Genetic diversity and prevalence of extended spectrum beta-lactamase producing Escherichia coli and Klebsiella pneumoniae in aquatic environment receiving untreated hospital effluents

doi:10.21203/rs.3.rs-1398021/v1

PDF

Research Article

Genetic diversity and prevalence of extended spectrum beta-lactamase producing Escherichia coli and Klebsiella pneumoniae in aquatic environment receiving untreated hospital effluents

https://doi.org/10.21203/rs.3.rs-1398021/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted 24 Mar, 2022

You are reading this latest preprint version

The spread of extended spectrum beta-lactamase producing bacteria in the environment has been recognized as a challenge to public health. Currently one of the most important mechanisms of resistance in Enterobacteriaceae is the synthesis of enzymes that contribute to modern expanded spectrum cephalosporin resistance, mainly extended spectrum beta-lactamases. The aim of the present study was to assess the occurrence of ESBL producing Escherichia coli and Klebsiella pneumoniae from selected water bodies receiving hospital effluents in Kerala, India. Nearly 69.8% of Enterobacteriaceae isolates were multi-drug resistant by Kirby-Bauer disc diffusion method. Double disc synergy test was used to detect the ESBL production and the genes responsible for imparting resistance was detected by PCR. Conjugation experiments confirmed the mechanism of plasmid-mediated transfer of resistance. The prevalence of ESBL production in E. coli and K. pneumoniae was 37.4% and 11.2% respectively. Among the ESBL encoding genes, bla_CTX−M was the most prevalent group followed by bla_TEM, bla_OXA, bla_CMY and bla_SHV. The results suggest that healthcare settings are one of the key contributors in the spread of ESBL-producing bacteria, not only through cross-transmission and ingestion of antibiotics, but also through the discharge of waste without a proper treatment, leading to harmful effects on the aquatic environment. The high prevalence of ESBL-producing Enterobacteriaceae with resistance genes in public water bodies even post-treatment poses a serious threat. .

Extended spectrum beta-lactamase

Antibiotic resistance

Public health

Kerala

Hospital effluent

Antimicrobials are undoubtedly one of the most triumphant chemotherapies in the medical history. Human activities since the industrialization of antibiotic production has changed the spread and increased the prevalence of resistance genes. In addition, millions of tons of antibiotics have been released into the environment through wastewater effluents, land use of animal waste, treatment of crop diseases and aquaculture activities (Kim and Cha 2021; Zheng et al. 2021). Antimicrobial resistance (AMR) spreads faster in humans, animals, and aquaculture due to the abuse and overuse of approved antimicrobials. Hospital wastewater treatment plants (WWTPs) are an important AMR driver aggregation path; they do not effectively eliminate all resistant bacterial pathogens and resistance genes and are thus, ultimately released into treated effluents (Osinska et al. 2020). Sewage effluent will be diluted when entering the river, estuary or coastal water, the resulting pollutant concentration including antibiotics, metals, biocides, and antibiotic resistance genes (ARGs) will interact with the native flora and fauna, causing changes in the microbial community structure and genetic makeup.

In Gram-negative bacteria, drug resistance is present as a serious global problem (Gniadkowski 2001). β-lactam antibiotics are the first-line therapeutic option for the treatment of Enterobacteriaceae infections, but resistance to these compounds has increased in recent decades (Rossolini and Mantengoli 2005). An epidemiological study reported that extended-spectrum β-lactamase (ESBL) producing Enterobacteriaceae, in particular Escherichia coli and Klebsiella pneumoniae are the major causes of community-acquired infections (Stadler et al. 2018). ESBL enzymes have hydrolytic capacities for a range of beta lactams including penicillins, monobactams and extended-spectrum cephalosporins (except cephamycins) and are inactivated by beta-lactamase inhibitors such as clavulanic acid (Gniadkowski 2001). Resistance to β-lactams in Enterobacteriaceae is primarily due to the production of β-lactamases, the genes for which are encoded on plasmids or chromosomally (Bush and Bradford 2016). Several different mechanisms of resistance to this antibiotic family have been detected, such as porin alterations, penicillin binding proteins (PBPs) modifications, efflux systems and the production of enzymes like extended spectrum β-lactamases (ESBLs), AmpC β-lactamases and metallo-β-lactamases (MBLs) (Batchelor et al. 2005).

