Plasmid construction
To construct pcDNA4-ADI, an ADI-overexpressing plasmid, ADI coding sequence was synthesized by Nanjing Genscript LTD and sub-cloned into the EcoR I/Xho I sites of pcDNATM4/TO/myc-His vector. C-myc tag was fused at the c-terminal of ADI protein. Two primers were used (5’- GATATGAATTCACCATGTCCGTCTTCGAT AGCAAGT -3’ and 5’- GATATCTCGAG TCACCATTT GACATCTTTTCTGGACA -3’). pcDNA4-ADI△(cysteine398alanine) plasmid was constructed through overlapping extension method. Two mutant primers were used (5' GTATGGGTAACG CTCGTGCCATGTCAATGCCTTTATC 3' and 5' GATAAAGGCATTGACATGG CACGAGCGTTACCCATAC 3').
To build pGBKT7-ADI plasmid as screening bait in yeast hybrid experiment, ADI coding sequence was inserted into the Nde I/BamH I sites of pGBKT7 vector which expresses proteins fused to amino acid 1-147 of the GAL4 DNA binding domain. Two primers were used (5’- GATATCATATGTCCGTCTTCGATAGCAAG TT -3’ and 5’- GATATCTCGAGTCACCATTT GACATCTTTTCTGGACA -3’).
Other plasmids were donated by Dr. Youjun Li in Life Science College of Wuhan University.
Cell culture and transfection
Human liver cancer cell lines (HpG2), Prostate cancer cell line (PC3) and human embryo lung cell line (MRC5) were cultured with DMEM supplemented with 10% fetal bovine serum (FBS), penicillin (100IU/ml) and streptomycin (100 μg/ml). Cells were grown in a 5% CO2 cell culture incubator at 37℃. All culture reagents were purchased from Life Technologies LTD.
Lipofectamine™ 2000 Transfection Reagent (Cat. #11668019) was from ThemoFisher Scientific. Transfection was performed according to the manufacturer’s instructions. For siRNA transfection, siRNA specific for TP53 (5’- ACCUCGGAAGACUCCAGUGGUAAUCUUCAAGAGAGAUUACCACUGGAGUCUUCCUU-3’ / 5’- CAAAAAGGAAGACUCCAGUGGUAAUCUCUCUUGAAGAUUACCACUGGAGUCUUCCG-3’), or TP53AIP1 (5’- ACCUCGGGAAUAGAAGCUCUGUCAGUUCAAGAGACUGACAGAGCUUCUAUUCCCUU-3’ / 5’- CAAAAAGGGAAUAGAAGCUCUGUCAGUCUCUUGAACUGACAGAGCUUCUAUUCCCG-3’), or non-specific control (5’-UAAUGUAUUGGAACGCAUAUU-3’/5’-UAUGCGUUCCAAUACAUUA-3’) was co-transfected into HepG2 or PC3 cells by using the Lipofectamine 2000. Immunoblots and FACS analyses were performed 2 days after transfection
Yeast Two-Hybrid Assay
Yeast two-hybrid analysis was performed in yeast strain AH109 according to the manufacturer’s instructions (http://www.clontech.com/). pGBKT7-ADI plasmid as bait plasmid was co-transformed into AH109 yeast with the yeast two-hybrid cDNA library of human liver (Cat. #630468) from Clontech Laboratories Inc. Quadruple dropout medium (without tryptophan, leucine, histidine and adenine) containing 4mg/ml x-a-gal was used to test the activation of reported genes MEL1 (MDS1/EVI1-like gene 1).
Co-immunoprecipitation (co-IP)
pcDNA4-ADI plasmid had been transfected into HepG2 and PC3 cells for two days. Pierce Classic Magnetic IP/Co-IP Kit (Cat. #88804, ThermoFisher Scientific) was used for conjugating myc-tag antibody (Cat. #16286-1-AP) or FTL antibody (Cat. # ab201975). The conjugated beads were placed into cell lysates containing ADI expression to capture the ADI-FTL complex. Then, beads were centrifuged, washed, and run SDS-PAGE gel for immunoblot staining.
Immunofluorescence Staining for co-localization.
HepG2 and PC3 cells were cultured on chamber slides for 24 h. Washed slides with PBS three times and transfected pcDNA4-ADI plasmid. Washed again after 2 days. The cells were then fixed with 4% paraformaldehyde for 1 hour at room temperature. After washing the slides twice with PBS, the cells were blocked with 10% FBS. The cells were then incubated with myc-tag antibody (Cat. #16286-1-AP) or FTL antibody (Cat. # ab201975) at room temperature for 1 hour. The slides were washed twice with PBS. TRITC conjugated goat anti-rabbit antibody (Cat. #A16101) and FITC conjugated goat anti-mouse antibody (Cat. #62-6511) were added and incubated at room temperature for 1 hour. The slides were then washed with PBS twice before the addition of DAPI. After additional washes with PBS, slides were mounted with Prolong Gold Antifade Reagent (Invitrogen). Immunofluorescence staining was examined under a confocal microscope.
