Characteristics of a Radish Mutant with Longer Siliques

doi:10.21203/rs.3.rs-1354810/v1

PDF

Short Report

Characteristics of a Radish Mutant with Longer Siliques

https://doi.org/10.21203/rs.3.rs-1354810/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

The silique is an important organ in plant reproduction and maintains biodiversity among species; however, little is known about the regulation of radish silique development. In this study, we conducted research on the radish long silique (ls) mutant and wild-type (WT) radish and compared their morphological and molecular markers. The results showed that the mutant obtained by ethyl methane sulfonate treatment had the following stable characteristics: the lengths of mutant and WT siliques were 20.50 and 9.10 cm, respectively; and the ovule number per silique of the mutant and WT was 9.5 and 4.5, respectively. Polymerase chain reaction (PCR) analysis revealed abundant polymorphisms between the ls mutant and WT in HZ001, SRC9-022, and OIL2F11 simple-sequence repeat molecular markers, and the expression of LS1 and LS2 (RsNAC66). Arabidopsis thaliana-transformed plants with RsNAC66 overexpression were obtained by the floral dip method. Quantitative PCR showed that LS2 (RsNAC66) was more highly expressed in transformed lines than in WT, and the expression of LS2 (RsNAC66) in the transformed lines was higher in siliques than leaves. Phenotypic analysis revealed abnormal ovule numbers and shoots, and altered plant height in the transformed plant. Phenotypic and gene expression analyses showed that LS2 (RsNAC66) had a positive effect on silique length and the number of seeds per silique. Together, the results showed that the radish ls mutant is specific and stable, and thus constitutes an excellent research resource for improving the seed yield of radishes.

Silique

mutant

overexpression

phenotype

radish

Radish (Raphanus sativus L.) is one of the most important and widely cultivated vegetables worldwide. The fleshy root is one of its edible parts, and the Chinese radish is highly productive and resistant to storage. The radish cultivation area in China is approximately 1.2 × 10⁶ m², accounting for about 40% of the world’s cultivated area and 47% of the world’s total production (Wang 2016). In the process of long-term evolution, cultivation, and breeding, new uses for radishes have gradually emerged, including as a food source (where the leaves and siliques are edible) and cover crop (oilseed radish); radish has thus received increasing attention from researchers. Radish seeds contain high amounts of lipids and active substances (Kim et al., 2014), among which sulforaphane is a natural active substance with antitumor activity (Zhao et al., 2011). However, the low yield of radish seeds limits their versatility and value. There have been few studies on the mechanisms of radish seed yield and silique development. Zhai et al. (2016) showed that 5,777 differentially expressed genes appeared in radish ovules within 15 days before and after artificial pollination, including auxin-response factor, Leafy cotyledon 1, somatic embryogenesis receptor kinase, and other important regulatory genes involved in embryogenesis. These results provide an important reference for understanding the early embryonic development process of radish.

Our group previously revealed the developmental process of radish siliques and ovules through morphological analysis (Li et al., 2018). The ovule development of radishes is similar to that of oilseed rape (Brassica napus) (Uyttewaal et al., 2008; Li et al., 2018). Under normal conditions, the average seed yield of radish per mu (0.067 hectare) is 50 kg (Li 1992), which is significantly lower than that of similar economic crops such as oilseed rape. The low seed yield severely affects the ability to multi-purpose the radish.

In this study, we identified mutation traits in a radish mutant with a long silique (ls), based on a mutant pool constructed by ethyl methanesulfonate (EMS) mutagenesis (Li et al., 2019). The results showed that the number of seeds per silique in the mutant was significantly increased compared to wild-type (WT) radish, and there were significant differences in molecular markers and gene expression related to silique development between the radish ls mutant and WT. In addition, the radish silique-related gene RsNAC66 was transformed into Arabidopsis, and phenotypic analysis showed that it may increase silique length and ovule number per silique.