Since the first study of the ESBLs reported in 1979, the occurrence of ESBL-producing bacteria was frequently identified worldwide from clinical isolates attributed to the cumulative use of β-lactam antibiotics and carbapenems; the latter are generally used as the last choice for most severe bacterial infections (Sanders and Sanders 1979). According to their functional and structural characteristics, over two hundred β-lactamases are classified into four main groups and eight subgroups (Bush and Jacoby 2010). When compared to antibiotic resistance genes from other antibiotic classes, β-lactamase genes have a higher number and diversity (Piotrowska et al. 2019). As the largest group of varied and unique determinants of resistance in bacteria, β-lactamase genes are studied in detail, in terms of distribution mechanisms in the environment. The ESBLs are mainly derived from plasmid-mediated TEM or SHV β-lactamases by a mutation that results in one or more amino acid sequence alteration and results in the change of binding to active substrate site (Paterson and Bonomo 2005). Enterobacteriaceae isolates have long been known to recruit narrow-spectrum ambler class A β-lactamases of the TEM and SHV lineages, which were linked to nosocomial epidemics in the 1980s (Quinn et al. 1989). Being mediated with plasmid and transposon, it spreads rapidly to various bacterial species, and it was found that up to 90% of the resistance to ampicillin in E. coli is due to the production of TEM β -lactamases (Livermore 1995). A relatively new type of CTX-M ESBLs has a high affinity for cefotaxime and has been divided into five categories, with more than 40 variants distributed worldwide (Bush 2018). Additionally, AmpC β-lactamases confer resistance to a wide range of β-lactam antibiotics, primarily cephamycins such as cefoxitin and cefotetan, less frequently used with cefotaxime, ceftazidime, cefpodoxime, ceftriaxone, and sometimes monobactams such as aztreonam and they are chromosomally, or plasmid encoded. The plasmid-mediated AmpC β-lactamase (pAmpC) now poses a complex danger to the activities of penicillins, cephalosporins, monobactams and carbapenems (Ahmed and Shimamoto 2008).

The aim of the present study was to assess the role of hospital effluents on the accumulation of microbial contaminants in the receiving public water bodies and aquaculture farms in their vicinity using the same water as inlet source. In particular, the study aimed to determine the prevalence, resistance pattern, identification of the major ESBL encoding genes in E. coli and K. pneumoniae isolates and their mode of transfer between bacteria since they can cause serious public health problems.

Study area

The methods are described in brief here. Detailed description of the method is available in previously published papers (Kalasseril et al. 2020 and Sneha et al. 2020). Three tertiary care hospitals (H1, H2 and H3) located near water bodies in three districts of Kerala, India (Ernakulam, Kollam, and Kannur) were selected for the study. The study was conducted during August-December 2019-20. The three hospitals released their sewage effluents into water bodies that were used for various purposes including inland fishing activities.

Sample collection and processing

From the sampling points, sediment, water, and fish/shrimp/clams were collected following standard procedures. Two sampling locations were chosen: (i) the point where hospital effluents enter public water bodies, and (ii) farms downstream of hospital sites. Water samples were taken from the outlet pipes of the hospitals in amber-colored sterile bottles and transported to the microbiology laboratory on ice within 2 h of collection. From each site, approximately 100-200 g of sediment and 50 g of animal tissue was taken and homogenized. The samples were diluted serially and a volume of 100 µl from each sample was inoculated onto Trypticase soy agar (TSA) (Himedia, India) in duplicate plates and incubated at 37 ^oC for 24 h. Colonies were enumerated and different morphotypes were randomly selected and transferred to fresh plate to ensure its purity.

Identification of E. coli and K. pneumoniae isolates from samples

For descriptive analysis, total colony-forming units per plate within the range of 30-300 were included. Single colonies were then transferred to MacConkey agar (Himedia, India) and Hicrome Klebsiella selective agar base followed by incubation for 24-48 h at ambient temperature until visible colonies were observed. Isolates that appeared bright pink and purple mucoid colonies on the selective agar were confirmed as E. coli and K. pneumoniae respectively. For biochemical characterization, the pure colonies were inoculated into Trypticase soy broth for 24 h at ambient temperature (Holt et al. 1994).

