WITHDRAWN: Effects of dietary Clostridium butyricum supplementation on growth performance, intestinal barrier function, immune response, and intestinal permeability in broiler chickens with necrotic enteritis

DOI: https://doi.org/10.21203/rs.3.rs-136871/v1

Abstract

Background

Necrotic enteritis (NE), which is caused by Clostridium perfringens (C. perfringens), is an economically important disease in broiler. Among normal flora in the broiler intestinal, Clostridium butyricum (C. butyricum) has been identified as a probiotic agent that reduces the susceptibility of broilers to C. perfringens. It also promotes the repair of broiler intestinal damage from harmful intestinal pathogens. However, the effects of C. butyricum infection on broiler intestinal integrity during NE are largely unknown. In this study, we investigated the effects of C. butyricum on the growth performance, intestinal morphology and barrier function, and the functions of immune-related cytokines under NE in broilers.

Results

Infected group (PC) showed significant decrease in the average daily gain (ADG, p < 0.01) and increase in feed conversion ratio (FCR, p < 0.01) compared with C. butyricum (NECB1 and NECB2) through dietary supplement. Supplementation of C. butyricum (NECB1 and NECB2) restored the intestinal villus height, increased the crypt depth, and reduced the intestinal damage under NE. Furthermore, broilers infected with NE (PC) had higher serum IgA and endotoxin content, and after addition with C. butyricum (NECB1 and NECB2) returned to normal level. In addition, compared with PC, supplementation of C. butyricum (NECB1 and NECB2) restored intestinal barrier function-related genes (such as CLDN-1, CLDN-3, OCLN, MUC2, ZO-1, and CLDN5), cytokines (such as TNF-α, IL-10, IL-6, and TGFB1) and C. perfringens plc gene expression. Moreover, C. butyricum (NECB1 and NECB2) could restore the decrease in Gt (p < 0.01) and Isc caused by NE (PC). In addition, NECB2 reduced the upregulation of FD4 flux caused by NE infection (p < 0.01).

Conclusion

Dietary supplementation of C. butyricum into broilers with NE improved chicken growth performance, intestinal morphology, intestinal barrier function, and immune function. Notably, no statistical difference was observed with the addition of C. butyricum at different time points.

Background

Necrotic enteritis (NE) in broilers is caused by the strains of Clostridium perfringens (C. perfringens) type A or C and is sometimes accompanied by co-infection with Eimeria maxima (E. maxima) [26]. Clinically, broiler NE caused by C. perfringens is mainly characterized by mucosal necrosis of the small intestine. After the onset of the disease, the intestinal wall becomes thin and brittle, resulting in intestinal bleeding. In some severe cases, the intestinal cavity is filled with blood. Acute cases of NE in broilers are marked with diarrhea, anorexia, plumage of feathers, depression, bloody stools, and coal tar feces, resulting in yolk pedicle contraction, intestinal fibrosis and necrosis. Broilers with NE may also develop subclinical disease, with mild or no symptoms of diarrhea, and gradually progress to chronic wasting. Although the mortality caused by NE in broilers with subclinical symptoms is not high, the NE in broilers results in severe economic losses to the poultry industry. This disease does not only increase the mortality of the flock but also reduces the feed conversion rate directly caused by the severe damage to the broiler intestine, delays the time to slaughter, and cause considerable economic losses in the poultry industry globally [9].

The use antibacterial growth agents in feeds and anticoccidial drugs are important in the control of poultry diseases. However, the widespread use of antimicrobials has also led to bacterial resistance and subsequently to restrictions or prohibitions on the use of antibiotics in various countries around the world. Since the EU started to completely ban antibiotic growth promoters in 2006 [11], the incidence and prevalence of NE have increased significantly [35]. Moreover, the use of vaccines against coccidiosis caused the incidence of C. perfringens-associated enteritis to increase yearly and has become a problem equal to coccidiosis. Hence, alternatives to antibiotics, such as probiotics, have received great attention in improving the broiler industry.

Probiotics can be used as growth promoters and, in some cases, can be used to control intestinal pathogens [47]. Moreover, probiotics can maintain normal intestinal function, regulate innate immunity and adaptive immunity, and the epithelial barrier function [8, 15, 37].

Some probiotics have beneficial effects on broilers with NE, such as Lactobacillus acidophilus [22]and Bacillus coagulans [38]. Among known probiotics is Clostridium butyricum (C. butyricum), is a gram-positive anaerobic bacillus isolated from the intestines of healthy humans and animals. It can produce short-chain fatty acids, such as butyric acid and lactic acid [25]. C. butyricum, as a microecological agent, has many functions in animal breeding, such as regulating animal intestinal health. C. butyricum promotes the growth performance and immune function of broilers, and it is beneficial to the balance of intestinal microbes in broilers [41]. Zhang showed that the dietary supplementation of C. butyricum is beneficial to the maintenance of the intestinal barrier [46]. Kong and his colleagues have also showed that C. butyricum can induce more short-chain fatty acids such as acetic and butyric acids in the digestive tract, thus promoting the growth of beneficial bacteria and inhibiting some pathogenic bacteria, such as C. perfringens growth [19]. The butyric acid produced by C. butyricum plays an important role in the nutritional properties of epithelial cells and the inhibitory effect on pathogens in the intestine [23]. Butyric acid can also produce antibacterial peptides to strengthen the intestinal defense barrier [21]. Butyric acid can also affect tight junction expression and epithelial cell proliferation to maintain the structure of villus and intestinal integrity [10, 34]. Lastly, butyric acid has an anticoccidial effect [21].