Phenotypic traits of the radish ls mutant

Our research group previously established a radish mutagenesis system and constructed a radish mutant pool (Li et al., 2019); after manyyears of self-fertilization, they were used to screen the radish ls mutant with stable silique and ovule phenotypes (Fig.1). There were significant differences between the ls mutant and WT radish in silique length and number of seeds per silique (Fig.2A–F). Specifically, the average length of silique in the ls mutant was 20.50 cm, compared to 9.10 cm in the WT radish (Fig.2G), and the average number of seeds per silique in the radish ls mutant was 9.5, whereas the average number of ovules of WT radish was 4.5 cm (Fig.2H). The statistical results showed that the siliques in the radish ls mutant were 2.3 times longer than those of WT radish, and there was a greater number of seeds per silique in the ls mutant than WT, indicating that the ls mutant not only has a longer silique than WT radishes but also a significantly higher number of ovules per silique. The radish ls mutant, with its significantly increased number of seeds per silique, has great research value and is an important experimental material for studying radish ovule formation and improving radish seed yield.

Detection of silique-related molecular markers and gene expression in the radish ls mutant

The results of screening of 42 simple-sequence repeat (SSR) molecular markers related to crop traits have been published (see Materials and Methods), and showed that the amplification products of the SSR molecular marker primers HZ001, SRC9-022, and OI12F11 were different between WT and ls mutant radishes. There were also abundant polymorphisms in the ls mutant and WT radish molecular markers (Fig. 3A). The bands of WT radish amplified by molecular markers HZ001 and SRC9-022 primers were faint (Fig. 3A). By contrast, amplification of the radish ls mutant by the molecular marker OI12F11 did not produce bands (Fig. 3A). The LS1 gene was derived from the BnaA09g39480D sequence of the B. napus gene (Shen et al., 2019) through sequence alignment by Blast (LR778317), and the LS2 gene was designed from the radish gene (XM_018634088) sequence obtained by homologous alignment in the National Center for Biotechnology Information database. Semi-quantitative polymerase chain reaction (PCR) results showed that the expression of LS1 and LS2 in the silique of the radish ls mutant was lower than that in WT radish. In addition, there were clear differences in the expression of LS1 and LS2 between mutant and WT radish cotyledons.

Verification and qualification of Arabidopsis-transformed plants overexpressing LS2 (RsNAC66)

Transformed Arabidopsis lines overexpressing LS2 (RsNAC66) were screened using amplification fragments of the kanamycin gene by PCR (Fig. 4A). The semi-quantitative PCR results showed that the expression of LS2 (RsNAC66) was significantly enhanced in the transgenic plants (Fig. 4B, C). Relative expression of the LS2 (RsNAC66) gene in the transgenic lines (lines 3, 5, 7, 9) was upregulated to different degrees compared to WT, and increased 6,054-, 2,427-, 2-, and 99-fold in the siliques of lines 3, 5, 7, and 9, respectively (Fig. 4C). These results showed that the expression of LS2 (RsNAC66) was significantly increased in the overexpressed lines.

Statistical analyses of the phenotypic characteristics of A. thaliana-transformed plants overexpressing LS2 (RsNAC66)

Statistical analyses showed that the average plant height of A. thaliana transgenic lines 3 and 7 was higher than that of WT, and the plant height of transformed line 7 was significantly different from that of WT (P < 0.01; Fig. 5A). There was no significant difference in plant height between transformed lines 3, 5, and 9 and WT (P > 0.05). A. thaliana transgenic line 5 showed abnormal bolting (Fig. 5B), and early bolting and flowering were observed during week 6 of A. thaliana growth. The average silique length and number of ovule per silique of transgenic A. thaliana were measured and analyzed (Fig. 5C–F). Among them, the silique length of transgenic lines 5 and 9 was longer than that of WT (P < 0.05). There were more ovules per silique in lines 3, 7, and 9 than in WT (P < 0.01).

