Neferine, A Novel ROCK1 Targeting Inhibitor, Blocks EMT Process and Induces Apoptosis in Non-Small Cell Lung Cancer

doi:10.21203/rs.3.rs-1358233/v1

PDF

Research Article

Neferine, A Novel ROCK1 Targeting Inhibitor, Blocks EMT Process and Induces Apoptosis in Non-Small Cell Lung Cancer

https://doi.org/10.21203/rs.3.rs-1358233/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

The compounds derived from Traditional Chinese Medicines have shown various pharmacological activities with unique advantages, especially in the aspect of anti-tumor. Neferine (Nef), a natural compound, extracted from green seed embryos of Lotus (Nelumbo nucifera Gaertn) also exerts antitumor effects on cancers. In this study, the effects and mechanisms of Nef on epithelial-to-mesenchymal transition (EMT) process in non-small cell lung cancer (NSCLC) were evaluated. The results showed that Nef had the antitumor effects in vivo and in vitro. Nef significantly suppressed cell viability and induced apoptosis in NSCLC cells, with elevated reactive oxygen species and reduced BCL-2 /BAX ratio. Nef was also demonstrated to inhibit the invasion, metastasis and EMT process of NSCLC cells, and attenuate EMT-related changes of E-cadherin, N-cadherin and Vimentin at both transcriptional and translational levels. Moreover, we concluded that the inhibitory effects of Nef on EMT was achieved by targeting Rho-associated protein kinase 1 (ROCK1), a protein mediating the process of EMT in various cancers. These results showed that Nef had a significant antitumor effect on NSCLC cells by inducing apoptosis and blocking EMT, providing the therapeutical prospect on NSCLC treatment.

NSCLC

neferine

EMT

apoptosis

natural compound

ROCK1

Lung cancer is the most frequent cause of cancer deaths worldwide and the non-small cell lung cancer (NSCLC) constitutes approximately 85% of lung cancers. The treatment of NSCLC has made a significant progress, with the advent and application of small molecule tyrosine kinase inhibitors and immunotherapy over the past two decades (Herbst et al. 2018). However, the characteristics of metastasis and epithelial-to-mesenchymal transition (EMT) process are still the barrier of NSCLC cure (Herbst et al. 2018; Ou and Zhu 2019). These traits increase the resistance and recurrence of NSCLC (Zheng et al. 2018).

Increasing evidence demonstrates that onco-factor KRAS promotes the metastasis and EMT process in NSCLC cells (Adachi et al. 2020; Larsen et al. 2016; Shaurova et al. 2020). KRAS mutations are the most frequent gain-of-function alterations and at least 1/4 of NSCLC patients have KRAS mutation (Adderley et al. 2019). Metastasis and recurrence are common in KRAS-mutated lung cancer (Renaud et al. 2015; Renaud et al. 2016). A study on metastasis of KRAS mutant lung cancer cells showed that wild-type KRAS was detected in primary tumor sites and then detectable mutant KRAS was present in metastatic sites, supporting the important role of KRAS mutations in metastasis of cancer cells (Rau et al. 2016). In addition, after the occurrence of KRAS mutation and metastasis, the response of tumor cells to treatment of tyrosine kinase inhibitors is reduced, which also indicates that KRAS-induced metastasis is extremely threatening to the survival of lung cancer patients (Rau et al. 2016). Previous studies highlight the inhibition of Rho-associated protein kinase (ROCK), the downstream of GATA2, which has a synthetic lethal interaction between oncogenic KRAS can result in dramatic tumor inhibition, especially in combination with bortezomib (Barbacid 2012; Kumar et al. 2012). ROCK is a serine/threonine kinase, involved in cytoskeleton organization, cell adhesion and motility, and can promote metastasis of tumor by phosphorylation of myosin light chain (Hartmann et al. 2015). Overexpression of aberrant-activation of ROCK is associated with the poor diagnosis and shortened survival of cancer patients (Deng et al. 2017). The modulation of ROCK in EMT in hepatocellular carcinoma, osteosarcoma and NSCLC has been suggested as the potential therapy target of cancers (Guo et al. 2019; Lin et al. 2018; Shi et al. 2019). However, there is less study on the effects of ROCK in metastasis of KRAS mutant NSCLC although it is considered as a therapeutical target.

Nowadays, the natural compounds derived from Traditional Chinese Medicines (TCMs) have shown the potential treatment value on tumors (Zhang et al. 2020). Neferine (Nef), a natural compound, extracted from green seed embryos of Lotus (Nelumbo nucifera Gaertn) also exerts various function on various tumor cells, such as proliferation inhibition, apoptosis induction, and mitochondrial dysfunction (Erdogan and Turkekul 2020; Wang et al. 2020; Xie et al. 2020). It also indicates the inhibitory effects of Nef on lung cancer, including suppression on lung carcinogenesis and sensitization of chemotherapy (Sivalingam et al. 2019; Sivalingam et al. 2017). However, the effects and mechanism of Nef on EMT process in NSCLC still unknown. Herein, the KRAS mutant NSCLC cells A549 was used to determine the in vitro cytotoxicity and inhibitory ability of Nef on EMT in comparison with H1299 cells (NRAS mutant NSCLC), and found that Nef had ROCK1 targeting affinity via molecular docking and as well as the role of ROCK1 in metastasis of NSCLC.