RNA Isolation and Quantitative RT-PCR
Total RNA was extracted from cells using Trizol (Invitrogen) following the manufacturer’s instructions. The RNA concentration and purity were determined by spectrophotometry (NanoDrop Technologies Inc., LLC). One microgram of total RNA was used as the template for synthesizing complementary DNA (cDNA) by using the cDNA Synthesis Kit (ThermoFisher Scientific). Quantitative RT-PCR (qRT-PCR) was performed by using SYBR Green PCR Master Mix with the StepOne Real-Time PCR System (Bio-Rad). 2-△△Ct in relative quantification analysis method was used to calculate the change fold of mRNA among the different cells. GAPDH was utilized as an internal control for the normalization. The primers used for RT-PCR were listed in supplementary tab S1.
Western Blot Analysis
Five micrograms of protein were electrophoresed in 10% SDS-PAGE gels and blotted to polyvinylidine difluoride membranes. Specific primary antibodies were detected with peroxidase-labeled secondary antibodies (ProteinTech Group Inc.) by using SuperSignal West Dura Extended Duration Substrate (Pierce Chemical) per manufacturer’s instructions. The used antibodies from ProteinTech Group Inc. included myc-tag antibody (Cat. #16286-1-AP), ASS antibody (Cat. #66036-1-Ig), GAPDH antibody (Cat. #60004-1-Ig), Flag-tag antibody (Cat. #66008-3-Ig), p53 antibody (Cat. #60283-2-Ig), Bcl-2 antibody (Cat. #60178-1-Ig), PUMA antibody (Cat. #55120-1-AP), Bax antibody (Cat. #60267-1-Ig), caspase 9 antibody (Cat. #66169-1-Ig), caspase 3 antibody (Cat. #66470-2-Ig), Histone H3 antibody (Cat. #17168-1-AP), HRP-conjugated goat anti-mouse IgG (Cat. #SA00001-1) and HRP-conjugated goat anti-rabbit IgG (Cat. #SA00001-2). FTL antibody (Cat. #ab201975) was from Abcam Inc.. p53AIP1 antibody (Cat. #ABP56144) was from Abbkine Inc., Noxa antibody (Cat. #ab13654) was from Abcam Inc.. Bak antibody (Cat. #ab69404) was from Abcam Inc.. TRITC conjugated goat anti-rabbit antibody (Cat. #A16101) was from ThermoFisher Scientific Inc.. FITC conjugated goat anti-mouse antibody (Cat. #62-6511) was from ThermoFisher Scientific Inc..
Fluorescence assay for mitochondrial permeability transition pore (MPTP)
MPTP activation assay followed the manuscript of LIVE Mitochondrial Transition Pore Assay Kit (GMS10095.1 v.A) from GENMED SCIENTIFICS INC. U.S.A. Cells were inoculated in 96-well plates at a density of 5 × 104 cells per well, and transfected with pcDNA4-ADI plasmid. After incubation for 48h, cells were stained with 50µg calcein-AM (Calcein acetoxymethyl ester), washed with 0.1M phosphate buffer solution (PBS), and neutralize with 0.1M cobalt (II) chloride hexahydrate. Then detected fluorescence intensity of cells in Thermo Multiskan™ FC Microplate Reader.
GFP-LC3 reporter fluorescence assay for autophagy in live cells
Expression of the GFP-LC3 fusion gene allows to visualize autophagosome formation in real time in live cells. Firstly, cells were inoculated in twelve-well plates with cover slips at a density of 1 × 105 cells per well, and co-transfected with pcDNA4-ADI and pEGFP-LC3 plasmids. Secondly, cells were starved with serum-free medium for 72 hours. Thirdly, cells were fixed with 4% paraformaldehyde, permeabilized with 0.2% Triton X-100. Cellular nucleuses were stained by DAPI for 10 minutes. Finally, the plates were sealed and stored at 4℃. GFP fluorescent signals were detected by using a confocal microscope (LeicaMicrosystems, Mannheim, Germany).
Chromatin autophagy assay by fluorescence co-localization.
Cells were inoculated in twelve-well plates with cover slips at a density of 1 × 105 cells per well, and co-transfected with pcDNA4-ADI and pEGFP-LC3 plasmids. Then, 2% FBS was added into DMEM medium to prevent cells from dying too quickly. After 96 hours of culture time, cells were fixed with 4% paraformaldehyde, permeated with 0.2% Triton X-100. Then, cells were incubated with TRITC-labeled anti-H3 antibody for 4 hours at 4℃. After wash, cellular nucleuses were stained by DAPI for 10 minutes. Finally, the plates were sealed and stored at 4℃. Fluorescent signals were detected by using a confocal microscope
Statistical analysis.
Data with error bars are presented as mean ± S.D. Student’s two-tailed t test was used to determine the p-value. Differences were considered statistically significant when the p-value was <0.05.