Identification of s9ap Used as an Endogenous Reference Gene in Qualitative and Real-Time Quantitative PCR Detection of Pleurotus eryngii

doi:10.21203/rs.3.rs-1356759/v1

PDF

Research Article

Identification of s9ap Used as an Endogenous Reference Gene in Qualitative and Real-Time Quantitative PCR Detection of Pleurotus eryngii

https://doi.org/10.21203/rs.3.rs-1356759/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Pleurotus eryngii is a kind of edible fungi with good quality, and it is popular among consumers. At present, some adulterated wild edible fungi are available in the market. The rights and interests of consumers can be ensured by establishing a practical edible fungi detection system. Among the existing methods for detecting food adulteration, endogenous reference gene amplification is convenient and reliable. However, no ideal endogenous reference gene is available for P. eryngii. In this study, s9ap was screened as an endogenous reference gene through sequence alignment. Qualitative and quantitative PCR analysis of this gene was carried out in one P. eryngii variety and 18 other species. The detection limit of quantitative PCR was 400 pg, and no s9ap amplification products were detected in the 18 other species. This study confirmed that s9ap was an ideal endogenous reference gene for the detection of P. eryngii. This method was also suitable for processed food products.

endogenous reference gene

Pleurotus eryngii

s9ap

qualitative PCR

quantitative PCR

Pleurotus eryngii is an edible mushroom, which is widely cultivated throughout the world; it is also known as king trumpet mushroom or king oyster mushroom (Li et al., 2018), which belongs to basidio mycotina, hymenomycetes, homobasidiomycetidae, agaricales, pleurotaceae and pleurotus. P. eryngii has high nutritional value, and it contains important bioactive constituents, such as polysaccharides, polyphenols, sterols, dietary fiber, and proteins. It also contains a large amount of vitamins and minerals (Stajic et al., 2009). In addition, P. eryngii has many medicinal functions, including immunoregulatory (Vetvicka et al., 2019), hepatoprotective (Xu et al., 2017), antihyperlipidemic (Ren et al., 2017), antioxidant (A. Zhang et al., 2014), antiphlogistic (Yuan et al., 2017), and antitumor (Sun et al., 2017). Recent studies confirm the antidepressant function of P. eryngii extract (Park et al., 2021).

P. eryngii is named for its rich almond-like flavor and delicious abalone-like taste. In recent years, it has become increasingly popular among consumers (B. Zhang et al., 2020). Therefore, with the development of technology and the progress of food processing, the adulteration of many precious edible fungi is produced accordingly. Edible mushroom adulteration is a kind of behavior that harms the rights and interests of consumers. The rights and interests of consumers can be ensurednd, and a good market atmosphere can be created by establishing a practical detection method of P. eryngii.

Many methods can be used to identify mushrooms, and the most traditional method is morphological identification (Carvalho et al., 2014), which is based on the observation of the shape and color of the fruiting bodies and the characteristics of spores. However, this method mainly involves a subjective judgment. Hence, it cannot ensure the accuracy of the detection results. Considering that most of the processed products of edible fungi no longer have the original morphological characteristics and are more difficult to identify, it is only suitable for the detection of intact fresh mushrooms rather than processed products (Shan et al., 2019). Edible fungi can also be identified by odor, by using electronic nose technology (Pei et al., 2016), or combining with gas chromatography-mass spectrometry technology to identify specific flavor compounds, which has the advantages of sensitivity and speed (Yang et al., 2016). Current studies have focused on the volatile components of edible fungi. By studying the differences between the volatile components of different edible fungi, it can provide chemical components indicators for the identification of edible fungi (Huang et al., 2018). Tagkouli, D et al. (Tagkouli et al., 2021) studied the volatile characteristics of P. eryngii and Pleurotus ostreatus strains, and the results showed that ketones, alcohols, and toluene were the main components that distinguish P. ostreatus, while aldehydes and fatty acid methyl esters were the main components that distinguish P. eryngii. However, these methods are not applicable for the identification of the processed products of edible fungi. Edible fungi contain a large amount of protein and polysaccharide, and each edible fungus has a unique compound profile. With the development of spectrum, chromatography, mass spectrometry, and analytical chemistry, physical and chemical detection method, such as the analysis of characteristic protein or characteristic compounds, are gradually emerging. El Karkouri et al. (El Karkouri et al., 2019) first applied MALDI-TOF-MS technology to identify truffles, which can reliably identify species and detect incorrectly identified specimens in commercial truffles. However, the procedures are somewhat complicated and their application to various groups of mushrooms is rather limited (Sugawara et al., 2016).