Cell culture and reagents

The NSCLC cells lines (A549, and H1299) and human normal lung epithelial cells BEAS-2B purchased from KeyGen BioTECH (Nanjing, China) were incubated in RPMI-1640 medium (KeyGEN BioTECH, NanJing, China) contains 10% fetal bovine serum (FBS; WISENT corporation, Wisent, Canada), as well as 1% penicillin (WISENT) and 1% streptomycin (WISENT). The cells were incubated in Heracell 150i Incubator (Thermo Fisher Scientific, Waltham, MA, USA) at 37°C in a 5% CO₂ atmosphere. Trypin was purchased from WISENT. Neferine (Nef, C₃₈H₄₄N₂O₆, Molecular weight: 624.8, Purity> 95%), obtained from Nanjing University of Chinese Medicine (Nanjing, China), and the molecular structure were shown in Figure 1A. Nef were dissolved in dimethyl sulfoxide (DMSO) to produce 10 mM stock solution and stored at -80°C. The primary antibodies including B-cell lymphoma-2 (BCL2) (#48496), BCL2 associated X protein (BAX) (#29057), ROCK1 (#48890), GAPDH (#21612), E-cadherin (#40860), N-cadherin (#48495), Vimentin (#41531) were purchased from Signalway Antibody (MD, USA), and the HRP-conjugated Goat anti-Rabbit (#S0001) were purchased from Affinity Biosciences (Cincinnati, OH, USA). All antibodies were used in accordance with the instructions. Recombinant human transforming growth factor-β1 (TGF-β1) was purchased from STEMCELL Technologies (Vancouver, BC, Canada).

In vivo assay

The BALB/c mice (male, 6 weeks old, weighing 18~22 g) (Gempharmatech, Jiangsu, China) were engrafted in the right legs of the mice with A549 cellsor TGF-β1-treated A549 cells (5×10⁶ cells) in PBS. The mice were divided into six groups as shown in Figures. The mice were received Nef intraperitoneally for everyday for three weeks. The tumor volumn (V=1/2×L×D², mm³) and mice weight (g) were measured. Animal experiments were approved by the Review Board of Nanjing University of Chinese Medicine (Ethics number: 202011A002).

Cell transfection

Scrambled siRNA and ROCK1 siRNA were designed and synthesized by GenePharma (Shanghai, China). For cell transfection, the cells were transfected with 2.5 µg plasmid or 50 nM siRNA using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer's protocol. After transfection for 48 h, the cells were collected and used for the subsequent experiments.The primers of ROCK1 siRNA were as follows: F:CCAGUUGUACCCGAUUUAATT; R:UUAAAUCGGGUACAACUGGTT

Cell apoptosis

The cells were collected and labeled with Annexin V and PI according to the protocols of Annexin V/PI Cell Apoptosis Detection Kit (Vazyme biotec, Nanjing, China). The fluorescence was detected by BectoneDickinson FACS Calibur flow cytometry (NJ, USA) and the data analysis was performed by Flowjo software (Tree Star, Ashland, OR, USA).

Reactive oxygen species (ROS) detection

The cells after drug treatment were harvested and stained with DCFH-DA (10 mM, diluted in serum-free medium; Beyotime Biotechnology, Shanghai, China) for 20 min at 37°C. Then cells were washed with phosphate-buffered saline (PBS) for 3 times. Finally, the cells were resuspended in PBS and detected by fluorescence microscope (Lecia, Wetzlar, Germany).

Cell viability

The cell viability was determined by CCK8 Cell Counting Kit (Vazyme biotec). The cells growth in 96-well plate were treated for 0, 4, 6, 10, 20, 40 and 80 μM of Nef for 24 or 48 h and then incubated with 100 μL of CCK8 solution for 30 min at 37°C in a 5% CO₂ atmosphere. The optical density (OD) was detected by VICTOR Multilabel Plate Reader (PerkinElmer, Hopkinton, USA). The cell viability was calculated as follows: Cell viability (%) = (OD_test-OD_blank)/(OD_control-OD_blank)×100%.

Western blot

The total protein was extracted from the cells treated with Nef using RIPA Buffer (Beyotime Biotechnology) and the concentration of protein were determined by BCA Protein Assay Reagent (Thermo Fisher Scientific). Protein samples (40 μg each) were loaded, separated by SDS-PAGE gels and transferred to PVDF membrane (Bio-Rad Laboratories, Hercules, USA) followed by western blot analysis. Immunodetection was performed using a WesternBright ECL (Advansta, Bering Drive San Jose, CA, USA). Detection was performed with ChemiDoc XRS+ System (Bio-Rad) and captured by Image Lab software (Bio-Rad). The bands were quantified by Image J software (National Institutes of Health, Bethesda, MD, USA). The blots were representative of triple independent experiments.

Immunofluorescent assay

The cells after treatment were washed by PBS and then fixed by 4% paraformaldehyde for 30 min. The cells were permeabilized in 0.3% Triton X-100 for 30 min. After blocking with 3% BSA and incubating with primary antibodies, the cells were followed by incubation with a secondary antibody conjugated to Alexa Fluor (Bio-Rad) for 1 h and DAPI (Bio-Rad). The cell images were captured with a confocal laser scanning microscope (Leica).

