Animals
C57BL/6J male mice (11 weeks old) were obtained from the Experimental Animal Center of Xuzhou Medical University (SCXK_Su_2015-0009), and housed in environmentally controlled conditions (temperature 22°C, 12 hour light/dark cycle). After acclimatization to the laboratory conditions for 1 week, the mice were used for experiments in accordance with the Chinese Council on Animal Care Guidelines and approved by Institutional Animal Care Committee of Xuzhou Medical University.
Chronic β-glucan supplementation experiment and cocktail antibiotic administration
The mice were randomly divided into 3 groups (n = 15): (1) the control (Con) group were fed a grain-based rodent lab chow (LC, LabDiet 5010, 13.1% fat by energy, 15% neutral detergent fibre by weight), (2) the HFFD group were fed with a diet with high fat (55% by energy) and fibre deficient (50g/kg from cellulose, low accessibility by gut microbiota, 5% fibre by weight); (3) the β-glucan (HFBG) group were fed with oat β-glucan derived from OatWellTM oat bran (CreaNutrition, Switzerland) added into the HFFD diet (β-glucan 7% by weight, fibre content 14% by weight, detailed in Table S1). The dosage was according to our previous study [42] in which 7% oat β-glucan improved the regulation of the gut-hypothalamic (PYY3-36-Y2-NPY) axis. In addition, a fourth group (HFBG+AB, n=12) was run in parallel with antibiotics (ampicillin 1g/L, vancomycin 0.25g/L, neomycin 1g/L, and metronidazole 1g/L) added to their drinking water with water renewed every 3 days for 15 weeks [43]. Mice fed a HFFD diet showed increased body weight from week 4 onwards, increased body fat accumulation and liver weight, and glucose intolerance (Fig. S1A-E). β-glucan supplementation to some degree attenuated these metabolic disturbances. Two cognitive behaviour tests were performed after 15 weeks of intervention (described below). Three days following the last test, nine mice per group were sacrificed using CO2 asphyxiation. Blood, cecum content, colon, liver, fat (epididymal, inguinal and interscapular masses), and brain tissues were immediately collected for the investigations of mRNA (left hippocampus) and protein expression (right hippocampus). The rest mice (n=6 per group) were sacrificed by CO2 asphyxiation and then transcardially perfused with PBS and paraformaldehyde for hippocampal immunohistochemistry and electron microscopy studies.
Acute β-glucan supplementation experiment
Similar to the chronic β-glucan supplementation experiment, the mice were randomly divided into three groups (n = 10 per group): the Con group, HFFD group and HFBG group were respectively fed with the LC diet, HFFD diet and 7% oat β-glucan in the HFFD diet for 7 days. After performing two cognitive behaviour tests, the mice were sacrificed with collection of cecum content for 16S sequencing of gut microbiota.
Behavioral tests
The object location and nesting behavior tests were performed in order to examine dietary effects on recognition memory and spontaneous rodent behaviors. Tests were conducted as for previous studies [24, 44]. In the object location test, the place discrimination index was calculated by using the formula: the time spent with the object moved to a novel place/(the total time spent in exploring both the object moved to a novel place + the object remaining in the familiar place) × 100. For the nesting behavior test, the Deacon nest score and the untore nestlet weight was used to evaluate spontaneous rodent behaviour (ability of daily living).
Microbial DNA extraction, PCR amplification and Miseq sequencing in cecal contents
Genomic DNA amplification and sequencing were conducted as in our previous study [3]. Briefly, microbial DNA was extracted from cecal contents of mice using the E.Z.N.A. stool DNA Kit (Omega Bio-tek, Norcross, GA, U.S.) according to the manufacturer’s protocols. The 16S rDNA V3-V4 region of the Eukaryotic ribosomal RNA gene was amplified by PCR(95°C for 2 min, followed by 27 cycles at 98°C for 10 sec, 62°C for 30 sec, and 68°C for 30 sec; and a final extension at 68°C for 10 min)using primers 341F:CCTACGGGNGGCWGCAG; 806R:GGACTACHVGGGTATCTAAT, where the barcode is an eight-base sequence unique to each sample. PCR reactions were performed in triplicate 50 μL mixture containing 5 μL of 10 × KOD Buffer, 5 μL of 2.5 mM dNTPs, 1.5 μL of each primer (5 μM), 1 μL of KOD Polymerase, and 100 ng of template DNA Amplicons were extracted from 2% agarose gels and purified using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA, U.S.) according to the manufacturer’s instructions and quantified using QuantiFluor-ST (Promega, U.S.). Purified amplicons were pooled in equivalent molar and paired-end sequence (2 × 250) on an Illumina platform according to the standard protocols.
Measurement of serum cytokines
ELISA kits were used to measure TNF-α, IL-6 and IL-1β of serum according to the manufacturer’s instructions (Thermo Fisher, USA).