Molecular biology technology is widely used in species identification (Ye et al., 2020). Molecular recognition technology has been introduced because it is fast, specific, sensitive, and accurate (Guglielmo et al., 2008). Considering that the genetic material is stable, molecular methods can be used to identify edible fungi and their processed products. The commonly used molecular markers include simple sequence repeats (SSR), inter SSR (ISSR), random amplified polymorphic DNA (RAPD), restriction fragment length polymorphism (RFLP), and sequence characterized amplified regions. These molecular markers are highly polymorphic and have been widely used in the genetic studies of edible fungi (Nazrul and Bian, 2010), which can accurately identify edible fungi species. ISSR (Wang et al., 2012) and RAPD (Ro et al., 2007) have been used to identify P. eryngii. Other molecular biotechnologies include genome sequencing, which identifies edible fungi by sequencing specific DNA fragments. The commonly used gene fragments for classification and identification of fungi include: ribosome internal transcribed spacer (ITS), ribosome large subunit, RNA polymerase II (RNA polymerase II, RPB2), β-micro tube protein (β-tubulin), and elongation factor 1-α (EF1-α). Xiao-lan et al. (Xiao-Lan et al., 2016) analyzed the ITS, EF1-α, and RPB2 sequences of Bailinggu, P. eryngii, and P. nebrodensis. These three DNA fragment sequences can be used to distinguish three different species of edible fungi. With the development of rapid detection technology, isothermal amplification technology has also been used in the identification of edible fungi (Vaagt et al., 2013).

Endogenous reference gene analysis is broadly applied in food component source authentication and for the qualitative and quantitative evaluation of food samples. Endogenous reference gene is a conserved DNA sequence with species specificity, constant copy number and no allelic variation (Shang et al., 2014). Endogenous reference gene of a specific species is a specific marker that can distinguish this species from other species (Shang et al., 2014). This method is convenient and economical, and it is a reliable and rapid choice for identifying wild species (Zheng et al., 2018). The identification of endogenous reference gene is mainly applied to crops, such as peach (Shang et al., 2014), wheat (Liu et al., 2014), canola (Demeke and Ratnayaka, 2008), maize (James et al., 2003), and soybean (James et al., 2003). In recent years, it has been developed for the detection of mushrooms. It has been used to detect Tricholoma matsutake (Shan et al., 2019), P. ostreatus (Zheng et al., 2018), and Flammulina velutipes (C. Zhang et al.).

Endogenous reference genes of different species have been reported. The endogenous reference gene for P. eryngii has not been reported. In the present study, s9ap was selected as the endogenous reference gene of P. eryngii by gene sequence alignment and blast analysis. Qualitative and quantitative PCR primers were designed for this gene, and the primers were verified and screened. The detection limit of SYBR quantitative PCR was 400 pg. The results show that s9ap gene was suitable for the detection of P. eryngii, and the specificity and detection limit both are good. The endogenous reference gene detection technology was an effective detection technology for wild mushroom adulteration.

Materials

Nineteen species of mushrooms were obtained from the local wild fungus market in Yunnan, including: Boletus auripes, P. ostreatus, Boletus brunneissimus, Lactarius volemus, Boletus brunneissimus, Thelephora ganbajun, Cantharellus cibarius, T. matsutake, Boletus rubellus, Boletus griseus, Russula vinosa, Boletus subsplendidus, Termitornyces albuminosus, Catathelasma ventricosum, Ramaria botrytoides, Lentinus edodes, Agrocybe aegerita, P. eryngii, and Tricholoma gambosum.