Real-time quantitative polymerase chain reaction (qRT-qPCR) analysis

Total RNA was extracted from tissue samples and cells using RNA Easy Fast Tissue/Cell Kit (TIANGEN BIOTECH, Beijing, China) according to manufacturer's instructions. RNA was reversely-transcribed into cDNA using the FastKing gDNA Dispelling RT SuperMix Kit (TIANGEN BIOTECH). qPCR was performed using iTaq™ Universal SYBR^® Green (Bio-chain, Shanghai, China) and CFX Connect™ Real-Time PCR Detection System (Bio-Rad). The thermocycling conditions were as follows: 40 cycles at 95°C for 30 sec (denaturation), 60°C for 10 s (annealing), and 72°C for 30 s (extension). GAPDH was served as an internal control. Relative gene expression was quantified using 2^−ΔΔCtmethod. The primers were as follows:

GAPDH (5’-3’) F: GGAGCGAGATCCCTCCAAAAT; R: GGCTGTTGTCATACTTCTCATGG

ROCK1 (5’-3’) F: AACATGCTGCTGGATAAATCTGG; R: TGTATCACATCGTACCATGCCT

E-cadherin (5’-3’) F: ATTTTCCCTCGACACCCGAT; R: TCCCAGGCGTAGACCAAGA

N-cadherin (5’-3’) F: TCAGGCTGTGGACATAGAAACC; R: GCTGTAAACGACTCTGGCACT

Vimentin (5’-3’) F: AGTCCACTGAGTACCGGAGAC; R: CATTTCACGCATCTGGCGTTC

Transwell assay

For cell migration assay, after Nef treatment, the 200 µL cells were suspended by serum-free medium in 1×10⁶/mL and loaded into the upper chamber of transwell, while 600 µL supplemented with 10% FBS was added to the lower chamber. Following incubation for 24 h, the cells in the upper chamber were removed by a cotton swab and the cells in the lower chamber were fixed by 4% paraformaldehyde and then stained with 0.1% crystal violet for 15 min at room temperature. For cell invasion assay, transwell chambers with 8-µm pore sizes (Millipore-Sigma, Boston, MA, USA) were coated with 50 µl Matrigel (BD Biosciences, Franklin Lakes, NJ, USA) and incubated at 37°C. Finally, the cells were counted and photographed under an inverted microscope (Leica). The migration and invasion ratio were calculated by Image J software.

Wound healing test

The cells were plated in 6-well plate and cultured until 90% confluence. A 10 μL pipette tip was utilized to scratch a line wound. The cells were washed by PBS for 2 times softly. The cells were treated with 0, 4, 6 and 10 μM Nef with serum-free medium for 24 h. The line wound was imaged at 0 and 24 h of culture under an inverted microscope. The line wound area was calculated by Image J software and as follows: Wound healing (%) = (Area_{0 h}-Area_{24 h})/ Area_{0 h}×100%.

Enzyme linked immunosorbent assay (ELISA)

Concentrations of matrix metalloproteinase (MMP) 2 and MMP9 in the media of cells with Nef treatment were determined by Human MMP-2/9 ELISA (Jin Yibai Biological Technology, Nanjing, China) according to the manufacturer’s instructions.

Molecular docking

The structural 3D model of ROCK1 -- Y27632 complex (Protein Data Bank ID, 2ETR) was used to determine the interactions of ROCK1 and Nef, and the results were analyzed using AutoDock Vina software (the Scripps Research Institute, USA). The structures of Y27632 and Nef were established by Chemdraw software (Perkinelmer, Hopkinton, USA). Grid Box (40 Å ×40 Å ×40 Å) centered at (51.530, 108.818, 28.061) Å, for AcROCK1 -- Y27632; grid box (40 Å ×40 Å ×40 Å) centered at (-0.088, 127.637, 22.682) Å, for Bc-ROCK -- Y27632. In this condition, the conformation of the complex formed by the docking of Y27632 drawn by Chemdraw and ROCK1 was consistent with that of the original ligand complex (Supplementary Figure 1A-D), indicating it was suitably used in the docking experiments by utilizing the AutoDock tools.

Statistical analysis

The data performed with three independent experiments and were analyzed by GraphPad Prism 9 software (San Diego, CA, USA). For comparisons of two groups, a two-tailed unpaired t-test was used. For comparisons of multiple groups, one-way analysis of variance (ANOVA) was used. All data were shown as mean ± SD, and P< 0.05 was considered to indicate a statistically significant difference.

The cytotoxicity effect of Nef in NSCLC cells.

In order to examine the antitumor effect of Nef, the cytotoxicity effect of Nef was firstly evaluated in NSCLC cells, i.e. A549 and H1299 cells after 24 or 48 h of treatment in a concentration range of 0-80 μM of Nef, using CCK8 assay. As shown in Figure 1B, the A549 and H1299 cells displayed a significantly decreased cell viability in a time- and concentration-dependent manner in response to Nef treatment. The half maximal inhibitory concentrations (IC₅₀) of Nef to A549 and H1299 were 41.03 μM and 63.30 μM at 24 h, and 14.34 μM and 26.99 μM at 48 h, respectively (Figure 1C). However, the normal lung cells (BEAS-2B) were less effected by Nef. Although the cell viability was decreased in high concentration of Nef for 24 h, the cell viability was recovered at 48 h (Figure 1D). The results showed that Nef had a cytotoxicity effect on NSCLC cells, which could be tumor-dependent, and A549 cells were slightly more sensitive to the H1299 cells. The data also suggest that Nef molecule has a relatively long half-life, as one-off addition of the Nef resulted in much higher proportions of cell death after 48 h than 24 h. In addition, we also determined the antitumor effects of Nef in vivo. As shown in Figure 1E, TGF-β1 could enhance the proliferation of xenograft tumor, while Nef could decreased the tumor growth compared with control group or TGF-β1-induced group. Besides, the antitumor effects of Nef were more significant than Fas with the less effects on mice weight (Figure 1F).

Nef promoted the cell apoptosis in NSCLC cells.