Detection and analyses of the expression of silique development-related genes

AP2, OPT4, and Atsus2 are silique development regulatory genes (Kunst et al., 1989; Bowman et al., 1989; Chai et al., 2011; Huang et al., 2013; Niuetal., 2002; Ohto et al., 2005). The heterologous expression of LS2 (RsNAC66) affects the development of Arabidopsis siliques. We further examined the correlation between the two genes in siliques. As shown in Fig. 11, the relative expression of AP2 in the transgenic lines was upregulated in siliques, as well as 6-, 17-, 1- and 2-fold in the four tested transgenic lines (3, 5, 7, and 9), respectively (Fig. 5G). OPT4 and Atsus2 were both expressed at high levels in the four tested transgenic lines (3, 5, 7, and 9). The high expression and function of LS2 (RsNAC66) in siliques suggest that the AP2 gene coordinated with LS2 (RsNAC66) is involved in the regulation of silique development.

Comparison of morphology and detection of molecular markers and gene expression showed that the radish ls mutant induced by EMS was stable, and the number of ovules per silique was significantly higher than that of WT (Fig. 2B, C, D, G). The radish ls mutant is an important resource to improve the seed yield of radish. Studies on the variation and regulation of silique length in radish have not been conducted. At present, applied research on the development of molecular markers in radish is mainly focused on purity and germplasm identification (Qiu et al., 2014; Li et al., 2018; Wang et al., 20119; Yang et al., 2019). Therefore, this study can only refer to other morphology-related molecular markers of radish and genes, and to markers related to the numbers of silique and ovules in other crops, to detect this radish ls mutant. Through polymorphism screening of the above 42 SSR molecular marker primers, three pairs of primers with clear amplification conditions and polymorphism were screened, indicating that the above three pairs of SSR molecular markers were universal in radish, turnip rape, and oilseed rape. Based on the sequence information of silique length regulatory genes in oilseed rape (Zhou et al., 2017; Sheng et al., 2019), we obtained the homologous sequence of silique length regulatory genes in radish through homology comparison, and found that the expression of these genes was significantly different between the ls mutant and WT radish.

NAC (NAM, ATAF, CUP) is one of the largest families of transcription factors in plants. The N-terminal has a highly conserved NAC domain, while the C-terminal has high diversity in the structural characteristics of NAC transcription factors (Munir et al., 2020). After constructing RsNAC66 overexpression transgenic lines in A. thaliana, the phenotypes of the transformants were analyzed by morphological and statistical methods. Among the 11 Arabidopsis transgenic lines, abnormalities in bolting, silique length ovule number per silique, and plant height were observed. Quantitative analysis of RsNAC66 expression confirmed high expression of the RsNAC66 gene in transgenic Arabidopsis siliques. The expression of the AP2 gene, which is related to ovule development in A. thaliana, was quantitatively analyzed, and found to be significantly upregulated in transgenic lines. These results showed that RsNAC66 had an effect on silique and ovule development, and increased silique length and ovule number per silique were observed in transgenic lines with high RsNAC66 expression compared to WT. The expression of AP2 in silique was also upregulated in transgenic lines with high RsNAC66 expression, indicating that they both participated in the regulation of silique and ovule development; however, the mechanisms by which they exert their synergistic roles merit further study.

Experimental materials and primers

The radish ls mutant with a longer silique based on EMS mutagenesis, as reported by Li et al. (2019), and the WT radish with a normal silique and A. thaliana (Columbia-0), were used in this study. The above plant materials were obtained from the germplasm resource bank of Hangzhou Radish Research and Development Center of Huanggang Normal University. The primers for molecular markers and related genes were as follows: primers 1–9 were selected according to the primer sequence information related to the bolting of radish published by Yang et al. (2019) and the molecular markers related to the number of seeds per silique of B. napus published by Zhang et al. (2012). Thirty-three pairs of primers corresponding to SSR molecular markers distributed in A01, A03, and A09 linkage groups, which are associated with silique length quantitative trait loci, were screened with primers 10–42 (Wang et al., 2011; Zhang et al., 2012; Yin et al., 2015; Yang et al., 2019). Through homologous comparison of the length-related gene sequence of silique in B. napus published by Shen et al. (2019), the radish gene sequence was obtained, and primers 43 and 44 were designed from this sequence. The primer sequence used in this experiment is shown in Table 1. The primers were synthesized by GenScript Biotech Corporation (Piscataway, NJ, USA).