DNA extraction and purification

The genomic DNA was extracted from fresh mushrooms by using a kit methods (Sangon, Shanghai, China). The mushroom fruiting bodies were first mixed with an equal amount of silica, ground into a powder with liquid nitrogen, and then extracted according to the kit instructions. The concentration and purity of all DNA samples were measured using Nano Drop2000 spectrophotometer (Thermo Scientific, Waltham, USA). The DNA integrity of the samples was verified by 1% agarose gel electrophoresis with ethidium bromide in 1× TAE buffer. DNA was amplified with universal fungi 18S primer, and the products were analyzed with 2% agarose gel electrophoresis with ethidium bromide in 1× TAE buffer. The DNA was stored at 4°C for further use.

Oligonucleotide primers

All oligonucleotide primers used in this study were designed using ABI Prism Primer Express version 3.0 (Applied Biosystems, Foster City, USA) and synthesized by Shanghai Sangon Co. Ltd. (Shanghai, China). The designed primers were analyzed by BLAST alignment in NCBI to ensure the specificity. SBRY fluorescent dye kit was obtained from Tiangen Biochemical Technology Co. Ltd. (Tiangen, Beijing, China). 18S rDNA-F/R primers were used to evaluate DNA quality, and s9ap-F/R primer was used for the qualitative and quantitative PCR detection of s9ap gene. The detailed nucleotide sequences of the primers are listed in Table 1.

Table 1

Primers used in qualitative and quantitative PCR.
Primer name	Primer sequence (5’→3’)	Length	Product size(bp)	Reference
ITS-F	TCCGTAGGTGAACCTGCGG	19	675bp	This study
ITS-R	TCCTCCGCTTATTGATATGC		675bp
s9ap-F	TGTCACGTCAACTGGGTTATT	21	332bp
s9ap-R	AGGATCAGTCACTTTCCACATC	22	332bp

PCR conditions

The final volume of conventional PCR reaction was 25 µL as determined using ABI SimpliAmp thermal cycler (Applied Biosystems, USA). A single reaction system contained 2.5 µL of 10×buffer, 2 µL of dNTP (2.5 mM), 1 µL of forward primer (10 µM), 1 µL of reverse primer (10 µM), 0.2 µL of Taq DNA polymerase (5 units; TaKaRa Biotechnology Co. Ltd., Dalian, China), 2 µL of DNA template, and balance ddH2O.

The PCR procedure for 18S amplification is as follows: 5 min of pre-denaturation at 95°C; 30 cycles: 30 s of predenaturation at 95°C, 30 s of annealing at 58°C, 30 s of extension at 72°C; and a final extension of 10 min at 72°C. The amplification products were analyzed by 2% agarose gel electrophoresis. The amplification procedure of the specific primer s9ap was the same as that of 18S except that the annealing temperature was 60°C.

The quantitative detection sensitivity of s9ap was performed using SYBR Green I real-time quantitative PCR amplification. The total reaction volume was 25 µL, containing 5 µL DNA (40 ng/µL), 0.75 µL of primers (10 µM), 12.5 µL of 2×SuperReal PreMix Plus, 2.5 µL of 50×ROX reference dye (Tiagen, Beijing, China), balance ddH2O. The amplification procedure was as follows: pre-denaturation (95°C, 15 min); 40 cycles: denaturation (95°C, 10 s), annealing (60°C, 20 s), and extension (72°C, 30 s). The samples of each biological replicate were quantified and repeated for three times.

Selection of the candidate P. eryngii endogenous reference gene

The selection of appropriate endogenous reference gene can result in the accurate and practical detection of P. eryngii. A good endogenous reference gene should be species-specific, with low and consistent interspecific copy numbers. In the nucleotide database of NCBI, the gene information of P. eryngii was searched. Through BLAST alignment and homology analysis, the s9ap gene for serine aminopeptidase (accession number: AB918644) with the lowest homogeneity with the sequences of the non-P. eryngii species was finally screened out as the alternative endogenous reference genes to be identified. The BLAST result and detailed information of s9ap are provided in Fig. S1. According to the gene sequence, species-specific primers were designed for qualitative and quantitative PCR.