Previous studies indicated that Nef was able to induce cell apoptosis in prostate cancer cells and renal cancer cells (Kim et al. 2019; Nazim et al. 2020). Therefore, we also determined the potential of Nef on inducing apoptosis in NSCLC cells using Annexin V/PI Cell Apoptosis Detection Kit. After treatment with 0, 10, 20 and 40 μM of Nef for 48 h, the total apoptosis rates (Annexin V-positive cells) in A549 cells were 8.82 ± 0.36 %, 14.05 ± 0.59 %, 19.21 ± 0.51 %, and 26.25 ± 2.25%, and in H1299 cells were 11.15 ± 0.76 %, 14.51 ± 0.92 %, 23.38 ± 1.45 %, and 26.22 ± 1.34 % (Figure 2A). These data demonstrate that both A549 and H1299 NSCLC cells displayed a comparable apoptotic profile in response to Nef treatment.

As excess cellular levels of ROS could occur during activation of cell death, in addition, we detected that Nef could increase the ROS levels both in A549 and H1299 cells, suggesting Nef promoted the oxidative stress in NSCLC cells (Figure 2B). Interestingly, significantly higher levels of ROS were detected in A549 cells than in H2199 cells (Figure 2B) under10 or 20 μM of Nef treatment. Compelling evidence in the literature suggests that apoptosis is tightly regulated by the balance of a negative regulator, BCL2, and a positive regulator, BAX (Zhang et al. 2018). The BCL2 and BAX protein contents were subsequently analyzed by immunoblotting. The A549 and H1299 cells treated with Nef had an increased expression of BAX protein, but decreased expression of BCL2 (Figure 2C-D), leading to lower ratios of BCL2/BAX. However, the Nef-mediated upregulation of the BAX in response to 20 or 40 μM of treatment was more dramatic in A549 cells than in H1299 cells, indicating that there could be subtle differences in mechanisms of Nef-mediating apoptotic effects between the two NSCLC cell lines.

The inhibitory effects of Nef on cell invasion and migration of NSCLC cells.

The metastasis of cancer cells is a risk factor for tumor-associated lethality and poor prognosis in NSCLC (Huang et al. 2019). It is crucial to reduce/block the metastasis of NSCLC cells in clinical treatment and we therefore next addressed whether Nef could inhibit the invasion and migration of tumor cells in vitro. As shown in Figure 3A-B, 4, 6 and 10 μM of Nef were able to suppress the migration ability of A549 and H1299 cells in the wound healing assay (Figure 3A), and invasion ability with transwell assay(Figure 3B) in a dosage-dependent manner. We then determined the primary mechanism of metastasis inhibition of Nef. MMP2 and MMP9 are widely found to corelate with the pathology of cancers, including but not limited to invasion and metastasis (Huang 2018; Scheau et al. 2019). Nef at 4, 6 and 10 μM were found to suppress the secretion of MMP2 and MMP9 (Figure 3C). These results proved the inhibitory effects of Nef on invasion and migration of NSCLC cells, which might be partially achieved by inhibiting MMP2 and MMP9.

Nef suppressed the EMT process in NSCLC cells.

The transdifferentiation of epithelial cells into motile mesenchymal cells, a process known as EMT, which plays an important role in cell progression and metastasis (Du and Shim 2016; Lamouille et al. 2014). An EMT model can be established by classic inducer TGF-β1 (Mo et al. 2017). Here we established the NSCLC EMT model in vitro using A549 and H1299 cells. As shown in Figure 4A the morphology of H1299 cells was changed after the stimulation of 5, 10 and 15 ng/mL of TGF-β1 for 12 and 24 h. The formation of invasive pseudopodia in tumor cells could be induced (arrows in Figure 4A; the data of A549 cells were not shown). In addition, TGF-β1 modulated the expression of EMT-related protein, including increased expression of N-cadherin and Vimentin, as well as the decreased expression of E-cadherin (Figure 4B). It suggested TGF-β1 promoted EMT progression in NSCLC cells. After the NSCLC EMT model establishment, we explored the effects of Nef on EMT process. As shown in Figure 4B, in comparison to the EMT model group treated with TGF-β1 alone, Nef could counteract the effect of TGF-β1 on expression of EMT-related proteins, i.e., increased E- cadherin expression and reduced expression of N-cadherin and Vimentin at both transcriptional (Figure 4C) and translational levels (Figure 4B). This evidence suggest that Nef can inhibit EMT process in cellular and molecular levels in NSCLC cells by regulating EMT-related factors.

Nef inhibited invasion, migration and EMT process of NSCLC cells via targeting ROCK1.

Previous studies have emphasized the vital role of ROCK1 in metastasis and EMT in cancer cells (Duan et al. 2020; Li et al. 2020; Tang et al. 2019). We also found the modulation effects of ROCK1 in NSCLC cells. First, after treatment with ROCK1 siRNA (Figure 5A-B), the invasion and migration ability of both A549 and H1299 cells were decreased (Figure 5C-D), suggesting the effects of ROCK1 in promoting metastasis in NSCLC cells. Second, ROCK1 protein expression in A549 and H1299 cells treated with EMT inducer TGF-β1 were enhanced significantly (Figure 6A). However, after treatment with 4, 6 and 10 μM of Nef, the ROCK1 protein expression was attenuated (Figure 6B), which was also proved by immunofluorescent assay (Figure 6C). We also determined the expression of ROCK1 in xenograft tumor in Figure 1. The results showed that ROCK1 expression was induced by TGF-β1 and was decreased by Nef (Figure 6D). These results demonstrated the correlation of ROCK1 expression with invasion, migration and EMT process of NSCLC, and Nef might reduce these processes by inhibiting ROCK1 expression.