Lipopolysaccharide (LPS) determination
The concentration of circulating serum LPS was measured by enzyme-linked immunosorbent assay (Limulus assay kit, Cat.18110115, China). The absorbance was measured at 545 nm using a spectrophotometer, with measurable concentrations ranging from 0.1 to 1.0 EU/ml. All samples for LPS measurements were performed in duplicate.
Intraperitoneal glucose tolerance test (IPGTT)
The IPGTT was conducted as we have previously described [45]. Briefly mice were fasted overnight followed by an intraperitoneal injection of glucose (2g/kg). Blood samples were obtained from the tail vein at 0, 30, 60, 90 and 120 minutes following the injection of glucose. Blood glucose levels were measured with a glucose meter (Accu-Chek).
Thickness measurements of the colonic mucus layer
Post Carnoy’s fixation, the methanol-stored colon samples were embedded in paraffin, cut into thin sections (5μm) and deposited on glass slides. Alcian blue staining was performed by the protocols as previously published [46]. The thickness of the colonic sections was then measured (10 measurements per section/2 sections per animal/5 animals per group) using ImageJ after cross-validation using anti-MUC2 staining.
Bacteria localization by FISH Staining
The staining of bacteria localization at the surface of the intestinal mucosa was conducted as previously described [47]. Briefly, transverse colonic tissues full of fecal material were placed in methanol-Carnoy’s fixative solution (60% methanol, 30% chloroform, 10% glacial acetic acid) for a minimum of 3 h at room temperature. Tissues were then washed in methanol 2x 30 min, ethanol 2x 20 min, and xylene 2x 20 min and embedded in paraffin for 5 μm sections on glass slides. The tissue sections were dewaxed by preheating at 60°C for 10 min, followed by xylene 60°C for 10 min, xylene for 10 min and 100% ethanol for 10 minutes. Deparaffinized sections were incubated at 37°C overnight with EUB338 probe (5′-GCTGCCTCCCGTAGGAGT-3′) diluted to 10 μg/mL in hybridization buffer (20 mM Tris–HCl, pH 7.4, 0.9 M NaCl, 0.1% SDS, 20% formamide). After incubating with wash buffer (20 mM Tris–HCl, pH 7.4, 0.9 M NaCl) for 10 min and 3x 10 min in PBS sequentially, the slides were mounted in DAPI containing mounting medium.
Immunohistochemistry
MUC2 in the colon was detected by staining the colonic tissue sections (5μm) with anti-MUC2 antibody (Abclonal, A14659) diluted 1:500 in TBS, and goat-anti-rabbit Alexa 488 conjugated antibody (1:1000) (Invitrogen, A32731) in TBS. At a temperature of -18°C, 20µm frozen brain sections (hippocampus) were cut using a cryostat from Bregma-3.3 mm to - 4.16 mm according to a standard mouse brain atlas [48]. The brain slices were blocked with 10% goat normal serum for 15 min at room temperature and then incubated with the primary antibodies at 4 °C overnight. The primary antibody anti-Iba1 (Wako, 019–19741) and PSD-95(CST, 3450) were used. After washing with PBS, the sections were incubated with the secondary antibodies at 37 °C for 1 h. The secondary antibody Alexa Fluor® 594 (abcom 150160) and Alexa Fluor® 488 (ab150117) were used. Finally, the sections were counterstained with DAPI (Sigma, D9542). The morphology of microglia in the CA1, CA3 and DG of hippocampus was then imaged with microscope (OLYMPUS IX51). The hippocampal CA1 area in brain tissue sections were imaged by a Leica SP8 confocal microscope system equipped with a 63x oil immersion objective (Leica, Germany) by using identical light intensity and exposure settings in stacks (z-step 0.1 μm). The images of contact between microglia and postsynaptic structures in identical 60x image stacks from sections double-labeled for Iba1 and PSD95 were processed by LAS X software (Leica, Germany).
Quantitative RT-PCR
Total RNA was extracted from tissues homogenized in Trizol (Thermo Fisher Scientific, Waltham, MA, USA). One microgram of purified RNA was used for RT-PCR to generate cDNA with a High-Capacity cDNA Reverse Transcription Kit (Takara, Dalian, China), and the resulting cDNA was used for quantitative PCR on a real-time PCR detection system (Bio-Rad, Hercules, CA, USA). The relative mRNA expression level was determined with the 2-ΔΔCt method with GAPDH as the internal reference control. Primer sequences were as the following:
mTNFα--forward (F): CTTGTTGCCTCCTCTTTTGCTTA,
mTNFα--reverse (R): CTTTATTTCTCTCAATGACCCGTAG;
mIL-1β--forward (F): TGGGAAACAACAGTGGTCAGG,
mIL-1β--reverse (R): CTGCTCATTCACGAAAAGGGA;
mIL-6--forward (F): TCACAGAAGGAGTGGCTAAGGACC,
mIL-6--reverse (R): ACGCACTAGGTTTGCCGAGTAGAT;
mGAPDH--forward (F): AGAAGGTGGTGAAGCAGGCATC,
mGAPDH--reverse (R): CGAAGGTGGAAGAGTGGGAGTTG;
mReg3γ--forward (F): 5’TTCCTGTCCTCCATGATCAAA-3’,
mReg3γ--reverse (R): 5’CATCCACCTCTGTTGGGTTC-3.