Species specificity of the qualitative PCR assays

We extracted the DNA of 19 mushroom species as templates, including: B. auripes, P. ostreatus, B. brunneissimus, L. volemus, B. brunneissimus, T. ganbajun, C. cibarius, T. matsutake, B. rubellus, B. griseus, R. vinosa, B. subsplendidus, T. albuminosus, C. ventricosum, R. botrytoides, L. edodes, A. aegerita, P. eryngii, T. gambosum (Fig. 1), and 18S rDNA-F/R primers were used to detect the quality of the extracted DNA (Fig. 2).

The species specificity of s9ap gene in P. eryngii was qualitatively identified by conventional PCR amplification by using s9ap-F/R primers. The results showed that s9ap gene was successfully amplified in P. eryngii genomic DNA with obvious bands, while the other mushroom species had no amplification products, indicating that s9ap gene had high species specificity for P. eryngii (Fig. 3).

Sensitivity of the qualitative and SYBR Green I real-time quantitative PCR assays

To detect the sensitivity of qualitative PCR, we gradient diluted the DNA concentrations from 15 ng/μL to 0.96 pg/μL (five-fold serial dilutions) for amplification. The results showed that when the DNA concentrations were 15 and 3 ng/μL, clear specific bands were observed on the electrophoretic diagram, and their brightness gradually decreased. However, when the DNA concentration was reduced to 0.6 ng/μL, no amplification products were detected. Therefore, the detection limit of qualitative PCR was 3 ng/μL (Fig. 4a).

For the sensitivity of SYBR Green I real-time quantitative PCR, the genomic DNA concentrations were gradient diluted to 40, 4, 0.4, 0.08, and 0.016 ng/μL. When the DNA concentration was 80 pg/μL, specific amplification could still occur, and the CT value was significantly higher than that of the negative control, indicating that the detection limit of SYBR Green I quantitative PCR was 80 pg/μL (Fig. 4b). We established a standard curve of s9ap by using the quantitative PCR system. A linear relationship (R² = 0.98, slope = −0.732) was determined between the DNA quantities and Ct values (Fig. 4c). These results indicate that the established s9ap SYBR Green I real-time PCR system was suitable for the accurate quantitative detection of P. eryngii.

Application of s9ap to examine different processed mushroom products

The established real-time PCR system was used to detect two kinds of mushroom products, namely, Fansaoguang (yexiangjun) and spicy P. eryngii. The DNA extracted from fresh P. eryngii was used as a positive control to ensure the practical use of s9ap. We amplified the DNA templates extracted from food samples with s9ap-F/R in conventional PCR (Fig. 5). Based on the results, no component of P. eryngii was observed in Fansaoguang (yexiangjun), but it could be detected in the spicy P. eryngii. The detection result was consistent with the food labels of the processed products.

The results indicated that a set of qualitative and quantitative PCR method was established for the detection of P. eryngii. This method has the advantages of high sensitivity, high specificity, simple operation, low cost, and easy observation of results. It has a good development prospect for the rapid biological source detection of P. eryngii and its deep-processed products.

We selected s9ap gene as the candidate endogenous reference gene of P. eryngii, and the specificity and sensitivity of s9ap gene were evaluated. The results indicated that a set of qualitative and quantitative PCR method was established for the detection of P. eryngii. This method has the advantages of high sensitivity, high specificity, simple operation, low cost, and easy observation of results. It has a good development prospect for the rapid biological source detection of P. eryngii and its deep-processed products.

Acknowledgments

This work was supported by the National Natural Science Foundation of China (31801635) and the Yunnan Education Department Scientific Research Fund Project (2018JS020).

Ethics approval

This article does not contain any studies with human participants or animals performed by any of the authors.

Author Contributions

Wei Yuanmiao: Methodology, Data curation, Writing – original draft.

Liu Yao: Formal analysis, Investigation.

Li Ling: Formal analysis, Investigation.

Xiang Shuna: Software, Investigation.

Zhang Hanyue: Software, Investigation.

Shang Ying: Writing – review & editing, Supervision, Project administration, Funding acquisition.

Consent to participate and for publication

Not applicable.

Competing Interests

The authors have no relevant financial or non-financial interests to disclose.