According to the results of dependent relevance of ROCK1 and Nef, we provided evidence that Nef could interact with ROCK1 protein by molecular docking (Figure 7A-D). The results showed the binding free energy of Nef with AcROCK1 and BcROCK1 were -10.08 KJ/mol and -9.00 KJ/mol, respectively, which were higher than Y27632, a well-known ROCK1 inhibitor, with AcROCK1 (binding free energy: -7.1 KJ/mol) or BcROCK1 (binding free energy: -7.2 KJ/mol), suggesting Nef had stronger interaction with ROCK1 than Y27632. Besides, molecular docking also showed that the number of residues of ROCK1 interacted with Nef were more than Y27632 (Supplementary Figure 1E-F). It suggested that Nef might block invasion, migration and EMT process through inhibiting ROCK1.

A significant progress, including chemotherapy, radiotherapy, immunotherapy and tyrosine kinase inhibitors, has been made in the diagnosis and treatment of NSCLC in recent years, however the 5-year overall survival rate of patients with NSCLC has remained as low as 16%. The recurrence and tumor metastasis currently remain as the major obstacle in clinical cancer treatment (Pan et al. 2019), and it istherefore imperative to develop novel therapeutic agents against tumor invasion and motility to overcome the shortcomings of current treatment of lung cancer (Herbst et al. 2018). In this study, we illustrated the antitumor effects of Nef, a natural compound from green seed embryos of Lotus, on two NSCLC cells lines in vitro. Nef also decreased the tumor growth in vivo. We have demonstrated that Nef exerts cytotoxicity effects to the NSCLC cell lines in micromolar concentrations, induces apoptosis by regulating BCL2/BAX ratio. We also provided evidence that Nef can target ROCK1 protein through molecular docking and that Nef can significantly inhibit cell migration and invasion in would healing and transwell assays, and attenuate dysregulations of key oncogenic factors during EMT process in the NSCLC cells.

Previous evidences have shown the various pharmaceutical functions of Nef, including antitumor, anti-diabetic, anti-aging, anti-microbial, anti-thrombotic, anti-arrhythmic, anti-inflammatory and even anti-HIV (Marthandam Asokan et al. 2018). Our current study is in consistency with the recent literature and also enhances the attention on antitumor properties of Nef. For example, Nef was found to modulate JNK pathway activation, to inhibit cell proliferation and induce apoptosis in melanoma and prostate cancer (Nazim et al. 2020; Xie et al. 2020). Nef was also shown to possess antitumor activities via inhibiting cell invasion and EMT in hepatocellular carcinoma (Deng et al. 2017). The studies indicate the IC₅₀ of Nef against LNCaP cells (prostate cancer), MCF-7 cells (breast cancer) and HCT8 cells (colon cancer) are 35 µM, 33.7 µM and 20.3 µM, respectively at 48 h (Erdogan and Turkekul 2020; Kadioglu et al. 2017). The IC₅₀ value above were in a good agreement with H1299 cells, the NRAS mutant NSCLC (26.66 μM), but were much higher than Nef on A549 cells (14.34 μM), suggesting that A549 cells, which is KRAS mutant NSCLC, might be more sensitive to Nef treatment and it required further investigation. Besides, Nef treatment had more notable induction of ROS and BAX protein levels in A549 cells, whereas, the inhibitory in metastasis was similar in A549 and H1299 cells. NRAS mutation is rarely observed in NSCLC patients, and there are no approved treatments for NRAS-mutant NSCLC yet (Park et al. 2020). However, GATA2 knockdown also reduced the viability of cell lines carrying mutated loci functionally related to KRAS such as NRAS, NF1, EML4-ALK and EGFR (Kumar et al. 2012). Our results showed the inhibitory effect of Nef on H1299 cells, which indicated that inhibition of ROCK, downstream of GATA2, was also effective on NRAS mutant cells. Lung cancer is the major type of cancer death, and our current research together with others highlight the potential for developing Nef as a common antitumor drug in the wide range of cancer cell lines and in pre-clinical models.

We have analyzed the antitumor mechanism of Nef and identified a novel target of Nef, ROCK1, which is involved in cell invasion and EMT (Guo et al. 2019; Hu et al. 2019; Lin et al. 2018). In recent years, the dysregulation of the ROCK1/2 has been associated with increased metastasis and poor patient survival in several tumor types. ROCK1/2 play essential roles in regulating the cytoskeleton, and have been increasingly recognized as common targets for many types of cancer (de Sousa et al. 2020). Previous studies show that ROCK is involved in anchorage-independent growth and invasion regulation directly (Vigil et al. 2012). The application of fasudil (Fas), a ROCK1 inhibitor, shows the treatment value in cancers by reducing the invasion and metastasis of hepatocellular carcinoma (Hu et al. 2014; Shahbazi et al. 2020). Evidence is appearing that the inhibition of ROCK1, as an oncogene, can play the suppression role in tumor progression, especially in NSCLC (Hu et al. 2019; Xin et al. 2020). In KRAS-driven lung cancers, ROCK is controlled by KRAS-GATA2 interaction, and the application of Fas can inhibit tumor progression (Barbacid 2012; Kumar et al. 2012). All these results indicate the importance of developing new inhibitors of ROCK1 and exploring the therapeutic potential.