C. butyricum is a potent antibiotic substitute and an effective probiotic in livestock and poultry breeding. However, C. butyricum affects broilers with C. perfringens-induced NE. Therefore, we evaluated the biological effects of C. butyricum on C. perfringens-infected broilers in terms of growth performance, secretion of serum IgA and endotoxin, intestinal barrier function, and immune-related gene expression and FD4 flux. We showed the effect of C. butyricum on controlling NE infection in broilers.

Methods

Experimental design, birds and diet

Coccidia and C. perfringens free 1-day-old Ling-nan yellow-feathered broilers (Xinxisheng Biotechnology, China) were raised in the animal house of Lanzhou Institute of Veterinary Medicine, Chinese Academy of Agricultural Sciences (LVRI, CAAS). E. maxima (E.max, GD strain) and C. perfringens isolated from NC broilers in China (Cp-Ch-SC-2014) were preserved by the pig and poultry mucosal immunity team of the LVRI, CAAS. E. max was passaged in coccidia-free, 2-week-old yellow-feathered broilers before use. C. perfringens was resuscitated in FT liquid medium (with 0.5% D-cycloserine) and cultured in an anaerobic culture system (Whitley DG250, UK) at 37 °C for 18 h. Then, the concentration of C. perfringens was adjusted to 5⋅108 CFU/mL. C. butyricum (Baifude Biotechnology, China) was added to the basal diet (Table 1). The animals were divided into five groups, each with 10 broilers, including the negative control group (NC), C. butyricum group (CB), positive control group (PC), NE broilers fed with C. butyricum group 1 (NECB1), and NE broilers fed with C. butyricum group 2 (NECB2). The daily feeding of broilers and experimental infections in each group is described in Table 2. The infected groups (NC, NECB1, and NECB2) were orally fed with 3⋅104 E. max sporulated oocysts in 1 mL of suspension at day 14. In addition, the animals were orally inoculated thrice a day for 3 days with 5⋅108 CFU/mL of C. perfringens at days 18, 19, and 20. The uninfected groups (NC and CB) received the same amount of sterile saline at the corresponding times [40].

Table 1

Composition of basal diet

Composition

Dosage

Corn

612.4449

Soybean meal 43

190.0000

Cotton meal 50

70.0000

Corn cluten Meal 60

55.0000

Bran

25.0000

Dicalcium phosphate

17.0000

Stone powder

12.0000

Soybean Oil

5.0000

L-Lysine sulfate (70%)

4.4000

Sodium chloride

3.0000

999 Meat and poultry trace element premix

2.0000

DL-Methionine (98.5%)

1.4000

Choline chloride (60%)

1.0000

L-Threonine (98.5%)

0.7000

25%Tryptophan

0.5000

RJ-dv1301 Poultry, rare birds for livelihood

0.3500

Enramycin premix (8%)

0.1250

Homotropin (mannanase)

0.0800

Flavomycin premix (8%)

  

Chlortetracycline premix (25%)

  
 

1,000.000

Table 2

Experimental design

Group

C. butyricum

Infectious dose

NC

/

/

CB

2⋅108 CFU/g (D1-D22)

/

PC

/

3⋅104 E. max and 5⋅108 CFU/mL C. perfringens

NECB1

2⋅108 CFU/g (D14-D22)

3⋅104 E. max and 5⋅108 CFU/mL C. perfringens

NECB2

2⋅108 CFU/g (D1-D22)

3⋅104 E. max and 5⋅108 CFU/mL C. perfringens

Growth performance and sample collection

The broiler body weight (BW) and feed weight, average daily gain (ADG), average daily feed intake (ADFI), and feed conversion ratio (FCR) were recorded on days 1, 13, and 22. Blood samples were collected from broilers in each group on day 22. The blood samples were incubated for 1 h at 37 °C and then at 4 °C for 10 h. Serum was isolated by centrifugation at 8,000 rpm for 10 min and stored at − 80 °C. After the broilers were sacrificed, the abdominal cavity was opened, the intestines were separated, and the intestinal contents were quick-frozen in liquid nitrogen and stored at − 80 °C. The small intestine tissues were sectioned 2 cm in front of the yolk pedicle for RNA and protein extraction. The small intestine tissue sections for RNA extraction and protein were quick-frozen in liquid nitrogen and stored at − 80 °C. The sectioned tissues were placed in tubes and stored in 4% paraformaldehyde at 4 °C for histological examination. We prepared and used immediately 1 cm length of small intestine tissue near the yolk pedicle for Ussing chamber experiment.

Intestinal histomorphology

The small intestine samples were fixed with 4% paraformaldehyde and then dehydrated (Wuhan Junjie Electronics, China), paraffin embedded (Wuhan Junjie Electronics, China), sectioned using microtome (Leica DM2016, Germany) to paraffin sections (4 µM), and fixed on the glass slide. The slices were stained with hematoxylin-eosin (HE, Servicebio, China) and then scanned with a panoramic slice scanner (3DHistech, Hungary). The height of villus and depth of crypts were measured.

Serum immunoglobulin A (IgA) assay

The broiler immunoglobulin A (IgA) enzyme-linked immunoassay kit (Cusabio, China) was used to determine the serum IgA. The absorbance was measured at 450 nm wavelength with a microplate reader (SpectraMax M5, Molecular Devices, USA) within 5 min after the reaction was terminated. After obtaining the absorbance value, a standard curve was generated to calculate the IgA concentration fold change.

Serum endotoxin assay

The endotoxin detection Tachypleus Amebocyte Lysate kit (Xiamen Bioendo Technology, China) was used to detect endotoxin in serum. The absorbance value was measured at 405 nm, and a standard curve was generated to calculate the endotoxin concentration.

