2.10. Sample collection and preparation
Rats were weighed and anesthetized with ketamine/xylazine on the fifteenth day. Then, 5 mL blood samples were immediately collected directly from the heart and poured into 5 mL microtubes for further serum separation by centrifugation for 15 minutes at 1,500 g. Afterward, the animals were euthanized by the decapitation method, and their heart was harvested. About 20–30 mg of the harvested heart tissue were immediately transferred to 1.5 mL RNase and DNase-free microtubes, including 200 µL RNA later solution (Yekta Tajhiz Azma, Tehran, Iran). After overnight incubation at 4°C, these microtubes were transferred to -80°C until the RNA extraction. However, the remaining tissue samples were placed in a formalin-containing tube, and then along with serum samples, were kept at -20°C for further analysis.
2.11 Laboratory analysis
2.11.1 Complete blood count (CBC)
The white blood cells (WBC, × 103/µL), and red blood cells (RBC, × 106/µL) count, hemoglobin (Hb, g/dL), and platelets (PLT, × 103/µL) were quantified with an automated counter (H9000, Xuzhou forward medical instrument Co. Ltd., Xuzhou, China).
2.11.2 Serological analysis
As to determine the enzymatic activity of liver tissue, the levels of liver function tests (LFT), i.e., aspartate aminotransferase (AST) and alanine aminotransferase (ALT) were evaluated by commercial ELISA kits (Pars Azmun, Karaj, Iran). Then, De Ritis (AST/ALT) ratio was calculated for study samples.
2.11.3 Cardiac marker enzymes assay
Lactate dehydrogenase (LDH, IU/L) and creatinine kinase-MB (CK-MB, IU/L) activities were measured in serum samples by commercial ELISA kits (Pars Azmun, Karaj, Iran).
2.12 Biochemical analysis
2.12.1 Total anti-oxidant capacity (TAC) assay
A commercial enzyme-linked immunosorbent assay (ELISA) kit (Teb Pazhouhan Razi, Tehran, Iran) was used to assess the total anti-oxidant capacity (TAC) of the rats’ serum samples. Miller et al. (1993) published a detailed description of the technique 39. Finally, an absorbance microplate reader (ELx808, BioTek, Winooski, VT, United States) measured the OD of the samples at 420 nm. This ELISA kit’s intra- and inter-assay coefficient of variation was 5.7% and 3.7%, respectively, and its detection range was 45–420 µM.
2.12.2 Catalase (CAT) assay
Catalase (CAT) is a ubiquitous anti-oxidant enzyme present in all cells’ peroxisomes, providing cell protection against oxidative stress-induced damage by catalyzing the decomposition of hydrogen peroxide (H2O2) to water and oxygen. A commercial ELISA kit was used to assess CAT levels (Teb Pazhouhan Razi, Tehran, Iran) in which CAT activity was assessed by the reaction of the CAT present in the sample with methanol in the presence of an optimal concentration of H2O2 to produce formaldehyde. After adding a chromogen that turns aldehydes purple, formaldehyde formation is determined by colorimetric analysis. Finally, an absorbance microplate reader (ELx808, BioTek, Winooski, VT, United States) measured the OD of the samples at 540 nm. This kit’s intra- and inter-assay coefficient of variation was 4.1% and 9.9%, respectively.
2.12.3 Malondialdehyde (MDA) assay
Malondialdehyde (MDA) assay was used to evaluate the lipid peroxidation levels of the serum samples. MDA is an end product of the oxidative decomposition of the polyunsaturated fatty acids initiated by free radicals. Thus, it is a frequently measured biomarker of oxidative stress. A commercial ELISA kit was used to assess MDA levels (Teb Pazhouhan Razi, Tehran, Iran) using a spectrophotometric method based on the reaction between MDA and thiobarbituric acid (TBA) generating an MDA-TBA adduct, which can be quantified by colorimetric analysis. Finally, an absorbance microplate reader (ELx808, BioTek, Winooski, VT, United States) measured the OD of the samples at 540 nm. This ELISA kit’s intra- and inter-assay coefficient of variation was 6.7% and 7.2%, respectively, and its detection range was 0–50 µM.