We have not only demonstrated the antitumor effect of Nef, but also showed that Nef targets ROCK1 with higher affinity than the existing ROCK inhibitor Y27632. As shown by molecular docking, 18 amino acid residues of AcROCK1 can interact with Nef, including Lys105, Gly85, Ala86, Phe87, Thr219, Ala215, Ser118, Gly218, Phe120, Ile82, Ala103, Glu154, Met156, Phe368, Met153, Val90, Gly83, and Asp216, and Nef forms hydrogen bonds with Lys105, Ser118 and Asp216. In addition, 17 amino acid residues of BcROCK1 can interact with Nef, including Asn163, Asp160, Phe368, Asn367, Asp369, Met153, Asp216, Ala215, Met156, Glu154, Ala103, Ile82, Gly83, Val90, Lys105, Lys200, and Asp202, and Nef can form hydrogen bonds with Asp369, Asp216, and Lys200. The numbers of amino acid residues in both AcROCK1 and BcROCK1 interacting with Y27632 are less than those of Nef. This may be related to the unique skeleton of Nef consisting of two benzylisoquinoline groups. It is suggested that Nef as the novel potential ROCK1 inhibitor has a higher binding affinity than Y27632. Furthermore, we show that Nef can decrease the expression of ROCK1 protein. We hypothesize that binding of Nef to ROCK1 may also influence the stability of ROCK1 leading to accelerated degradation and/or negative feedback of autoregulation, which are required to be further investigated in the subsequent studies, as currently there is lack of knowledge in specific pathway involving in ROCK1 degradation.

In summary, Nef as a natural compound isolated from Chinese medicine, has shown to play multiple anti-tumor roles, which include inhibiting cell viability, inducing apoptosis via regulation of ROS and BCL2/BAX balance, inhibiting invasion, migration and EMT process via onco-factors in NSCLC cells, in particular by targeting ROCK1 and decreasing ROCK1 protein contents. The study demonstrates the therapeutical potential of Nef as a novel ROCK1 inhibitor, which may find a wide application for common cancers. Our results also emphasized ROCK as the therapeutical targets of KRAS and NRAS mutant NSCLC. Further, the mechanism of ROCK1 inhibition, downstream targets and the connection between ROCK1 and EMT process should be also explored in the follow up studies. In addition to verify the therapeutic effects and mechanism of Nef on a wide range of NSCLC cell lines, we need to evaluate the safety and effectiveness of Nef in vivo in pre-clinical models and in human cell models, to provide a firm foundation of clinical trials and the application prospects of TCM in clinical cancer treatment.

ANOVA

analysis of variance

BAX

BCL2 associated X protein

BCL2

B-cell lymphoma-2

DMSO

dimethyl sulfoxide

ELISA

enzyme linked immunosorbent assay

EMT

epithelial-to-mesenchymal transition

Fas

fasudil

IC₅₀

half maximal inhibitory concentration

Nef

Neferine

NSCLC

non-small cell lung cancer

optical density

PBS

phosphate-buffered saline

qRT-qPCR

real-time quantitative polymerase chain reaction

ROS

reactive oxygen species

ROCK1

Rho-associated protein kinase 1

TCMs

traditional Chinese Medicines

TGF-β1

transforming growth factor-β1

Funding

Research supported by the National Natural Science Foundation of China (No. 81373295, 81473420); the Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD); and Top-notch Academic Programs Project of Jiangsu Higher Education Institutions (TAPP).

Availability of data and materials

The datasets used during the present study are available from the corresponding author upon reasonable request.

Authors' contributions

G. Yang and Y. Pan conceived the idea; P. Hu, P. Wan and B. Yan performed most of the research; Q. Xu and C. Liu conducted the molecular docking; Z. Wei, J. Xu and S. Liu analyzed the data; all authors contributed to the writing and revisions.

Ethics approval and consent to participate

Animal experiments were approved by the Review Board of Nanjing University of Chinese Medicine (Ethics number: 202011A002).

Competing interests

The authors declare that they have no competing interests.