Carvalho LM, Carvalho F, Bastos MD, Baptista P, Moreira N, Monforte AR, Ferreira ACD, de Pinho PG (2014) Non-targeted and targeted analysis of wild toxic and edible mushrooms using gas chromatography-ion trap mass spectrometry. Talanta 118:292–303
Demeke T, Ratnayaka I (2008) Multiplex qualitative PCR assay for identification of genetically modified canola events and real-time event-specific PCR assay for quantification of the GT73 canola event. Food Control 19:893–897
El Karkouri K, Couderc C, Decloquement P, Abeille A, Raoult D (2019) Rapid MALDI-TOF MS identification of commercial truffles.Scientific Reports.9:
Guglielmo F, Gonthier P, Garbelotto M, Nicolotti G (2008) A PCR-based method for the identification of important wood rotting fungal taxa within Ganoderma, Inonotus s.l. and Phellinus s.l. Fems Microbiol Lett 282:228–237
Huang LL, Chen G, Yu FQ (2018) Analysis on volatile components from five edible wild mushrooms. Edible Fungi 40:80–84
James D, Schmidt AM, Wall E, Green M, Masri S (2003) Reliable detection and identification of genetically modified maize, soybean, and canola by multiplex PCR analysis. J Agricultural Food Chem 51:5829–5834
Li Q, Huang WL, Xiong C, Zhao J (2018) Transcriptome analysis reveals the role of nitric oxide in Pleurotus eryngii responses to Cd2 + stress. Chemosphere 201:294–302
Liu YK, Li HP, Huang T, Cheng W, Gao CS, Zuo DY, Zhao ZX, Liao YC (2014) Wheat-Specific Gene, Ribosomal Protein L21, Used as the Endogenous Reference Gene for Qualitative and Real-Time Quantitative Polymerase Chain Reaction Detection of Transgenes. J Agricultural Food Chem 62:10405–10413
Nazrul MI, Bian YB (2010) ISSR as New Markers for Identification of Homokaryotic Protoclones of Agaricus bisporus. Curr Microbiol 60:92–98
Park YS, Jang S, Lee H, Kang S, Seo H, Yeon S, Lee D, Yun CW (2021) Identification of the Antidepressant Function of the Edible Mushroom Pleurotus eryngii.Journal of Fungi. 7:
Pei F, Yang WJ, Ma N, Fang Y, Zhao LY, An XX, Xin ZH, Hu QH (2016) Effect of the two drying approaches on the volatile profiles of button mushroom (Agaricus bisporus) by headspace GC-MS and electronic nose. Lwt-Food Sci Technol 72:343–350
Ren ZZ, Li J, Xu N, Zhang JJ, Song XL, Wang XX, Gao Z, Jing HJ, Li SS, Zhang C, Liu M, Zhao HJ, Jia L (2017) Anti-hyperlipidemic and antioxidant effects of alkali-extractable mycelia polysaccharides by Pleurotus eryngii var. tuolensis. Carbohydr Polym 175:282–292
Ro HS, Kim SS, Ryu JS, Jeon CO, Lee TS, Lee HS (2007) Comparative studies on the diversity of the edible mushroom Pleurotus eryngii: ITS sequence analysis, RAPD fingerprinting, and physiological characteristics. Mycological Res 111:710–715
Shan LY, Wang DZ, Li YJ, Zheng S, Xu WT, Shang Y (2019) Identification of the Pol Gene as a Species-Specific Diagnostic Marker for Qualitative and Quantitative PCR Detection of Tricholoma matsutake.Molecules.24:
Shang Y, Zhu PY, Huang KL, Liu WH, Tian WY, Luo YB, Xu WT (2014) A peach (Prunus persica)-specific gene, Lhcb2, used as an endogenous reference gene for qualitative and real-time quantitative PCR to detect fruit products. Lwt-Food Sci Technol 55:218–223
Stajic M, Vukojevic J, Duletic-Lausevic S (2009) Biology of Pleurotus eryngii and role in biotechnological processes: a review. Crit Reviews Biotechnol 29:55–66
Sugawara R, Yamada S, Tu ZH, Sugawara A, Suzuki K, Hoshiba T, Eisaka S, Yamaguchi A (2016) Rapid and reliable species identification of wild mushrooms by matrix assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS). Anal Chim Acta 934:163–169