Table 1

Primer sequences of silique-related molecular markers and genes
Serial number	Name Of Primer	Forward primer (5’→3’)	Reverse primer (5’→3’)
1	HZ001	CAGATCCGAGGGAGTTTGAA	TTCTCTCATCCTCGGTTTCC
2	HZ002	ACTTCCCCGGACCTTAAAGA	GCATCGCAAAGAACAGACAA
3	HZ003	GTGGCCGAGTAGATGGTTGT	TGGCAATAGCTTTCCTTGCT
4	HZ004	CGAAGTTTGCGTTTTCGATT	AGTGTCTTGCAAGCTCGGAT
5	HZ005	GCTCTTTCTAGCCCGAGGAT	CCGATGGTCATGGGTAGTTT
6	BoGMS1413	TGGGCTTCTTCTTACTTACCT	TGCTCTGTCTATTATTCGTTTG
7	SRC9-022	TTGTGGTTTTTCTCTCCGTGATGCT	TCGAGGCAGAACCATCGGGGT
8	SCC9-005	GCAGCAACTTGGTTTCAGGT	CAGCCCTTGGCTTAGACACT
9	Ss2066	AATTAAGGGACCACGCAACA	CCAGAACCCTCTTGATTCACTT
10	BoE667	TCACGCTTTTCTCGATCTCACTGT	ATCTTCCTCTTCCCGCCTCTAAAT
11	KBRH139B23	ATCTCATGGTTGGTTCACCG	ATTTCCAAAACACACACGCA
12	Ra2G09	ACAGCAAGGATGTGTTGACG	GATGAGCCTCTGGTTCAAGC
13	BRMS056	GATCAAGGCTACGGAGAGAGAG	CGTGACGCTAGAGTAATCGAGT
14	OI12F11	AAGGACTCATCGTGCAATCC	GTGTCAGTGGCTACAGAGAC
15	BC46	CTTTTGCTGCCCGACGAGA	AAGGAAGCAGGAAAGAGATAAAAG
16	ENA28	GGAGTCCGAGCGTTATGAAT	CTTCATCGACCCACCTTGTT
17	BRMS303	ACTCAACAACCGAACAAGAAAAACA	CGGTAGAGAACAGAGGAAGCCTAAG
18	BoE368	GGAGGTGGAGGTCAGTG	GGCTTTCCATTCATATCTTTCTCC
19	Ra2E11	GGAGCCAGGAGAGAAGAAGG	CCCAAAACTTCCAAGAAAAGC
20	BRMS269-2	AATTTTCAACGCCTTCATCCTGT	GGTGAATGCATCAGTCGACATAACT
21	BRMS043	GCGATGTTTTTTCTTCAGTGTC	TTAATCCCTACCCACAATTTCC
22	BoE76	GCCCATCTCAGTTTTTCAA	AGCGCGGCGTGGTTCAGT
23	BoE320	CACGACACGAAACCCTAAACT	CATCCGCTGAGAACTGTCG
24	BRMS042	TCGGAATTGGATAAGAATTCAA	GGATCAGTTATCTGCACCACAA
25	B126.3	GGAAGATTCAAAGTCGAGTG	GTTGGGTTCGTTGTATCATC
26	BRMS042-2	AGCTCCCGACAGCAACAAAAGA	TTCGCTTCCTTTTCTGGGAATG
27	BRMS050	AACTTTGCTTCCACTGATTTTT	TTGCTTAACGCTAAATCCATAT
28	BoE887	CCTCCACGCGCACAGAAG	TCGAAAGAAAGAAAAAGACAGGAA
29	BoE073	CGTCGCTGATTCACCAACCAA	GAAGGACGGGGAGAAGTGAAAGAA
30	OI10D08	TCCGAACACTCTAAGTTAGCTCC	GAGCTGTATGTCTCCCGTGC
31	KBRH143K20	CAAATGTCTCAAGACACATAAACCA	CTAAAGCAGCAATTGGGTGTTC
32	BoE828	AATGCGGCTTCTAATCCTTTTG	TGTCTGGCCAGCCGTAGCAC
33	BoE338	AGGAAAGCAAAGAAGCCAAGAC	TACAAGCCCTAAAGGAGACACA
34	BoE032	CTCTCACCGAATCGAATAAAAC	GTAGAGAATGGGGACGAGACCT
35	BoE334	GAGAAGGCGGTGATGACGA	TAAAACGCTAAAACCACAG
36	BoE075	GGTGCTGCCAAGGAGGAAATC	AAGGCTTGTAGGCACCACCAC
37	nia-ssr039	GCATATGACCAAAGCAAGAGAA	GTGTGCCCTGATATGTGCAA
38	BoE851	TCATTTTCAACGACTCTCCACTCT	AGGGGGTTTGATTCTCTGA
39	BoE390	GGTGGCGTATCCGTAAAGGTAGA	CGCCGTCGCTGCTCCACT
40	BRMS016	TCCCGTATCAATGGCGTAACAG	CGATGGTGACATTATTGTGGCG
41	ENA27	AAAGGACAAAGAGGAAGGGC	TTGAAATCAAATGAGAGTGACG
42	BoE974	TAGATCGGACGGAGGAAGGAAGA	TTGGGCTGGAGGTAGACGAAGAG
43	LS1	GATCGATCAAAACGCCGTCA	AAGAGGCCCAGCTAGTGATG
44	LS2	TGGAGGCCGGAGAAAAGAAG	TCACACTGTTGAGGCGAAAC