Intestinal C. perfringens Enumeration

Broiler intestinal content genome was extracted using the stool genome extraction kit (Mobio12888, Qiagen, Germany). The obtained DNA was used as the template, bacterial 16 s rDNA was used as the house-keeping gene, and C. perfringens alpha- toxin coding gene, plc, was used as the target gene (Table 3). The reactions were contained 10 µL of ChamQ SYBR qPCR Master Mix (Q311-02, Vazyme, China), 1 µL of forward primer, 1 µL of reverse primer, and 2 µL of DNA with a total reaction volume of 20 µL. Real-time fluorescence quantitative PCR instrument (CFX96TM, Bio-Rad, USA) was used. The amplification program was set as follows: pre-denaturation at 95 °C for 30 s, denaturation at 95 °C for 10 s, annealing at 59 °C for 30 s, and melting curve after 40 cycles. The Ct value 2-ΔΔCt was calculated to analyze the relative expression difference.

Table 3

Quantitative real-time PCR primer sequences

Gene

Forward primer

Reverse primer

Genbank accession number

GAPDH

CACGCCATCACTATCTTC

GACTCCACAACATACTCAG

NM_204305.1

CLDN-1

GTGTGTTTGTTGCTGTGA

ACTCTGTTGCCATACCAT

NM_001013611.2

CLDN-3

GTCATCTTCCTGCTCTCC

AGCGGGTTGTAGAAATCC

NM_204202.1

CLDN-5

ACCATCTACATCCTCTGC

GTCGTAGAAGTCGCTGAT

NM_204201.1

OCLN

CCAGCGGTTACTACTACA

CAGGATGACGATGAGGAA

NM_205128.1

MUC-2

TTACCACCATAGTTACCACAA

CACTCAGACCAATCACAGA

NM_001318434.1

ZO-1

ATGAATGAAGGATGGTATGG

GATGTATGTCTGCTGTCTG

XM_015278981.2

IL-6

CTCCTCGCCAATCTGAAG

CTCACGGTCTTCTCCATAA

NM_204628.1

IL-10

GCCATCAAGCAGATCAAG

CTTCCTCCTCCTCATCAG

NM_001004414.2

TGFB1

CGGATGAGAAGAACTGCT

CCTTTGGGTTCGTGGATC

NM_001318456.1

TNF-α

AGCCTATGCCAACAAGTA

GGTCATAGAACAGCACTAC

NM_204267.1

16 s rDNA

GTGCTACAATGGCTGGTA

CTACAATCCGAACTGAGACT

NR_121697.2

plc

AGTCTACGCTTGGGATGGAA

GTGATTCCCCTGTGTCAGGT

AY823400.1

RNA extraction and cDNA synthesis

RNA extraction was performed using TRIzol (ThermoFisher, USA) following manufacturer’s instruction. Total RNA concentration was measured using NanoPhotometer NP80 (Implen, Germany) and reverse transcribed to cDNA using the Prime Script RT reagent kit (RR047A, Takara, Japan) as described in the manual. The obtained cDNA was stored in a refrigerator at − 20 °C.

Real-time PCR

Primers for real-time PCR were designed in accordance with the principles of real-time PCR primer design, as shown in Table 3, by following the instructions of the fluorescence quantitative kit (RR820A, Takara, Japan). The real-time PCR reaction tube contained 1 µL of forward or reverse primers, 1 µL of template DNA, 10 µL of TB Green enzyme, and water, with a total volume of 20 µL, and the mixture was thoroughly mixed. The reaction program was as follows: pre-denaturation at 95 °C for 5 min, denaturation at 95 °C for 30 s, and annealing at 59 °C for 30 s. Forty cycles were performed, and the melting curve was inserted. The Ct value obtained from 2− ΔΔCt was used to analyze the relative expression difference.

Western blot

Total protein was extracted according to the procedure for RIPA lysis buffer (P0013B, Beyotime, China). The total protein concentration was measured using the BCA kit (T9300A, Taraka, Japan). Protein was resolved on 12% SDS-PAGE gel and transferred to a polyvinylidene difluoride membrane (Merck Millipore, Germany). Skimmed milk powder (5%) at room temperature was used to seal the membrane and then incubated with the primary antibody consisting of GAPDH 1:10,000 (Proteintech, USA), CLDN-1 1:125 (ThermoFisher, USA), OCLN 1:125 (ThermoFisher, USA), C. perfringens plc 1:500 (Bioss, China) overnight at 4 °C. This process was followed by incubation using the secondary antibody (Qiyan Biotech, China) for 1 h at room temperature. After exposure to ECL chemiluminescent kit (Merck Millipore), the film obtained was scanned for protein band and analyzed using the ImageJ software.

Ussing chamber experiment

With the salt bridge in place, the sample holder was empty as required, and 5 mL of Krebs-Henselet (K-H) solution containing 117 mM NaCl, 4.7 mM KCl, 1.2 mM MgSO4·7H2O, 1.2 mM KH2PO4, 2.418 mM NaHCO3, 11.1 mM GluCose, and 2.56 mM CaCl2 was added to each chamber, with passage of oxygen to set the resistance and voltage to at zero and turned on the VCC MC6 (Physiologic Instruments, USA). After debugging the instrument, the K-H solution was eliminated, the sample holder was removed, and the broiler was sacrificed by the dislocation of neck bones to excise at approximately 1 cm of intestine tissue (yolk pedicle), which was immediately supply oxygen (95% O2 and 5% CO2) 4 °C and pre-cooled K-H solution after longitudinal cut. The tissue was fixed in a 0.3 cm3 sample holder and filled with 5 mL of K-H solution, and the sample holder was reinstalled. The values of the changes in short-circuit current value (Isc) and conductivity value (Gt) were recorded for 20 min, and when the curve was in a stable state, 100 µL of Fluorescein isothiocyanate-dextran (FD4) solution was added to the mucosal side, while 100 µL of liquid was aspirated from the serosal side after 30 min. Lastly, 100 µL of K-H solution was added, and a microplate reader was used to record the value of the excitation wavelength at 490 nm and emission wavelength at 520 nm.

