phytochemicals with chemotherapeutics could sensitize cancer cells to apoptosis and reduce side effects of chemotherapy (12). For illustration, silibinin in combination with paclitaxel, cisplatin, carboplatin, and doxorubicin in human breast carcinoma models including MCF-7, MDA-MB-435, and MDA-MB-468 cells was studied, and results indicated that this concomitant use made more substantial apoptotic death compared to either agent alone in the cell lines (11, 13).

However, there are no reports on the synergistic effect of vinblastine-silibinin in TNBC, which could be considered a significant element in developing a new combination chemotherapy strategy. Therefore, we evaluate whether silibinin can synergize with the therapeutic efficacy of vinblastine in human TNBC cell models.

Cell culture condition

Highly metastatic human breast cancer TNBC cell line (MDA-MB-231) was provided from the Pasteur Institute Cell Bank of Iran. Complete RPMI-1640 medium containing 10% FBS, 2 mg/ml sodium bicarbonate, 100 µg/ml streptomycin and 0.05 mg/ml penicillin G were used for cell culture. Standard 25 cm² flasks were used for cell culture in a humidified incubator containing a 5% CO2 at 37°C.

MTT cytotoxicity assays and drug combinations analysis

The IC50 value (half-maximal inhibitory concentration) of silibinin and vinblastine for MDA-MB-231 cell line was assessed by the MTT cytotoxic assay. MDA-MB-231 cells at a density of 5,000 cells per well seeded into 96 well plates and incubated in normal cell culture conditions to reach 80% confluency. The next day, cells were exposed to single agents at increasing concentrations (from 5 mM − 640 µM for silibinin and 2.5 µM-160 µM for vinblastine). After 48 hours of incubation, the supernatant culture medium was discarded and 50 µL of Tetrazolium dye (Sigma) (0.5 mg/ml) was added to each well and incubated for 4 hours at 37°C in a CO₂ incubator. After incubation period, to dissolve the formazan crystals, 25 µl of Sorenson’s buffer and 200 µl of DMSO were added to the each well. Finally, by using an ELISA plate reader (Stat-Fax-3200; Awareness Technologies, Westport, CT/USA), absorbance at 570 nm wavelength was read. Cell viability was determined using the following formula:

Cell viability (%) = Absorbance Test/ Absorbance Control × 100.

For experiment with silibinin and vinblastine according to the strongest concentration-dependent effects of the single agents, cells were simultaneously exposed to both agents (silibinin 5-640 µM and vinblastine 1.9–30 µM) with the combined ratio of 1: 25, each diluted 1: 2 within the given ranges were used. CompuSyn software (Version 1.0, Combo-Syn Inc., US) was used to determine the drug interaction between fixed ratios of silibinin and vinblastine based on the Chou-Talalay method for drug combinations. CI (combination Index) value indicated the mechanism of drugs interactions. CI < 0.9, CI = 0.9–1.1 and CI > 1.1 indicating synergistic, additive mode and antagonistic manners, respectively (14).

Flowcytometry YO-PRO-1/PI double staining

The Yo-Pro-1 assay kit (Invitrogen, CA, USA) was used to quantify of apoptotic cells, and the procedure performed according to the manufacturer’s protocol. Briefly, the 250000 cells/well were seeded in a six-well plate and drugs were added after 24 h incubation in humified atmosphere. After the incubation period, cells were exposed for 48 hours to silibinin and vinblastine (equal to IC50 values), and their combination. Later, cells were detached by tripsin and resuspended in one ml cold PBS. Then, one µL of Yo-Pro-1 solution and one µL of propidium iodide (PI) solution were added to the cell suspension. Cells were kept on ice in a dark place for 30 min, and fluorescence results were measured using the flow cytometer apparatus (Becton Dickinson, CA, USA) and evaluated by CellQuest Software (Becton Dickinson, CA, USA).

Western blot

After treatment with silibinin, vinblastine (equal to IC50 values) and their combination for 48 hours, cells were washed three times with PBS and lysed in RIPA cell lysis buffer containing 50 µL 0.1 mol/L PMSF and100 µL proteinase inhibitor cocktails. The cell lysate was centrifuged at 12,000 rpm for 10 min at 4°C. Protein in each treated sample was separated on SDS-PAGE and electrically transferred to PVDF membrane. The PVDF membrane was blocked with 5% nonfat dry milk for 1 hour and followed by the incubation with 1:1000 dilution of primary antibody at 4°C overnight. Then, the PVDF membrane was washed and incubated with HRP-conjugated secondary antibody at room temperature for one h. ECL kit were used for the immunoreactive proteins detection.