Phenotypic statistical analyses of radish and Arabidopsis

After the bolting and flowering of plants, abnormal traits of silique were observed, and the silique length of radish was measured by tape measure and ImageJ software (NIH, Bethesda, MD, USA). Siliques were treated with 8 mol/L sodium hydroxide solution to observe the distribution and number of ovules in siliques. Arabidopsis material was taken at week 14 and three phenotypic traits were recorded: plant height, silique length, and ovule number per silique.

Extraction, amplification, and detection of DNA

Genomic DNA was extracted from the samples using the Plant Genomic DNA Kit (DP305-02; Tiangen Biotech, Beijing, China), and the quality of DNA was analyzed by agarose gel electrophoresis. The PCR amplification system included 2× Taq PCR Master Mix (12.5 µL), DNA (0.5 µL), 10 µmol/L primers (1 µL), and ddH₂O (10 µL). The amplification procedure was as follows: pre-denaturation at 94℃ (3 min), 35 cycles of denaturation at 56℃ (30 s), annealing at 56 ℃ for 30s, extension at 72℃ (1 min), final extension at 72℃ (5 min), and maintenance at 4℃. The PCR products were separated by 1% agarose gel electrophoresis.

Construction of the RsNAC66 overexpression vector

Amplification and recovery of the target gene

The cDNA sequence of RsNAC66 was used, along with the specific primers LSS-F(ActagggtctcGcaccATGAACATATCAGTAAACGGA) and LSS-R(ActagggtctcTACCGCTAGTGTGACGATGGCGTCGT) for PCR amplification. The PCR product was subjected to agarose gel electrophoresis, the 978 bp electrophoretic fragment was cut out, and the target fragment was recovered using the TIANgel Midi Purification Kit (DP209-03; Tiangen).

Transformation and identification of Escherichia coli

The empty plasmid was digested with BsaI-HF and ligated to the target fragment with T4 DNA ligase, and transformed into E. coli DH5α competent cells. After culture, it was coated on LB solid medium plates with kanamycin and cultured overnight in a constant temperature incubator at 37℃. The primers LSS (Test +)( AAGAGGAGACCATTCCAGAC) and Nos-R (ATCATCGCAAGACCGGCAAC) were used for colony PCR detection, and the fragment size was about 416 bp. Positive plaque was confirmed by sequencing, and single bacterial colonies were selected for shaking culture.