Statistical analysis

Weight gain, feed intake, villus height, crypt depth, and Ussing chamber experimental data use aov function in the R package to perform two-way ANOVA and calculate p value. GraphPad Prism software was used for Tukey multiple comparisons and the generation of graphs. One-way ANOVA was used to analyze other data, and graphs were generated using the GraphPad Prism software.

Result

Growth performance

The growth performance of broilers was evaluated by the analysis of AGD, ADFI, and FCR value. At 14–22 days, the decrease of AGD and AFDI caused by NE was improved by the supplementation of C. butyricum (NECB1 and NECB2) (Fig. 1B). And the increase of FCR in NE broilers were significantly inhibited (p < 0.01) at 14–22 days by supplementation C. butyricum (NECB1 and NECB2) compared with the PC group (Fig. 1A and C).These results suggest that the supplementation of C. butyricum could significantly improve the growth performance of broilers with NE.

Histopathological observation

The pathological section results are shown in Fig. 2A. Among group NC, the structure of the mucosal layer of the small intestine tissue was intact, the intestinal glands were abundant in number and arranged tightly, and the epithelial cells were normal.

In group CB, abundant intestinal villus was observed, mucosal epithelium was intact, more intestinal villus were fused, and lamina propria capillaries were mildly congested (yellow arrow). The number of intestinal villus in group PC was abundant, but the epithelial cells of intestinal villus fell off, and the lamina propria was exposed. More inflammatory cell infiltration was observed in the intestinal gland epithelium (red arrow) with mild congestion of lamina propria capillaries (yellow arrow). Diffuse lymphoid tissue (green arrow), pyknosis of the nucleus of the mucosal muscle layer, and eosinophilic cytoplasm (blue arrow) increased. Group NECB1 was similar to group NECB2 with shorter intestinal villus, more intestinal villus fused, and a small amount of inflammatory cell infiltration in the intestinal gland epithelium (red arrow). A few round cavities were observed in the mucosal layer (purple arrow), swelling of mucosal muscularis cells, loose cytoplasm or vacuole (blue arrow).

With the use of Caseviewer software, villus height, crypt depth, and their ratios (Fig. 2B and C) showed that NE infection (PC) and C. butyricum addition (CB) had a significant interaction on villus height and crypt depth (p < 0.01, p < 0.05). However, compared with NC after NE infection, villus height decreased significantly, and crypt depth increased. Broilers supplemented with C. butyricum showed an inhibited decrease of villus height and increase of crypt depth caused by NE infection, but no significant difference was observed. The crypt height to villus depth ratio is shown in Fig. 2C. A significant interaction (p < 0.05) was observed on the ratio between NE infection (PC) and C. butyrcium supplementation (CB). However, supplementing C. butyricum (NECB1 and NECB2) reinforced the declination of villus height/crypt depth ratio caused by NE infection (PC), but no significant difference was observed.

Serum IgA and endotoxin content

Serum IgA and endotoxin levels are shown in Figs. 3A and B. In comparison with NC after NE infection (PC), serum IgA increased. However, supplementation of C. butyricum (NECB1 and NECB2) reduced serum IgA level caused by NE infection (PC). Similarly, serum endotoxin content was higher in PC compared with NC. Moreover, C. butyricum supplementation inhibited the upsurge in endotoxin content caused by NE (PC), but no significant difference was observed.

Intestinal barrier function-related genes, C. perfringens plc gene, and protein expression

The results of tight junction and C. perfringens plc mRNA expression are shown in Figs. 4A–G). In comparison with NC after NE infection (PC), CLDN-1, CLDN-3, MUC-2, OCLN, and ZO-1 mRNA expression decreased, while CLDN-5 and plc increased, wherein the expression of MUC-2 and OCLN decreased significantly (p < 0.05), the expression of CLDN-1 and ZO-1 significantly decreased (p < 0.01), and the expression of plc significantly increased (p < 0.05). Furthermore, compared with NC, supplement C. butyricum (CB) increased the expression of CLDN-1, CLDN-3, MUC-2, OCLN, and ZO-1 and decreased the expression of CLDN-5, but no significant difference was observed. In addition, C. butyricum supplement in NECB1 and NECB2 restored CLDN-1, CLDN-3, MUC-2, OCLN, ZO-1, CLDN-5, and plc expression of caused by NE infection.

Western blot results (Fig. 5) showed that in PC, the expression of CLDN-1 and OCLN significantly decreased (p < 0.01) and increased the expression of plc. The addition of C. butyricum (CB) significantly increased the expression of CLDN-1 and OCLN compared with NC. Also, the addition of C. butyricum in NECB1 and NECB2 restored the expression of CLDN-1, OCLN and plc caused by NE infection.

Immune-related cytokines and growth-related factor gene expression

NE infection (PC) increased TGFB1 and immune-related factors, such as IL-10, IL-6, and TNF-α, compared with NC. However, supplementation of C. butyrcium (NECB1 and NECB2) alleviated the upregulation of TGFB1, IL-10, IL-6, and TNF-α caused by NE infection (PC), but no significant difference was observed in the increase between the NECB1 and NECB2 groups (Fig. 6).