Western blotting
Mouse colon and hippocampus were homogenized in ice-cold RIPA lysis buffer, supplemented with complete EDTA-free protease inhibitor cocktail and PhosSTOP Phosphatase Inhibitor. The homogenate was sonicated six times for 4 sec, at 6 sec intervals on ice and then centrifuged at 12,000 g for 20 min at 4 °C. The supernatant was collected and the protein concentration was quantitated by BCA assay. Equal amounts of protein were separated by sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto polyvinylidene difluoride (PVDF) membranes. The membrane was blocked with 5% non-fat milk at room temperature for 1 hr, and then incubated with the primary antibody at 4 °C overnight. These primary antibodies were included: anti-Occludin (Abcam, ab167161), anti-ZO1 (Abcam, ab96587), anti-p-IRS-1 (Ser307) (CST, 2381T ), anti-IRS-1 (CST, 2382S), anti-Iba1 (Wako, 019–19741), anti-p-GSK-3β(Ser9) (CST,9322S), anti-GSK-3-β (CST,12456T), anti-p-AKT(Ser473) (CST, 4060 T), anti-AKT (CST, 4691T), anti-Tau5 (Abcam, ab80579), anti-p-Tau (S202 + T205) (Abcam, ab80579), anti-Synaptophysin (Abcam, ab32127), anti-PSD95 (CST, 3450), anti-PTP1B (Abcam, ab189179), GAPDH (ABclonal, AC033) and β-Actin (ABclonal, AC026). Following 3 washes in TBST, the membrane was incubated with HRP inked anti-rabbit IgG secondary antibody (CST, 7074) or HRP-linked anti-mouse IgG secondary antibody (CST, 7076S) at room temperature for 1 h. After washing 3 times with TBST, the protein bands were detected with Clarity™ ECL Western Blot substrate (Bio-Rad, 1,705,060) and visualized using ChemiDoc Touch imaging system (Bio-Rad).
Transmission electron microscopy (TEM)
The left side of the hippocampal CA1 was taken and rapidly fixed in glutaraldehyde. After fixation for 24 h, the hippocampal tissues of control, HFFD, and HFBG mice were quickly dissected and separated into thin slices. They were fixed immediately with 2.5 % glutaraldehyde at 4 °C overnight. Washed 3 times in phosphate-buffered saline (PBS), these slices were fixed in 1 % osmium tetroxide, stained with 2 % aqueous solution of uranyl acetate, and then dehydrated with different concentrations of ethanol and acetone gradient. Finally they were embedded in epoxy resin. Ultra-thin sections (70 nm) were cut with ultramicrotome, collected on copper grids, and then stained with 4 % uranyl acetate and lead citrate. Synapses are classified into asymmetric and symmetric synapses, or Gray I type and Gray II type synapses, which are considered to mediate excitatory and inhibitory transmission respectively [49]. Asymmetric synapses have prominent post-synaptic densities and relatively wide synaptic clefts while symmetric synapses are with pre- and post-synaptic densities of equal thickness and narrower synaptic clefts. In the present study, asymmetric synapses were examined for excitatory synaptic measurement. The PSD thickness was evaluated as the length of a perpendicular line traced from the postsynaptic membrane to the most convex part of the synaptic complex. The widths of the synaptic clefts (SCs) were estimated by measuring the widest and narrowest portions of the synapse and then averaging these values.
Statistical analysis
Data were analyzed using the statistical package SPSS (Version 20, Chicago, USA). After data were tested for normality, the differences among the intervention groups were determined using one-way analysis of variance (ANOVA) followed by the post hoc Tukey-Kramer test. A p value of <0.05 was considered to be statistically significant. For 16S rRNA gene sequence analysis, all reads were deposited and grouped into operational taxonomic units (OTU) at a sequence identity of 97% [50], and the taxonomic affiliation of the OTUs was determined with quantitative insights into microbial ecology (QIIME, version 1.8.0) against the Greengenes database version 13.8 [51]. Based on Kyoto Encyclopedia of Genes and Genomes (KEGG) functional pathway, the predicted functional composition of the intestinal microbiome was inferred for each sample using Phylogenetic Investigation of Communities by Reconstruction of Unobserved States (PICRUSt) [52]. Statistical analyses were conducted with STAMP [53] and functional differences in orthologs among groups were assessed by a one-way ANOVA followed by post hoc Tukey-Kramer multiple comparisons.