Real-Time PCR

Following 48 hours of treatment of MDA-MB-231 cell line with concentrations equal to IC50 values of both agents and their combination, total RNA extraction was performed by RNXPlus Solution (SinaClon Co., Tehran, Iran). The synthesis of cDNA was conducted using the Pars Tous RT Reagent kit (Pars tous, Iran) as described by the manufacturer.

For RT-PCR, three replicates of each sample were amplified in a 20 µL reaction mixture containing 1 µL of 0.5 mM of primer, 4 µL of diluted cDNA template, 10 µL SYBR Green reaction mix and 5 µL DW in PCR micro tube. Table 1 showed the specific primers. Rotor gene 6000 system (corrbet, Australia) were used for PCR amplification. β-actin was used as endogenous control for normalizing RNA concentration, and relative expression in mRNA levels of desired genes was calculated using the comparative 2^−ΔΔCt method (15).

Table 1

List of primer sequences
Genes	primer sequence
Β-Actin	F- TCCCTGGAGAAGAGCTACG R- GTAGTTTCGTGGATGCCACA
Caspase-3	F-AGGACTCTAGACGGCATCCA R-CAGTGAGACTTGGTGCAGTGA
Bax	F-TTCATCCAGGATCGAGCAGG R-TGAGACACTCGCTCAGCTTC
Bcl-2	F-TGGACAACCATGACCTTGGACAATCA R-TCCATCCTCCACCAGTGTTCCCATC

Statistical analysis

GraphPad Prism 6.01 software was used for analyzing data (mean ± SD). Unpaired student-t test was used for assessing statistical difference. P value less than 0.05 was considered statistically significant.

Effects of silibinin and its combination with vinblastine on MDA-MB-231 cell line

MTT assay were used for cytotoxic effect determination of two agents alone and their combination. (Fig. 1A, B, and C). Within the described ranges, both agents evidently decreased the viability of MDA-MB-231 cells in a concentration-dependent manner. The IC50 values of silibinin and vinblastine calculated by CompuSyn software were 192.249 µM and 29.819 µM for MDA-MB-231 cells. Next, MTT results also indicated that combining two agents mediated synergistic effects on MDA-MB-231 cells (CI < 0.9). (Fig. 1D, E, and F). The combination of 105 µM of silibinin with 4 µM of vinblastine (total concentration 110 µM) cause decreased the viability of cells to 50% viability (the IC50 value of combination agents) (CI = 0.69). The dose reduction index (DRI) for the combination of silibinin and vinblastine, which affected 50% of the cells after 48h treatment, was 1.8 (the dose of silibinin was reduced from 190 to 110 µM) and 7.01 (the dose of vinblastine was reduced from ~ 30 µM to 4 µM) respectively. All subsequent experiments were performed with IC50 concentrations.

Combination of silibinin and vinblastine induced marked apoptosis of MDA-MB-231 cells

Apoptosis plays a crucial role in the regulation of the killing of cancer cells by anticancer agents. To evaluate whether the cell death observed in MDA-MB-231 cells after silibinin and vinblastine combination treatment might occur through apoptosis, YO-PRO-1/PI double staining was utilized.

YO-PRO-1/PI double staining results indicated that total apoptotic cell of MDA-MB-231cells treated with silibinin, vinblastine and their combination were 17.46%, 34.72%, and 47.60%, respectively (Fig. 2). These results indicated that a combination of two agents could effectively induce apoptosis in MDA-MB-231 cells.

Combination of silibinin and vinblastine altered Bcl2/Bax ratio and cleaved caspase-3 in protein level

After observing the flow cytometry results, we measured Bcl-2, Bax, and cleaved caspase-3 proteins levels after the MDA-MB-231 cells were treated with IC50 concentration of silibinin, vinblastine, and their combination for 48h. We found that Bax and cleaved caspase-3 were significantly upregulated while the expression of Bcl-2 protein was down-regulated. On the other hand, the ratio of Bcl-2/Bax was decreased considerably (Fig. 3).

Combination of silibinin and vinblastine alter mRNA expression of Bcl2, Bax and caspase3

Consequent apoptosis change in protein expression, we evaluated the effects of silibinin and vinblastine on the genes expression level of Bcl2, Bax and caspase-3 by quantitative RT-PCR. As shown in Fig. 4, after 48h treatment, the expression level of Bax (2.96-fold) and caspase 3 (3.46-fold) showed significant upregulation while Bcl2 mRNA expression level revealed 2-fold decrease in combined treatment as compared to control.