Ussing chamber

In comparison with NC, Gt decreased after NE infection (PC). The addition of C. butyricum prevented the usual decrease in Gt caused by NE, especially in NECB2, where Gt significantly increased (p < 0.01). The Isc of PC also decreased, and supplement C. butyricum (NECB1 and NECB2) could alleviate the decrease of Isc caused by NE. In this case, no statistical difference was observed (NECB1 and NECB2, Fig. 7A). Furthermore, the flux of FD4 in PC increased, and C. butyricum addition in NECB2 could significantly inhibit the increase of FD4 flux caused by NE infection (p < 0.01). The level of expression of FD4 and OCLN was inversely proportional. Moreover, a significant interaction was observed between C. butyricum (CB) and NE infection (PC) in the protein expression level of OCLN (Fig. 7B).

Discussion

NE in broilers is caused by C. perfringens type A or C, which shows necrotic lesions in the broilers intestinal mucosa, thus reducing the feed conversion rate and causing serious economic losses in the broiler industry. C. butyricum, as a probiotic, can maintain the growth performance of broilers [21]. The supplement of C. butyricum in feed can promote growth performance and increase feed utilization [41, 45]. In this study, AGD decreased and FCR increased significantly after NE infection. After supplementation, C. butyricum could inhibit the decrease of AGD and the increase of FCR caused by C. perfringens-induced NE, thus confirming previous results.

The intestinal tissue morphology, villus height, and crypt depth are important indicators for the measurement of intestinal health, injury, and recovery. The nutrient absorption in the intestine increased with the increase of intestinal epithelial transport and the height of villus [28]. Dietary supplementation with probiotics such as Lactobacillus acidophilus and C. butyricum enhanced the restoration of intestinal morphology, the increase of villus height, and the decrease of crypt depth [7, 22, 46]. In this study, the NE broilers showed severe hemorrhage in the small intestinal tissue, proliferation of inflammatory cells, shorting of villus, and increase of crypt depth. By comparison, all the selected indices were clearly improved in the broilers fed with C. butyricum supplemented diet, suggesting that C. butyricum was beneficial to NE broilers to maintain the intestinal function.

IgA is the main component of the intestinal mucosal barrier and plays a role in intestinal protection. Previous studies have reported that C. butyricum can lead to reduction serum IgA after the Escherichia coli K88 infection [45]. Moreover, C. butyricum can promote the secretion of IgA in broilers [41, 42]. In the present study, we have shown that C. butyricum can inhibit the secretion of the IgA caused by NE infection (NECB1 and NECB2), thus supporting Huang’s results [18]. These results show that C. butyricum plays a role in intestinal mucosal immune protection after pathogen infection.

The endotoxin produced by LPS is related to tight junction proteins and intestinal permeability [16, 31], and it is an indicator for evaluating the integrity and function of the intestinal barrier [22]. Our results showed that the serum endotoxin was increased in NE broilers but was not increased in NE broilers fed with C. butyricum added diet, suggesting that C. butyricum aided in the maintenance of the intestinal function in NE broilers. These results are consistent with previous reports [22, 46].

Tight junction proteins are very important for the integrity and function of the epithelial barrier. They maintain the diffusion barrier and seal the intercellular space. OCLN is a TJ protein that acts as an adhesion molecule between cells to maintain and regulate the barrier function of TJs. CLDNs also play important role in regulating cellular signal transduction and paracellular transport in the intestinal epithelium [20]. ZO proteins are located on the surface of the inner cytoplasmic membrane. ZO-1 is important, because it connects TJ proteins and the actin backbone [24]. Alpha-toxin of C. perfringens can damage the intestinal mucosal barrier [27], and the expression of TJ proteins such as CLDN-1, CLDN-3, OCLN, and ZO-1 after NE decreased to varying degrees compared with the control group [33, 39, 44]. NE leads to mRNA expression increase in the pore-forming TJ protein CLDN-2 [44].Similar to CLDN-2, CLDN-5 is a pore-forming protein. In the present study, we observed that CLDN-5 increased with C. perfringens-induced NE but with supplementation of C. butyricum, the mRNA expression of CLDN-5 decreased. This showed that the addition of C. butyricum removed the decreasing tendencies of CLDN-1, CLDN-3, OCLN, and ZO-1 expression because of NE, thus confirming the results of previous studies [18, 33]. MUCs interact with IgA and various growth factors to maintain the relatively stable intestinal environment [14]. MUCs have potential binding sites for pathogenic microorganisms and colonization of some bacteria could induce MUCs expression change [36]. After broilers develop NE, the expression of MUCs such as MUC2 and MUC5AC changed [13, 38]. Butyric acid could increase the mRNA expression of MUC2 inhibited by NE [33]. Our data are in agreement with these results. Furthermore, MUCs could provide nutrition for the proliferation of C. perfringens [4]. Although C. perfringens may be present in the normal flora of healthy broilers but it is generally believed that a large number of C. perfringens proliferate in the intestinal tract, causing NE in chickens. In healthy birds, C. perfringens is present in the range of 102–104 CFU/g intestinal contents, but in NE, the concentration of C. perfringens increased to 107–109 CFU/g [32]. In our result, the C. perfringens plc increased as a result of NE, but the supplementation of probiotic inhibited the increase in plc expression. Similar results were reported by Xu [40] and Huang [18]. This finding indicates that C. butyricum can reduce the proliferation rate of C. perfringens and intestinal barrier damage caused by NE.