2.13 Histopathological analysis
Each rats’ heart was harvested and weighed separately. These tissue specimens were fixed in 10% formalin solution and processed using a tissue processing device (dewatering, clearing, and staining), embedded in paraffin blocks, sliced in 5 µm thicknesses layers, and stained with hematoxylin and eosin (H&E). An average of four sections was placed on each slice. Therefore, approximately 390 sections were evaluated with digital light microscopy. Hyperemia, necrosis, and hyalinization were assessed in each section. An experienced user (Seyed Mohammad Hosseini) performed all morphological analysis using a Medicus pro-Myko microscope (Helmut Hund GmbH, Wetzlar, Germany) under ×40, ×100, and ×400 magnifications.
2.14 RNA extraction
A total RNA extraction commercial kit (Pars Tous Biotechnology, Mashhad, Iran) extracted the total RNA of the previously described 20–30 mg of harvested heart tissue. The extracted RNA of each sample was measured using a NanoDrop spectrophotometer (Thermo Scientific, Waltham, MA, USA). Then, all RNA samples were transferred to -80°C until further analysis
2.15 cDNA synthesis
For cDNA synthesis, a commercial cDNA synthesis kit (Pars Tous Biotechnology, Mashhad, Iran) was used in which the following mixture was included: 250 ng of the previously mentioned extracted RNA samples, 5 µL of the 2x enzyme buffer, and 1 µL of the reverse transcriptase enzyme. The resulting mixture was then reached to a 10 µL volume using diethylpyrocarbonate (DEPC)-treated water. Afterward, the mixture was incubated with a PCR-thermocycler (FlexCycler2, Analytik Jena AG, Jena, Germany) as follows: At room temperature for 10 minutes for the random hexamer primer annealing, at 47°C for 60 minutes for the reverse transcriptase reaction, and finally, at 85°C for 5 minutes for the ending the reaction.
2.16 Quantitative real-time PCR
cDNA samples were amplified in duplicates by PCR in RealQ Plus Master Mix Green (Ampliqon, Odense C, Denmark) using a 7300 Real-Time PCR System (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA). OLIGO Primer Analysis Software 7 (DBA Oligo, Inc., Colorado Springs, CO, USA) was used to design specific primers summarized in Table 1. Briefly, real-time PCR was performed using 10 µL of PCR reaction mixture consisting of 6.25 µL of master mix, 0.25 µL of each primer, 2.25 µL of RNase free dH2O, and 1 µL of cDNA templates. The amplification reaction cycles were performed as follows: Initial denaturation at 95°C for 15 minutes, then 40 cycles at 95°C for 15 seconds, annealing temperature for 30 seconds which was different for each primer as depicted in Table 1, and extension at 72°C for 30 seconds. At the end of the amplification cycles, the temperature of the samples was increased at a steady rate of 0.2°C/min from 60°C to 95°C for calculating the melting curve. Melting curve analyses and negative controls were embedded in each assay to ensure that the reaction contamination was not producing anyCR products 40. The target genes’ relative expression ratios (R) were measured using a model proposed by Pfaffl et al. 41, in which the reference and target genes’ efficiency was calculated according to a relative standard curve comprised of various dilutions (i.e., 1:1, 1:2, 1:4, 1:8, 1:16, and 1:32) of cDNAs from high-quality samples with good target genes expression. In this study, glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the reference gene to normalize samples.
Table 1
Primer sequences of COX-2, TNF-α, and the housekeeping genes
Primer
|
5’---3’
|
COX-2 forward
|
CAACCAGCAGTTCCAGTATCAGA
|
COX-2 reverse
|
CAAGGAGGATGGAGTTGTTGTAGAG
|
TNF-α forward
|
AAATGGGCTCCCTCTCATCAGTTC
|
TNF-α reverse
|
TCTGCTTGGTGGTTTGCTACGAC
|
GAPDH forward
|
CTACATGGCCTCCAAGGAGTAAG
|
GAPDH reverse
|
CCTCCTCTTCTTCGTCTATGGC
|
2.17 Statistical analysis
All data were presented as mean ± standard deviation (SD). One-way ANOVA followed by post hoc Tukey tests were used to assess differences between study groups. Moreover, for non-parametric analyses, such as histopathological evaluations, the Kruskal–Wallis and Mann–Whitney U tests were utilized. A probability level (p-value) of < 0.05 were considered statistically significant. Nevertheless, wherever applicable, other p-values are presented, i.e., p < 0.01, < 0.001, and < 0.0001. All statistical analyses were performed with the SPSS v. 26 software (IBM Inc., Chicago, IL, USA).