Triple-negative breast cancer (TNBC) has poor survival associated with young patient age and reduced progression-free and overall survival. The absence of critical molecular markers of breast cancer makes this subtype unresponsive to targeted therapy. Therefore, the development of new and effective treatments is crucial to improve the outcome of TNBC patients (16, 17).

Although the use of chemotherapy agents is effective in controlling TNBC, widespread side effects limit their use. In such situations, combinatorial therapeutic methodologies involving two or more synthetic anticancer agents and flavonoids are applied as an alternative solution to enhancement the efficacy and minimize side effects (18).

Vinblastine is a tubulin-targeting that belongs to the vinca alkaloids family and, since its introduction, has been responsible for many successes in cancer chemotherapy at the clinic. Vinblastine perturbs tubulin polymerization and induces apoptosis and cell death. But its side effects are one of the obstacles to its widespread use in treatment (19, 20).

To reduce the side effects and improve the therapeutic efficacy of vinblastine, the exploitation of vinblastine combination strategy with silibinin seems to be effective. Silibinin has widespread biological applications, including chemo-preventative, anticancer activity and antioxidant. It is evident from the published studies in the last couple of decades that silibinin exhibits its anticancer activity through targeting proliferation, apoptosis, cancer cell metabolism, and angiogenesis. We previously described the role of silibinin in breast cancer metastasis by targeting Rac1 expression and anticancer effect on luminal A subtype of breast cancer by reducing Leptin, OB-Ra, and OB-Rb gene expression (21, 22). It is also reported that most of the silibinin's biological effects are performed by molecular alterations and targeting an range of cellular signaling cascade, including NF-kappa B transcription factor, epidermal growth factor receptor, phosphoinositide 3-kinase, β-catenin, and cyclooxygenase (23).

Data of this study revealed the synergy of silibinin and vinblastine in an in vitro model. The combination significantly improves apoptosis induction and reduces antiapoptotic protein Bcl-2 expression and increases Bax and caspase-3 expression compared with the single use of silibinin or vinblastine.

Toxicity of silibinin and vinblastine were assessed by MTT assay, which exhibited a significant decrease (p < 0.01) of cell viability in compression with individual treatment. The results presented here correspond with the study of Tyagi et al. in which they studied synergistic anticancer effects of silibinin with conventional cytotoxic agents including doxorubicin, cisplatin and carboplatin against human breast carcinoma MCF-7 and MDA-MB-468 cells. Combinations of silibinin with these three agents showed strong synergistic effects on cell growth inhibition in both the cell lines (24).

Apoptosis is a very complex cascade involving many processes. One way to trigger apoptosis machinery is downregulation of apoptosis inhibitor Bcl-2 expression and up-regulation of apoptosis-promoting factor, Bax expression (25). Our results indicated that after treatment of MDA-MB-231 cells with a combination of two agents, the expression of Bcl-2 was downregulated and Bax protein upregulated significantly in both protein and mRNA levels. This expression alteration led to a decrease of the Bcl-2/Bax ratio. Therefore, it increases the mitochondrial membrane permeability and release of cytochrome C, thus inducing caspase-3 (pro-apoptotic gene) and initiates the apoptosis program. Results demonstrated that cleaved caspase-3 protein was significantly increased after combination treatment. Besides flow cytometry results, these findings lead us to conclude that the induction of apoptosis occurs through the activation of the intrinsic pathway. Flow cytometry results showed that combination has a more significant effect on inducing apoptosis. This effect appears to be due to the sharing of pathways leading to apoptosis of two common drugs. Previous studies declared that vinblastine induced apoptosis via various signaling molecules, including NF-kB, c-myc, JNK, and Erk (26). Therefore, silibinin could affect the vinblastine-mediated caspase-3-dependent apoptotic pathway (27).

To investigate the role of Bcl-2 and Bax Q-PCR was employed. These proteins play apparent key function of mitochondria in silibinin and vinblastine mediated apoptosis. For regulation of the mitochondrial pathway, pro and anti-apoptotic activities of Bcl-2 family is necessary (28). MDA-MB-231 cells treated with silibinin and vinblastine combination down-regulating Bcl-2 and up-regulating Bax. On the other hand, the combination significantly up-regulate caspase-3 that indicates the apoptosis enhancement occurs via the Bcl-2/Bax and caspase-3 pathway.