Cytokines regulate cell growth and immune response and participate in inflammatory response. Among these cytokines, TGFB1 is related to mucosal immune tolerance. IL-10 is mainly secreted by T cells and is an important anti-inflammatory cytokine, and IL-10 has a barrier protective effect [30]. TNF-α is a key regulator of inflammation. IL-6 is an effective pro-inflammatory cytokine of Th1 cells, mainly secreted by intestinal epithelial cells [1]. We observed that at the instance of NE, the expression of anti-inflammatory factors TGFB1, IL-10, and pro-inflammatory cytokines TNF-α and IL-6 increased. However, supplementation of C. butyricum lowered the upregulation of TGFB1, IL-10, IL-6, and TNF-α observed in NE infection. Our findings support the increase in cytokine secretion after the addition of probiotics or food additives that can reduce inflammation after pathogens infection in broilers and pigs [6, 7, 12, 43]. This result shows that an increase of immune factors caused by NE owing to C. perfringens stimulates the inflammatory immune response in the intestine.

Ussing chamber is a useful tool for detecting the changes in the current and resistance of epithelial tissue by using electrodes to assess the integrity of the intestinal epithelial barrier. Evidence has been presented that after supplementing probiotic Yeast Saccharomyces boulardii in pig for 8 days, Gt remained unchanged, while Isc decreased, but Isc recovered after 16 days [29]. Gt (tissue conductance) is a sign of tissue integrity, while Isc (short-circuit current) is a sign of net ion migration activity in the intestine, and the decrease of Gt and Isc indicates the closure of ion channels [28]. Previous work had reported that after broilers were infected with Salmonella or Campylobacter, Gt decreased because of the closure of ion channels, and the decrease of Gt was related to the decrease of net charge transfer of epithelial cells and the decrease in Isc [2, 3]. Hence, the intestinal function of livestock and poultry is improved by probiotics. In the present study, Ussing chamber analysis showed that Gt and Isc were significantly decreased in NE broilers, suggesting that the integrity of the intestinal epithelial barrier declined. Interestingly, the supplementation of C. butyricum could reverse the decrease in the values of Isc and Gt, signifying that C. butyricum can potentially maintain the integrity of the intestinal epithelial barrier in NE broilers. These results were in accordance with the expression patterns of CLDN-1, MUC-2, OCLN, and ZO-1 as indicated by real-time PCR assay. However, the addition of organic acids dose had no effect on the intestinal barrier [28]. The differential values of Gt and Isc in this study maybe caused by the different dosages of C. butyricum. The flux of FD4 between the intestinal epithelium mainly occurred through the cell bypass pathway. The increased flux of FD4 reflects the increased paracellular permeability and impaired intestinal barrier, which is inversely proportional to OCLN expression level [5, 17, 44]. In the present study, when NE was induced by the C. perfringens infection, the flux of FD4 on the mucosal side increased, whereas the expression of OCLN decreased, indicating that the permeability of the intestine was increased, that is, the intestinal barrier was damaged. The addition of food additives such as L-arginine can inhibit the increase of FD4 flux caused by NE [44]. In the present study, the addition of C. butyricum showed the same result, indicating that C. butyricum can promote and maintain intestinal permeability of broilers.

Conclusion

This study showed that C. butyricum effectively improved AGD and increased the AFDI in NE broilers. Furthermore, the supplementation of C. butyricum significantly reduced the colonization of C. perfringens and improved the intestinal barrier function and permeability, thus improving the AGD and AFDI in NE broilers. The use of probiotic C. butyricum as feed supplement aided broiler growth performance, maintenance, and repair of intestinal after NE. No significant difference was observed in the supplementation of C. butyricum at different time points. In summary, C. butyricum enhances broiler health and can serve as antibiotic substitute in the prevention and treatment of NE in broilers.

Abbreviations

ADFI: Average daily feed intake; ADG: Average daily gain; CFU: Colony-forming unit; CLDN-1: Claudin-1; CLDN-3: Claudin-3; CLDN-5: Claudin-5; EU: Endotoxin Unit; FCR: Feed conversion ratio; FD4: Fluorescein isothiocyanate-dextran; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; Gt: Conductivity value; IL-10: Interleukin 10; IL-6: Interleukin6; Isc: Short-circuit current; MUC-2: Mucin-2; OCLN: Occludin; plc: Phospholipase C; TGFB1: Transforming growth factor beta 1; TNF-a: Tumor necrosis factor alpha; ZO-1: Zonula Occluden-1

Declarations

Authors’ contributions

Jianping Cai and Xiao Xu designed the experiments. Xiao Xu performed the experiments. Shunli Yang provided Ussing Chamber mothed, Zhenxing Gong and Zigang Qu provided E. maxima oocyst (Guangdong strain). Jing Wang, Yanbing Zhang, Heng Wang, Ling Xiong and Kun Zhang participated in the animal experiments. Xiao Xu wrote the manuscript. Shunli Yang, Joshua Seun Olajide, Jianping Cai and Enmin Zhou revised the manuscript. All authors approved the final version of the manuscript.

Funding

Key Technologies Research and Development Program (Key Technologies R&D Program) 2087YFD050040320, and the Innovative Special Project of Agricultural Science and Technology (Grant No. CAAS-ASTIP-2014-LVRI-09).

Availability of data and materials

All data generated or analyzed during this study can be made available from the corresponding author upon reasonable request.

Ethics approval

All animal experiments and experimental procedures were approved by the State Key Laboratory of Veterinary Etiological Biology, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, China.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no conflict of interest.

Author details

1State Key Laboratory of Veterinary Etiological Biology, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou, China. 2Department of Preventive Veterinary Medicine, College of Veterinary Medicine, Northwest A&F University, Yangling, China. 3JiangSu Co-Innovation Center for Prevention and Control of Animal Infectious Disease and Zoonoses, Yangzhou, China.