Adachi Y, Ito K, Hayashi Y, et al. (2020) Epithelial-to-Mesenchymal Transition is a Cause of Both Intrinsic and Acquired Resistance to KRAS G12C Inhibitor in KRAS G12C-Mutant Non-Small Cell Lung Cancer. Clin Cancer Res 26(22):5962-5973 doi:10.1158/1078-0432.CCR-20-2077
Adderley H, Blackhall FH, Lindsay CR (2019) KRAS-mutant non-small cell lung cancer: Converging small molecules and immune checkpoint inhibition. EBioMedicine 41:711-716 doi:10.1016/j.ebiom.2019.02.049
Barbacid M (2012) Opening a new GATAway for treating KRAS-driven lung tumors. Cancer Cell 21(5):598-600 doi:10.1016/j.ccr.2012.04.032
de Sousa GR, Vieira GM, das Chagas PF, Pezuk JA, Brassesco MS (2020) Should we keep rocking? Portraits from targeting Rho kinases in cancer. Pharmacol Res 160:105093 doi:10.1016/j.phrs.2020.105093
Deng G, Zeng S, Ma J, et al. (2017) The anti-tumor activities of Neferine on cell invasion and oxaliplatin sensitivity regulated by EMT via Snail signaling in hepatocellular carcinoma. Sci Rep 7:41616 doi:10.1038/srep41616
Du B, Shim JS (2016) Targeting Epithelial-Mesenchymal Transition (EMT) to Overcome Drug Resistance in Cancer. Molecules 21(7) doi:10.3390/molecules21070965
Duan ZN, Dong CG, Liu JH (2020) Circ-ABCB10 promotes growth and metastasis of nasopharyngeal carcinoma by upregulating ROCK1. Eur Rev Med Pharmacol Sci 24(23):12208-12215 doi:10.26355/eurrev_202012_24011
Erdogan S, Turkekul K (2020) Neferine inhibits proliferation and migration of human prostate cancer stem cells through p38 MAPK/JNK activation. J Food Biochem 44(7):e13253 doi:10.1111/jfbc.13253
Guo D, Li Y, Chen Y, et al. (2019) DANCR promotes HCC progression and regulates EMT by sponging miR-27a-3p via ROCK1/LIMK1/COFILIN1 pathway. Cell Prolif 52(4):e12628 doi:10.1111/cpr.12628
Hartmann S, Ridley AJ, Lutz S (2015) The Function of Rho-Associated Kinases ROCK1 and ROCK2 in the Pathogenesis of Cardiovascular Disease. Front Pharmacol 6:276 doi:10.3389/fphar.2015.00276
Herbst RS, Morgensztern D, Boshoff C (2018) The biology and management of non-small cell lung cancer. Nature 553(7689):446-454 doi:10.1038/nature25183
Hu C, Zhou H, Liu Y, et al. (2019) ROCK1 promotes migration and invasion of nonsmallcell lung cancer cells through the PTEN/PI3K/FAK pathway. Int J Oncol 55(4):833-844 doi:10.3892/ijo.2019.4864
Hu K, Wang Z, Tao Y (2014) [Suppression of hepatocellular carcinoma invasion and metastasis by Rho-kinase inhibitor Fasudil through inhibition of BTBD7-ROCK2 signaling pathway]. Journal of central south university 39(12):1221-7 doi:10.11817/j.issn.1672-7347.2014.12.001
Huang H (2018) Matrix Metalloproteinase-9 (MMP-9) as a Cancer Biomarker and MMP-9 Biosensors: Recent Advances. Sensors (Basel) 18(10) doi:10.3390/s18103249
Huang JQ, Wei FK, Xu XL, et al. (2019) SOX9 drives the epithelial-mesenchymal transition in non-small-cell lung cancer through the Wnt/beta-catenin pathway. J Transl Med 17(1):143 doi:10.1186/s12967-019-1895-2
Kadioglu O, Law BYK, Mok SWF, Xu SW, Efferth T, Wong VKW (2017) Mode of Action Analyses of Neferine, a Bisbenzylisoquinoline Alkaloid of Lotus (Nelumbo nucifera) against Multidrug-Resistant Tumor Cells. Front Pharmacol 8:238 doi:10.3389/fphar.2017.00238
Kim EA, Sung EG, Song IH, et al. (2019) Neferine-induced apoptosis is dependent on the suppression of Bcl-2 expression via downregulation of p65 in renal cancer cells. Acta Biochim Biophys Sin 51(7):734-742 doi:10.1093/abbs/gmz061
Kumar MS, Hancock DC, Molina-Arcas M, et al. (2012) The GATA2 transcriptional network is requisite for RAS oncogene-driven non-small cell lung cancer. Cell 149(3):642-55 doi:10.1016/j.cell.2012.02.059
Lamouille S, Xu J, Derynck R (2014) Molecular mechanisms of epithelial-mesenchymal transition. Nat Rev Mol Cell Biol 15(3):178-96 doi:10.1038/nrm3758
Larsen JE, Nathan V, Osborne JK, et al. (2016) ZEB1 drives epithelial-to-mesenchymal transition in lung cancer. J Clin Invest 126(9):3219-35 doi:10.1172/JCI76725
Li X, Cheng Y, Wang Z, et al. (2020) Calcium and TRPV4 promote metastasis by regulating cytoskeleton through the RhoA/ROCK1 pathway in endometrial cancer. Cell Death Dis 11(11):1009 doi:10.1038/s41419-020-03181-7
Lin L, Li M, Lin L, Xu X, Jiang G, Wu L (2018) FPPS mediates TGF-beta1-induced non-small cell lung cancer cell invasion and the EMT process via the RhoA/Rock1 pathway. Biochem Biophys Res Commun 496(2):536-541 doi:10.1016/j.bbrc.2018.01.066
Marthandam Asokan S, Mariappan R, Muthusamy S, Velmurugan BK (2018) Pharmacological benefits of neferine - A comprehensive review. Life Sci 199:60-70 doi:10.1016/j.lfs.2018.02.032
Mo C, Liu T, Zhang S, et al. (2017) Reduced N-acetylglucosaminyltransferase III expression via Smad3 and Erk signaling in TGF-beta1-induced HCC EMT model. Discov Med 23(124):7-17
Nazim UM, Yin H, Park SY (2020) Neferine treatment enhances the TRAILinduced apoptosis of human prostate cancer cells via autophagic flux and the JNK pathway. Int J Oncol 56(5):1152-1161 doi:10.3892/ijo.2020.5012