There is an urgent need to develop new and effective combination treatments to improve the outcome of patients with TNBC. Here, by combining silibinin with vinblastine, based our findings, silibinin revealed outstanding synergistic cytotoxicity on the MDA-MB-231 cells. These data led us that a better treatment outcome could be gained for TNBC therapy, and treatment could be administered at a lower dose to reduce the side effects of TNBC patients.

Altogether, this study corroborated silibiin enhanced the apoptotic effect of vinblastine via alteration of Bcl-2/Bax ratio, which may offer novel insights into uncovering new therapeutic methods for breast cancer.

Acknowledgements

The paper was supported by the Lorestan University of Medical Sciences.

Authors’ contributions

HD: Conceptualization, Writing original draft, Data curation. NR: Visualization, Validation, Data curation. LP: Writing original draft. LC: Data curation. VG: Writing - original draft, Project administration, Supervision, Visualization, Validation, Writing - review & editing. All authorsread and approved the final manuscript.

Funding

This study was funded by Deputy of Research and Technology (grant No. 1018), Lorestan University of Medical Sciences, Khorramabad, Iran.

Data availability

The data that support the findings of this study are available from the corresponding author, upon reasonable request.

Conflict of interest

The authors declare there is no conflict of interest.

Consent to participate

All authors have seen the manuscript andapproved to submit the manuscript.

Consent for publication

All authors consent to the publication of themanuscript.

Ethical approval

This research was approved by The Ethics Committee of Lorestan University of Medical Sciences (IR.LUMS.REC.1398.095).

[1] Lanceta L, Lypova N, O’Neill C, et al. Differential gene expression analysis of palbociclib-resistant TNBC via RNA-seq. Breast Cancer Research and Treatment. 2021; 186(3):677-86.

[2] Zhou Y, Yamamoto Y, Takeshita F, et al. Delivery of miR-424-5p via Extracellular vesicles promotes the apoptosis of MDA-MB-231 TNBC cells in the tumor microenvironment. International Journal of Molecular Sciences. 2021; 22(2):844.

[3] Bai X, Ni J, Beretov J, et al. Triple-negative breast cancer therapeutic resistance: Where is the Achilles' heel? Cancer Letters. 2021; 497:100-11.

[4] El‐Sayed ESR. Discovery of the Anticancer Drug Vinblastine from the Endophytic Alternaria alternata and Yield Improvement by Gamma Irradiation Mutagenesis. Journal of Applied Microbiology. 2021.

[5] Aggarwal S, Verma SS, Aggarwal S, et al. Drug repurposing for breast cancer therapy: Old weapon for new battle. 2021: Elsevier.

[6] Aramjoo H, Zadeh HE, Hemmati M. Investigation of Protective Effects of Quercetin on Oxidative Stress Induced by Vinblastine in Bone Marrow of Rats. Pharmaceutical Sciences. 2020.

[7] Zhou H, Liu L, Ma X, et al. RIP1/RIP3/MLKL-mediated necroptosis contributes to vinblastine-induced myocardial damage. Molecular and Cellular Biochemistry. 2021; 476(2):1233-43.

[8] Baksi R, Rana R, Nivsarkar M. Chemopreventive potential of plant-derived epigenetic inhibitors silibinin and quercetin: an involvement of apoptotic signaling cascade modulation. Future Journal of Pharmaceutical Sciences. 2021; 7(1):1-13.

[9] Delmas D, Xiao J, Vejux A, et al. Silymarin and cancer: A dual strategy in both in chemoprevention and chemosensitivity. Molecules. 2020; 25(9):2009.

[10] Mao J, Yang H, Cui T, et al. Combined treatment with sorafenib and silibinin synergistically targets both HCC cells and cancer stem cells by enhanced inhibition of the phosphorylation of STAT3/ERK/AKT. European journal of pharmacology. 2018; 832:39-49.

[11] Tiwari P, Mishra K. Silibinin in cancer therapy: A promising prospect. Cancer Res Front. 2015; 1(3):303-18.

[12] Sak K. Chemotherapy and dietary phytochemical agents. Chemotherapy research and practice. 2012; 2012.

[13] Chavoshi H, Vahedian V, Saghaei S, et al. Adjuvant therapy with silibinin improves the efficacy of paclitaxel and cisplatin in MCF-7 breast cancer cells. Asian Pacific journal of cancer prevention: APJCP. 2017; 18(8):2243.