References

  1. Al-Sadi R, Boivin M, Ma T. Mechanism of cytokine modulation of epithelial tight junction barrier. Front Biosci (Landmark Ed). 2009;14(1):2756-78.
  2. Awad WA, Aschenbach JR, Khayal B, Hess C, Hess M. Intestinal epithelial responses to Salmonella enterica serovar Enteritidis: effects on intestinal permeability and ion transport. Poult Sci. 2012;91(11):2949-57.
  3. Awad WA, Molnar A, Aschenbach JR, Ghareeb K, Khayal B, Hess C et al. Campylobacter infection in chickens modulates the intestinal epithelial barrier function. Innate Immun. 2015;21(2):151.
  4. Bart D, Olivier V, Deshanie G, Donovan SM, Mackie RI, Rex GH. Selective growth of mucolytic bacteria including Clostridium perfringens in a neonatal piglet model of total parenteral nutrition. Am J Clin Nutr. 2002;76(5):1117-25.
  5. Cani PD, Possemiers S, Van de Wiele T, Guiot Y, Everard A, Rottier O et al. Changes in gut microbiota control inflammation in obese mice through a mechanism involving GLP-2-driven improvement of gut permeability. Gut. 2009;58(8):1091-103.
  6. Cao G, Tao F, Hu Y, Li Z, Zhang Y, Deng B et al. Positive effects of a Clostridium butyricum-based compound probiotic on growth performance, immune responses, intestinal morphology, hypothalamic neurotransmitters, and colonic microbiota in weaned piglets. Food Funct. 2019;10(5):2926-34.
  7. Chen L, Li S, Zheng J, Li W, Jiang X, Zhao X et al. Effects of dietary Clostridium butyricum supplementation on growth performance, intestinal development, and immune response of weaned piglets challenged with lipopolysaccharide. J Anim Sci Biotechno. 2018;9(23):62.
  8. Choct M. Managing gut health through nutrition. Brit Poultry Sci. 2009;50(1):9-15.
  9. Cooper KK, Songer JG. Necrotic enteritis in chickens: a paradigm of enteric infection by Clostridium perfringens type A. Anaerobe. 2009;15(1-2):55-60.
  10. Eeckhaut V, Van Immerseel F, Croubels S, De Baere S, Haesebrouck F, Ducatelle R et al. Butyrate production in phylogenetically diverse Firmicutes isolated from the chicken caecum. Microb Biotechnol. 2011;4(4):503-12.
  11. EU. 2003. Commission of the European of European Communities, Commission Regulation (EU) No.1831/2003, Official Journal of European Union L 268, 29-43.
  12. Fasina YO, Lillehoj HS. Characterization of intestinal immune response to Clostridium perfringens infection in broiler chickens. Poult Sci. 2019;98(1):188-98.
  13. Forder REA, Nattrass GS, Geier MS, Hughes RJ, Hynd PI. Quantitative analyses of genes associated with mucin synthesis of broiler chickens with induced necrotic enteritis. Poult Sci. 2012;91(6):1335-41.
  14. Fukuda M. Roles of mucin-type O-glycans in cell adhesion. Biochim Biophys Acta. 2002;1573(3):394-405.
  15. Gaggìa F, Mattarelli P, Biavati B. Probiotics and prebiotics in animal feeding for safe food production. Int J Food Microbiol. 2010;141(supp-S):S15-28.
  16. Gilani S, Howarth GS, Kitessa SM, Forder REA, Tran CD, Hughes RJ. New biomarkers for intestinal permeability induced by lipopolysaccharide in chickens. Anim Prod Sci. 2016;56:1984-97.
  17. Hu CH, Xiao K, Luan ZS, Song J. Early weaning increases intestinal permeability, alters expression of cytokine and tight junction proteins, and activates mitogen-activated protein kinases in pigs. Journal of Animal ence. 2013;91(3):1094-101.
  18. Huang T, Peng X, Gao B, Wei Q, Xiang R, Yuan M et al. The Effect of Clostridium butyricum on Gut Microbiota,Immune Response and Intestinal Barrier Function During the Development of Necrotic Enteritis in Chickens. Front Microbiol. 2019;10(11):2309.
  19. Kong Q, He GQ, Jia JL, Zhu QL, Hui R. Oral Administration of Clostridium butyricum for Modulating Gastrointestinal Microflora in Mice. Curr Microbiol. 2011;62(2):512.
  20. Krause G, Winkler L, Mueller SL, Haseloff RF, Piontek JR, Blasig IE. Structure and function of claudins. Biochimica et Biophysica Acta (BBA) - Biomembranes. 2008;1778(3):631-45.
  21. Leeson S, Namkung H, Antongiovanni M, Lee EH. Effect of butyric acid on the performance and carcass yield of broiler chickens. Poult Sci. 2005;84(9):1418-22.
  22. Li Z, Wang W, Liu D, Guo Y. Effects of Lactobacillus acidophilus on the growth performance and intestinal health of broilers challenged with Clostridium perfringens. J Anim Sci Biotechno. 2018;9(03):197-206.
  23. Meimandipour A, Shuhaimi M, Soleimani AF, Azhar K, Hair-Bejo M, Kabeir BM et al. Selected microbial groups and short-chain fatty acids profile in a simulated chicken cecum supplemented with two strains of Lactobacillus. Poult Sci. 2010;89(3):470-76.
  24. Mikio, Furuse, Masahiko, Itoh, Tetsuaki, Hirase et al. Direct Association of Occludin with ZO-1 and Its Possible Involvement in the Localization of Occludin at Tight Junctions. J Cell Biol. 1994.