Ou SI, Zhu VW (2019) CNS metastasis in ROS1+ NSCLC: An urgent call to action, to understand, and to overcome. Lung Cancer 130:201-207 doi:10.1016/j.lungcan.2019.02.025
Pan P, Huang YW, Oshima K, et al. (2019) The immunomodulatory potential of natural compounds in tumor-bearing mice and humans. Crit Rev Food Sci Nutr 59(6):992-1007 doi:10.1080/10408398.2018.1537237
Park S, Kim TM, Cho SY, et al. (2020) Combined blockade of polo-like kinase and pan-RAF is effective against NRAS-mutant non-small cell lung cancer cells. Cancer Lett 495:135-144 doi:10.1016/j.canlet.2020.09.018
Rau KM, Chen HK, Shiu LY, et al. (2016) Discordance of Mutation Statuses of Epidermal Growth Factor Receptor and K-ras between Primary Adenocarcinoma of Lung and Brain Metastasis. Int J Mol Sci 17(4):524 doi:10.3390/ijms17040524
Renaud S, Falcoz PE, Schaeffer M, et al. (2015) Prognostic value of the KRAS G12V mutation in 841 surgically resected Caucasian lung adenocarcinoma cases. Br J Cancer 113(8):1206-15 doi:10.1038/bjc.2015.327
Renaud S, Seitlinger J, Falcoz PE, et al. (2016) Specific KRAS amino acid substitutions and EGFR mutations predict site-specific recurrence and metastasis following non-small-cell lung cancer surgery. Br J Cancer 115(3):346-53 doi:10.1038/bjc.2016.182
Scheau C, Badarau IA, Costache R, et al. (2019) The Role of Matrix Metalloproteinases in the Epithelial-Mesenchymal Transition of Hepatocellular Carcinoma. Anal Cell Pathol (Amst) 2019:9423907 doi:10.1155/2019/9423907
Shahbazi R, Baradaran B, Khordadmehr M, et al. (2020) Targeting ROCK signaling in health, malignant and non-malignant diseases. Immunol Lett 219:15-26 doi:10.1016/j.imlet.2019.12.012
Shaurova T, Zhang L, Goodrich DW, Hershberger PA (2020) Understanding Lineage Plasticity as a Path to Targeted Therapy Failure in EGFR-Mutant Non-small Cell Lung Cancer. Front Genet 11:281 doi:10.3389/fgene.2020.00281
Shi D, Wu F, Mu S, et al. (2019) LncRNA AFAP1-AS1 promotes tumorigenesis and epithelial-mesenchymal transition of osteosarcoma through RhoC/ROCK1/p38MAPK/Twist1 signaling pathway. J Exp Clin Cancer Res 38(1):375 doi:10.1186/s13046-019-1363-0
Sivalingam K, Amirthalingam V, Ganasan K, Huang CY, Viswanadha VP (2019) Neferine suppresses diethylnitrosamine-induced lung carcinogenesis in Wistar rats. Food Chem Toxicol 123:385-398 doi:10.1016/j.fct.2018.11.014
Sivalingam KS, Paramasivan P, Weng CF, Viswanadha VP (2017) Neferine Potentiates the Antitumor Effect of Cisplatin in Human Lung Adenocarcinoma Cells Via a Mitochondria-Mediated Apoptosis Pathway. J Cell Biochem 118(9):2865-2876 doi:10.1002/jcb.25937
Tang J, Liu C, Xu B, Wang D, Ma Z, Chang X (2019) ARHGEF10L contributes to liver tumorigenesis through RhoA-ROCK1 signaling and the epithelial-mesenchymal transition. Exp Cell Res 374(1):46-68 doi:10.1016/j.yexcr.2018.11.007
Vigil D, Kim TY, Plachco A, et al. (2012) ROCK1 and ROCK2 are required for non-small cell lung cancer anchorage-independent growth and invasion. Cancer Res 72(20):5338-47 doi:10.1158/0008-5472.CAN-11-2373
Wang J, Dong Y, Li Q (2020) Neferine induces mitochondrial dysfunction to exert anti-proliferative and anti-invasive activities on retinoblastoma. Exp Biol Med (Maywood) 245(15):1385-1394 doi:10.1177/1535370220928933
Xie J, Chen MH, Ying CP, Chen MY (2020) Neferine induces p38 MAPK/JNK1/2 activation to modulate melanoma proliferation, apoptosis, and oxidative stress. Ann Transl Med 8(24):1643 doi:10.21037/atm-20-7201
Xin T, Lv W, Liu D, Jing Y, Hu F (2020) ROCK1 knockdown inhibits non-small-cell lung cancer progression by activating the LATS2-JNK signaling pathway. Aging (Albany NY) 12(12):12160-12174 doi:10.18632/aging.103386
Zhang H, Yuan B, Huang H, Qu S, Yang S, Zeng Z (2018) Gastrodin induced HO-1 and Nrf2 up-regulation to alleviate H2O2-induced oxidative stress in mouse liver sinusoidal endothelial cells through p38 MAPK phosphorylation. Braz J Med Biol Res 51(10):e7439 doi:10.1590/1414-431X20187439
Zhang Y, Lou Y, Wang J, Yu C, Shen W (2020) Research Status and Molecular Mechanism of the Traditional Chinese Medicine and Antitumor Therapy Combined Strategy Based on Tumor Microenvironment. Front Immunol 11:609705 doi:10.3389/fimmu.2020.609705
Zheng H, Zhan Y, Liu S, et al. (2018) The roles of tumor-derived exosomes in non-small cell lung cancer and their clinical implications. J Exp Clin Cancer Res 37(1):226 doi:10.1186/s13046-018-0901-5

Supplementarymaterials.docx

PDF

Reviews received at journal
10 Apr, 2022
Reviewers invited by journal
18 Feb, 2022
Editor invited by journal
16 Feb, 2022
Editor assigned by journal
14 Feb, 2022
First submitted to journal
14 Feb, 2022

You are reading this latest preprint version

Neferine, A Novel ROCK1 Targeting Inhibitor, Blocks EMT Process and Induces Apoptosis in Non-Small Cell Lung Cancer

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

Abbreviations

Declarations

References

Supplementary Files

Status:

Version 1