Plasmid sequencing and digestion validation

The plasmid was extracted using a plasmid extraction kit, and Sanger sequencing was performed. The sequencing primer was NOS-R(ATCATCGCAAGACCGGCAAC), and the sequence was consistent with the target fragment sequence; thus, the overexpression vector was successfully constructed. The extracted plasmids were confirmed by restriction endonuclease digestion with EcoRI/HindIII.

Genetic transformation and resistance screening in A. thaliana

The plasmid with the target fragment was transformed into competent cells of Agrobacterium tumefacien, and the flowering A. thaliana WT was transformed by the floral dip method. The seeds were collected and seeded on MS solid medium containing kanamycin, and positive plants were identified by PCR; positive plants with RsNAC66 overexpression were screened.

Detection of RsNAC66 expression

Extraction and reverse transcription of RNA from plants

Using the HiPure Plant RNA Mini Kit (R4151-02; Magen Biotechnology, Guangzhou, China), the was extracted from the radish mutant, WT radish, Arabidopsis, and transgenic A. thaliana. The extracted RNA was reverse-transcribed into cDNA using the PrimeScript RT Reagent Kit (RR047A; Takara Bio, Shiga, Japan) as a template for PCR.

Semi-quantitative PCR

The expression of RsNAC66 in plants was first detected by semi-quantitative PCR. The reaction system consisted of 2× Taq PCR MasterMix (12.5 µL), cDNA (0.5 µL), forward primer (1 µL), reverse primer (1 µL), and ddH₂O (10 µL) in a total volume of 25 µL. The PCR amplification procedure was as follows: 95℃ for 3 min; 35 cycles of 95℃ for 30 s, 55℃ for 30 s, and 72℃ for 1 min; and 72℃ for 5 min. After semi-quantitative PCR amplification, 1% agarose gel electrophoresis was used for detection. The reference gene primer sequences used were Atactin-F: GGAGCTGAGAGAGATTCCGTTG and Atactin-R: GGTGCAACCACCTTGATCTT; the specific primer sequences for RsNAC66 were Rsls376-F: CAAGTGCCTCCTGGCTTTAG and Rsls376-R: GCATGATCCAGTCGGATTTT.

Real-time quantitative PCR

Quantitative fluorescence PCR was performed using the 7500 instrument (Applied Biosystems, Foster City, CA, USA). TB Green Premix Ex Taq (Tli RNase H Plus) (RR420A; Takara) was used as the fluorescence quantification kit. The reaction system of 10 µL consisted of TB Green Premix Ex Taq (5 µL), forward primer (0.2 µL), reverse primer (0.2 µL), Rox Reference Dye Ⅱ (0.2 µL), cDNA (1 µL), and ddH₂O (3.4 µL). The reaction procedure for real-time fluorescence quantification was as follows: holding stage: 50℃ for 2 min and 95℃ for 10 min; cycling stage (40 cycles): 95℃ for 15 s and 56℃ for 1 min; and melting curve stage: 95℃ for 15 s, 56℃ for 1 min, 95℃ for 15 s and 56℃ for 15 s. The data were processed by the 2^−ΔΔCт method and plotted using GraphPad Prism 9 (GraphPad Software Inc., La Jolla, CA, USA). The specific primer sequences for AP2, OPT4, and Atsus2 were AP2- F: AGCAGCACAACCCTCAACAG and AP2-R: CCAGATGTGCTAAAGACGGAG; AtOPT4 F: CTATGGATACATGAGTATGGCACAAG and AtOPT4 R: GATAGAGTTTAACTGCCACCATGC; Atsus2 F: TAGTGGTACAGAACACGCACACATTCTG and Atsus2 R: GTCTCAAAGAAGCTGACCAAGGTAGCTG.

Author contributions

Conceived and designed the experiments: Fu Jun, Yu Xiaomin and Li Shisheng. Performed the experiments: Fu Jun, Li Zhengrong, Jin Die, Zhu Jinjin and Yin Yanni. Analyzed the data: Yu Xiaomin, Li Zhengrong, Jin Die and Zhu Jinjin. Original Draft Preparation: Fu Jun, Li Zhengrong, Jin Die and Li Shisheng. All authors read and approved the final manuscript.