  25. Nakanishi S, Kataoka K, Kuwahara T, Ohnishi Y. Effects of High Amylose Maize Starch and Clostridium butyricumon Metabolism in Colonic Microbiota and Formation of Azoxymethane-Induced Aberrant Crypt Foci in the Rat Colon. Microbiol Immunol. 2013.
  26. Opengart K, Songer JG. Necrotic enteritis. In: D. E. Swayne (ed.) Diseases of Poultry. 2013. p 949-53.
  27. Rehman H, Awad WA, Lindner I, Hess M, Zentek J. Clostridium perfringens alpha toxin affects electrophysiological properties of isolated jejunal mucosa of laying hens. Poultry Sci. 2006;85(7):1298-302.
  28. Ruhnke I, R He I, Goodarzi Boroojeni F, Knorr F, Mader A, Hafeez A et al. Feed supplemented with organic acids does not affect starch digestibility, nor intestinal absorptive or secretory function in broiler chickens. J Anim Physiol Anim Nutr (Berl). 2015;99(supp-S):29-35.
  29. Schroeder B, Winckler C, Failing K, Breves G. Studies on the time course of the effects of the probiotic Yeast Saccharomyces boulardii on electrolyte transport in pig jejunum. Dig Dis Sci. 2004;49(7-8):1311-17.
  30. Scumpia PO, Moldawer LL. Biology of interleukin-10 and its regulatory roles in sepsis syndromes. Crit Care Med. 2005;33(12 Suppl):S468-71.
  31. Shini S, Kaiser P, Shini A, Bryden WL. Differential alterations in ultrastructural morphology of chicken heterophils and lymphocytes induced by corticosterone and lipopolysaccharide. Vet Immunol Immunopathol. 2008;122(1-2):83-93.
  32. Shojadoost B, Vince AR, Prescott JF. The successful experimental induction of necrotic enteritis in chickens by Clostridium perfringens: a critical review. Vet Res. 2012;43:74.
  33. Song B, Li H, Wu Y, Zhen W, Guo Y. Effect of microencapsulated sodium butyrate dietary supplementation on growth performance and intestinal barrier function of broiler chickens infected with necrotic enteritis. Anim Feed Sci Tech. 2017;232:6-15.
  34. Timbermont L, Lanckriet A, Dewulf J, Nollet N, Schwarzer K, Haesebrouck F et al. Control of Clostridium perfringens-induced necrotic enteritis in broilers by target-released butyric acid, fatty acids and essential oils. Avian Pathol. 2010;39(2):117-21.
  35. Van Immerseel F, Rood JI, Moore RJ, Titball RW. Rethinking our understanding of the pathogenesis of necrotic enteritis in chickens. Trends Microbiol. 2009;17(1):32-36.
  36. Van KBJ, Dekker J, Buller HA, Einerhand AW. Mucin gene structure and expression: protection vs. adhesion. Am J Physiol. 1995;269(5):G613.
  37. Viswanathan VK, Hodges K, Hecht G. Enteric infection meets intestinal function: how bacterial pathogens cause diarrhoea. Nat Rev Microbiol. 2009;7(2):110.
  38. Wu Y, Shao Y, Song B, Zhen W, Wang Z, Guo Y et al. Effect of Bacillus coagulans supplementation on the grwoth performance and gut health of broiler chickens with Clostridirum perfringens-induced necrotic enteritis. J Anim Sci Biotechno. 2018;9:9.
  39. Wu Y, Zhen W, Geng Y, Wang Z, Guo Y. Pretreatment with probiotic Enterococcus faecium NCIMB 11181 ameliorates necrotic enteritis-induced intestinal barrier injury in broiler chickens. Sci Rep-Uk. 2019.
  40. Xu S, Lin Y, Zeng D, Zhou M, Zeng Y, Wang H et al. Bacillus licheniformis normalize the ileum microbiota of chickens infected with necrotic enteritis. Sci Rep-Uk. 2018;8(1):1744.
  41. Yang CM, Cao GT, Ferket PR, Liu TT, Chen AG. Effects of probiotic, Clostridium butyricum, on growth performance, immune function, and cecal microflora in broiler chickens. Poult Sci. 2012;91(9):2121-29.
  42. Zhan HQ, Dong XY, Li LL, Zheng YX, Gong YJ, Zou XT. Effects of dietary supplementation with Clostridium butyricum on laying performance, egg quality, serum parameters, and cecal microflora of laying hens in the late phase of production. Poult Sci. 2019;98(2):896-903.
  43. Zhang B, Gan L, Shahid MS, Lv Z, Fan H, Liu D et al. In vivoand in vitro protective effect of arginine against intestinal inflammatory response induced by Clostridium perfringens in broiler chickens. J Anim Sci Biotechno. 2019;10:73.
  44. Zhang B, Lv Z, Li H, Guo S, Liu D, Guo Y. Dietary l-arginine inhibits intestinal Clostridium perfringens colonisation and attenuates intestinal mucosal injury in broiler chickens. Brit J Nutr. 2017;118(05):321.
  45. Zhang L, Cao GT, Zeng XF, Zhou L, Ferket PR, Xiao YP et al. Effects of Clostridium butyricum on growth performance, immune function, and cecal microflora in broiler chickens challenged with Escherichia coli K88. Poult Sci. 2014;93(1):46.
  46. Zhang L, Zhang L, Zhan XA, Zeng X, Zhou L, Cao G et al. Effects of dietary supplementation of probiotic, Clostridium butyricum, on growth performance, immune response, intestinal barrier function, and digestive enzyme activity in broiler chickens challenged with Escherichia coli K88. J Anim Sci Biotechno. 2016;7(1):1-09.
  47. Zhou C, Fang X, Xu J, Gao J, Zhang L, Zhao J et al. Bifidobacterium longum alleciates irritable bowel syndrome-related visceral hypersensitivity and microbiota dysbiosis via Paneth cell regulation. Gut microbes. 2020;12(1):1782156.