Sun YN, Hu XL, Li WX (2017) Antioxidant, antitumor and immunostimulatory activities of the polypeptide from Pleurotus eryngii mycelium. Int J Biol Macromol 97:323–330
Tagkouli D, Bekiaris G, Pantazi S, Anastasopoulou ME, Koutrotsios G, Mallouchos A, Zervakis GI, Kalogeropoulos N (2021) Volatile Profiling of Pleurotus eryngii and Pleurotus ostreatus Mushrooms Cultivated on Agricultural and Agro-Industrial By-Products.Foods.10:
Vaagt F, Haase I, Fischer M (2013) Loop-Mediated Isothermal Amplification (LAMP)-Based Method for Rapid Mushroom Species Identification. J Agricultural Food Chem 61:1833–1840
Vetvicka V, Gover O, Karpovsky M, Hayby H, Danay O, Ezov N, Hadar Y, Schwartz B (2019) Immune-modulating activities of glucans extracted from Pleurotus ostreatus and Pleurotus eryngii. J Funct Foods 54:81–91
Wang SX, Yin YG, Liu Y, Xu F (2012) Evaluation of Genetic Diversity Among Chinese Pleurotus eryngii Cultivars by Combined RAPD/ISSR Marker. Curr Microbiol 65:424–431
Xiao-Lan, He, Bo, Wu Q, Li W-H, Zhong-Qian P (2016) Phylogenetic relationship of two popular edible Pleurotus in China, Bailinggu (P. eryngii var. tuoliensis) and Xingbaogu (P. eryngii), determined by ITS, RPB2 and EF1α sequences. Mol Biology Rep 43:573–582
Xu N, Gao Z, Zhang JJ, Jing HJ, Li SS, Ren ZZ, Wang SX, Jia L (2017) Hepatoprotection of enzymatic-extractable mycelia zinc polysaccharides by Pleurotus eryngii var. tuoliensis. Carbohydr Polym 157:196–206
Yang WJ, Yu J, Pei F, Mariga AM, Ma N, Fang Y, Hu QH (2016) Effect of hot air drying on volatile compounds of Flammulina velutipes detected by HS-SPME-GC-MS and electronic nose. Food Chem 196:860–866
Ye LY, Deng YJ, Mukhtar I, Meng GL, Song YJ, Cheng B, Hao JB, Wu XP (2020) Mitochondrial genome and diverse inheritance patterns in Pleurotus pulmonarius. J Microbiol 58:142–152
Yuan B, Zhao LY, Rakariyatham K, Han YH, Gao ZL, Kimatu BM, Hu QH, Xiao H (2017) Isolation of a novel bioactive protein from an edible mushroom Pleurotus eryngii and its anti-inflammatory potential. Food & Function 8:2175–2183
Zhang AQ, Li XQ, Xing C, Yang JH, Sun PL (2014) Antioxidant activity of polysaccharide extracted from Pleurotus eryngii using response surface methodology. Int J Biol Macromol 65:28–32
Zhang BR, Li YY, Zhang FM, Linhardt RJ, Zeng GY, Zhang AQ (2020) Extraction, structure and bioactivities of the polysaccharides from Pleurotus eryngii: A review. Int J Biol Macromol 150:1342–1347
Zhang C, Lei Z, Li YJ, Yi LZ, Shang Y Identification of Tps2 Used as an Endogenous Reference Gene in Qualitative and Real-time Quantitative PCR Detection of Flammulina velutipes.Food Analytical Methods
Zheng S, Shan LY, Zhuang YL, Shang Y (2018) Identification of pyrG Used as an Endogenous Reference Gene in Qualitative and Real-Time Quantitative PCR Detection of Pleurotus ostreatus. J Food Sci 83:750–755

renamed1d132.jpg

PDF

Reviews received at journal
01 Mar, 2022
Reviewers invited by journal
22 Feb, 2022
Editor assigned by journal
18 Feb, 2022
First submitted to journal
13 Feb, 2022

You are reading this latest preprint version

Identification of s9ap Used as an Endogenous Reference Gene in Qualitative and Real-Time Quantitative PCR Detection of Pleurotus eryngii

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results And Discussion

Conclusion

Declarations

References

Supplementary Files

Status:

Version 1