Acknowledgements

This work supported Special Project for Development of Science and Technology in Local by Central Guidance (2018ZYYD019). Young outstanding talent project of Huanggang City.

Conflicts of interest

The authors declare no conflicts of interest.

Bowman JL, Smyth DR, Meyerowitz EM (1989) Genes directing flower development in Arabidopsis. Plant Cell 1(1):37–52
Chai J, Qiang Y, Jia R, Mao J, Qu S, Yu J (2011) AtSUS3 with RNA interference affects sucrose synthase gene family expression and siliques maturation in Arabidopsis thaliana. Scientia Sinica Vitae 41(8):615–625
Conaway C, Wang C, Pittman B, Pittman B, Yang Y, Schwartz J, Tian D, Mclntee E, Hecht S, Chung F (2007) Phenethyl isothiocyanate and sulforaphane and their N-acetylcysteine conjugates inhibit malignant progression of lung adenomas induced by tobacco carcinogens in A/J mice. Cancer Res 65:8548–8557
Hui-Ya, Huang et al (2013) BR Signal Influences Arabidopsis Ovule and Seed Number through Regulating Related Genes Expression by BZR1. Mol Plant 6(2):456–469
Kim KH, Moon E, Kim SY, Choi SU, Lee JH, Lee KR (2014) 4-Methylthio-butanyl derivatives from the seeds of Raphanus sativus and their biological evaluation on anti-inflammatory and antitumor activities. J Ethnopharmacol 151(1):503–508
Kunst L et al (1989) AP2 Gene Determines the Identity of Perianth Organs in Flowers of Arabidopsis thaliana. Plant Cell 1(12):1195–1208
Kinuthia Karanja B, Xu L, Wang Y et al (2017) Genome-wide characterization and expression profiling of NAC transcription factor genes under abiotic stresses in radish (Raphanus sativus L.).5
Li, Baoxi (1992) (1) Several ways of radish propagation, seed, : 52–53. 67
Li JC, Li SS, Zhang NN, Xv JB, Fang YP, Xiang J (2018) Screening and identification of SSR molecular markers for purity identification of white radish. Mol Plant Breed 16(8):2525–2532
Li SS, Xiang J, Fang YP, Li JC (2018) Developmental characteristics of silique and structural comparison of embryo from oil radish. North Hortic 408(9):8–13
Li S, Zhang N, Li J, Xiang J (2019) A new male sterile line of “Duanye-13” radish produced by ethyl methanesulfonate mutagenesis. Genet Resour Crop Evol 66:981
Masa-aki Ohto RL, Fischer RB, Goldberg K, Nakamura JJ (2005) Harada. Control of seed mass by APETALA2. Proceedings of the National Academy of Sciences Feb 102 (8) 3123–3128
Munir N, Chen Y, Chen X et al (2020) Genome-wide identification and comprehensive analyses of NAC transcription factor gene family and expression patterns during somatic embryogenesis in Dimocarpus longan Lour. Plant Physiol Biochem 157:169–184
Niu Xiping and Helentjaris Tim and, Bate Nicholas J (2002) Maize ABI4 binds coupling element1 in abscisic acid and sugar response genes. Plant Cell 14(10):2565–2575
Qiu Y, Li XX, Li QX, Chen YC, Shen D, Wang HP, Song JP (2014) Establishment of the molecular identification for radish germplasm using SSR markers. J Plant Genetic Resour 15(3):648–654
Shen W, Qin P, Yan M, Li B, Wu Z, Wen J, Yi B, Ma C, Shen J, Fu T, Tu J (2019) Fine mapping of a silique length- and seed weight-related gene in Brassica napus. Theor Appl Genet 132:2985–2996
Sun QQ, Wu J, Cheng F, Wang XW, Liang JL, Shen SX (2016) QTL Mapping of self-compatibility, silique and seeds-associated traits in Brassica rapa. Scientia Agricultura Sinica 49(13):2449–2458