[14] Chou T-C, Talalay P. Quantitative analysis of dose-effect relationships: the combined effects of multiple drugs or enzyme inhibitors. Advances in enzyme regulation. 1984; 22:27-55.

[15] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. methods. 2001; 25(4):402-8.

[16] Brandl MB, Pasquier E, Li F, et al. Computational analysis of image-based drug profiling predicts synergistic drug combinations: Applications in triple-negative breast cancer. Molecular oncology. 2014; 8(8):1548-60.

[17] Li J, Chen S, Chen C, et al. Pathological complete response as a surrogate for relapse-free survival in patients with triple negative breast cancer after neoadjuvant chemotherapy. Oncotarget. 2017; 8(11):18399.

[18] Choudhari AS, Mandave PC, Deshpande M, et al. Phytochemicals in cancer treatment: From preclinical studies to clinical practice. Frontiers in pharmacology. 2020; 10:1614.

[19] Gigant B, Wang C, Ravelli RB, et al. Structural basis for the regulation of tubulin by vinblastine. Nature. 2005; 435(7041):519-22.

[20] Pfister C, Gravis G, Fléchon A, et al. Randomized phase III trial of dose-dense Methotrexate, Vinblastine, Doxorubicin, and Cisplatin, or Gemcitabine and Cisplatin as perioperative chemotherapy for patients with muscle-invasive bladder cancer. Analysis of the GETUG/AFU V05 VESPER trial secondary endpoints: Chemotherapy toxicity and pathological responses. European Urology. 2021; 79(2):214-21.

[21] Nejati-Koshki K, Akbarzadeh A, Pourhasan-Moghaddam M, et al. Inhibition of leptin and leptin receptor gene expression by silibinin-curcumin combination. Asian Pacific Journal of Cancer Prevention. 2013; 14(11):6595-9.

[22] Esmaeil Lashgarian H, Adamii V, Ghorbanzadeh V, et al. Silibinin Inhibit Cell Migration through Downregulation of RAC1 Gene Expression in Highly Metastatic Breast Cancer Cell Line. Drug Res (Stuttg). 2020.

[23] Tuli HS, Mittal S, Aggarwal D, et al. Path of Silibinin from diet to medicine: A dietary polyphenolic flavonoid having potential anti-cancer therapeutic significance. 2020: Elsevier.

[24] Tyagi AK, Agarwal C, Chan DC, et al. Synergistic anti-cancer effects of silibinin with conventional cytotoxic agents doxorubicin, cisplatin and carboplatin against human breast carcinoma MCF-7 and MDA-MB468 cells. Oncology reports. 2004; 11(2):493-9.

[25] Sharma A, Kaur M, Katnoria JK, et al. Polyphenols in food: Cancer prevention and apoptosis induction. Current medicinal chemistry. 2018; 25(36):4740-57.

[26] Lee J-W, Park S, Kim SY, et al. Curcumin hampers the antitumor effect of vinblastine via the inhibition of microtubule dynamics and mitochondrial membrane potential in HeLa cervical cancer cells. Phytomedicine. 2016; 23(7):705-13.

[27] Li L, Zeng J, Gao Y, et al. Targeting silibinin in the antiproliferative pathway. Expert opinion on investigational drugs. 2010; 19(2):243-55.

[28] D’Arcy MS. Cell death: a review of the major forms of apoptosis, necrosis and autophagy. Cell biology international. 2019; 43(6):582-92.

Download PDF

Version 1

posted

You are reading this latest preprint version

Silibinin, Synergistically Enhances Vinblastine-Mediated Apoptosis in Triple Negative Breast Cancer Cell Line: Involvement of Bcl2/Bax and Caspase-3 Pathway

Status:

Version 1

Abstract

Background

Methods

Results

Conclusion

Figures

Introduction

Material And Method

Cell culture condition

MTT cytotoxicity assays and drug combinations analysis

Flowcytometry YO-PRO-1/PI double staining

Western blot

Real-Time PCR

Statistical analysis

Results

Effects of silibinin and its combination with vinblastine on MDA-MB-231 cell line

Combination of silibinin and vinblastine induced marked apoptosis of MDA-MB-231 cells

Combination of silibinin and vinblastine altered Bcl2/Bax ratio and cleaved caspase-3 in protein level

Combination of silibinin and vinblastine alter mRNA expression of Bcl2, Bax and caspase3

Discussion

Conclusions

Declarations

References

Status:

Version 1