Uyttewaal M, Arnal N, Quadrado M, Martin-Canadell A, Vrielynck N, Hiard S, Gherbi H, Bendahmane A, Budar F, Mireau H ,2008, Characterization of Raphanus sativus pentatricopeptide repeat proteins encoded by the fertility restorer locus for ogura cytoplasmic Male Sterility,The Plant Cell, 20:3331–3345
Wang CN, Huang ZY, Li M, Zhang H, Fan WQ, Hua DP (2019) Application of SSR marker technique in hybrid seed purity identification of radish Hybrid “Qi Xing”. Seed 38(3):132–134
Wang Y, Sun S, Liu B, Wang H, Deng J, Liao Y, Wang Q, Cheng F, Wang X, Wu J (2011) A sequence-based genetic linkage map as a reference for Brassica rapa pseudo-chromosome assembly. BMC Genomics 12:239
Wang FY (2016) Problems and countermeasures of radish industry development in China. J Chin Agricultural Mechanization 37(11):188–191
Yang F, Ran ML, Li XM, Chen L, Yong XP, Ran K ,2019,Genetic diversity of radish (Raphanus sativus L.) with different bolting-resistance based on SSR markers,Jiangsu Agricultural Sciences, 47(4):123–127
Yang P, Shu C, Xu J, Wu J, Liu K (2012) Identification of a major QTL for silique length and seed weight in oilseed rape (Brassica napus L.). Theor Appl Genet 125:285–296
Yin T (2015) QTL mapping of major plant-type traits related to plant height and silique length in Brassica napus L., PhD diss., Southwest University
Zhai L, Xu L, Wang Y, Zhu X, Feng H, Li C, Luo X, Everlyne M, Liu L (2016) Transcriptional identification and characterization of differentially expressed genes associated with embryogenesis in radish (Raphanus sativus L.). Sci Rep 6:21652. doi: 10.1038/srep21652
Zhang L, Li S, Chen L, Yang G (2012) Identification and mapping of a major dominant quantitative trait locus controlling seeds per silique as a single Mendelian factor in Brassica napus L. Theo Appl Genet 125:695–705
Zhang Z, Xie Q, Jobe TO, Kau AR, Wang C, Li Y, Qiu B, Wang Q, Mendoza-Cózatl DG, Schroeder JI (2016) Identification of AtOPT4 as a Plant Glutathione Transporter. Mol Plant 9(3):481–484
Zhao GL, Hao R, You H, Zhu Y, Luo YB (2011) Fatty acid composition and antioxidant activity of 8 kinds of radish seed oil. China Oils and Fats 38(12):73–76
Zhou QH, Zhou C, Zheng W, Fu DH (2017) Genome wide association analysis of silique length in Brassica napus L.,Scientia Agricultura Sinica, 50(2)

TableS1.docx
Table S1 Phenotypic trait (plant height and siliques) statistics for each line of Arabidopsis thaliana

PDF

Editorial decision: Major revisions
20 Apr, 2022
Reviews received at journal
04 Mar, 2022
Reviewers invited by journal
26 Feb, 2022
Editor assigned by journal
14 Feb, 2022
First submitted to journal
12 Feb, 2022

You are reading this latest preprint version

Characteristics of a Radish Mutant with Longer Siliques

Status:

Version 1

Abstract

Figures

Introduction

Results

Detection and analyses of the expression of silique development-related genes

Discussion

Materials And Methods

Experimental materials and primers

Phenotypic statistical analyses of radish and Arabidopsis

Extraction, amplification, and detection of DNA

Construction of the RsNAC66 overexpression vector

Amplification and recovery of the target gene

Transformation and identification of Escherichia coli

Plasmid sequencing and digestion validation

Genetic transformation and resistance screening in A. thaliana

Detection of RsNAC66 expression

Extraction and reverse transcription of RNA from plants

Semi-quantitative PCR

Real-time quantitative PCR

Declarations

References

Supplementary Files

Status:

Version 1