Antimicrobial susceptibility testing

According to Clinical and Laboratory Standards Institute (CLSI 2017), antibiotic resistance phenotypes were determined based on the disc diffusion method (Bauer et al. 1966). All the antibiotic discs and the media were purchased from Himedia, India. Overnight cultures of the bacterial isolates were plated on Mueller-Hinton agar. The following antibiotic discs were used for antimicrobial susceptibility testing: ampicillin (10 µg), amoxicillin (10 µg), amoxycillin/clavulanate (20/10 µg), cefotaxime (30 µg), cefotetan (30 µg), cefoxitin (30 µg), ceftazidime (30 µg), ceftriaxone (30 µg), cefpodoxime (10 µg), cefepime (10 µg), aztreonam (30 µg), chloramphenicol (30 µg), azithromycin (15 µg), gentamicin (10 µg), amikacin (30 µg), ciprofloxacin (5 µg), ofloxacin (5 µg), nalidixic acid (30 µg), trimethoprim/sulfamethoxazole (1.25/23.75 µg), imipenem (10 µg) and meropenem (10 µg) followed by incubation at 37 ^oC for 24 h. Using strip (Himedia, India) method, the minimum inhibitory concentration (MIC) for selected isolates was determined.

Phenotypic detection of ESBL production

The isolates showing a higher resistance to cephalosporin class of antibiotics was selected for checking the ESBL production. Combined disc method was used for the detection of ESBL production in which a disc of ceftazidime (30 µg) alone and a combination of ceftazidime with clavulanic acid (30 µg/10µg), and cefotaxime (30 µg) alone and cefotaxime with clavulanic acid (30 µg/10 µg) were used (Linscott and Brown 2005). A lawn culture of the test organism was plated on Mueller-Hinton agar and the discs were carefully placed with centers at least 24 mm apart. The plates were incubated overnight at ambient temperature. Any decrease or increase in the inhibition zone diameter of ≥5 mm for the combination discs compared to ceftazidime or cefotaxime alone was considered as positive for ESBL production.

Molecular detection of ESBL-encoding genes

The presence of ESBL encoding genes was detected as described by (Villegas et al. 2004; Sharma et al. 2010; Ibrahim et al. 2014). Details of the primers used and PCR conditions are given in Table 1. The PCR was carried out in 25 µl reaction mixture containing 15.75 µl of nuclease free water, 10X Taq buffer (2.5 µl) (100 mM Tris HCl, pH 8.3, 20 mM MgCl₂, 500 mM KCl, 0.1% gelatin), 200 mM dNTP’s (0.5 µl) (dATP, dTTP, dGTP, dCTP), 10 pmol each of forward and reverse primers (2 µl), 1.0 unit of Taq DNA polymerase (0.25 µl) and 2 µl of template. All the reagents were purchased from Origin Diagnostics and Research, Bangalore. The PCR was carried out in a My Cycler thermal cycler (Biorad, USA). The PCR products were purified and sequencing was performed with an automated ABI 3100 Genetic analyzer using ABI BigDYE terminator method (M/s Agrigenome Pvt Ltd, Kerala, India). A BLAST algorithm was used to analyze the nucleotide sequences (https://www.ncbi.nlm.nih.gov/BLAST). The nucleic acid sequences were submitted to GenBank (GenBank accession numbers MN715313, MN715314, MW642081 and MW642080).

Bacterial plasmid isolation and conjugation

Using a plasmid extraction kit (GeNei, Bangalore), the bacterial plasmid was extracted. The purified plasmid DNA was dissolved and stored at 4 ^oC in TE buffer. Conjugation experiments were carried out by a broth mating method using azide resistant (AzR) E. coli J53 as recipient and bla_CTX-M-15positive E. coli as the donor (wang et al. 2008). Pure colonies of donor and recipient cells were inoculated separately and incubated overnight at 37 ^oC with shaking. These overnight cultures were diluted in a fresh medium at 1:100 and each was grown to the early exponential phase. The mating combination was prepared by adding 0.1 ml of donor cells to 0.9 ml of recipient cells. The mixture was gently whirled for a few minutes, incubated at 37 ^oC for 6 h (without shaking). This was followed by plating on Luria-Bertani (LB) agar medium (Himedia, India) containing cefotaxime (2 mg/l). Trans-conjugants carrying the same bla_CTX-M-15gene as their donor were verified by PCR.

Bacterial identification and ESBL detection

From the study area, a total of 524 Gram-negative bacteria were isolated, of which 366 isolates (69.8%) showed multi-drug resistance (MDR) to different class of antibiotics tested. E. coli was found to be the dominant isolate (n= 135) followed by K. pneumoniae (n=49), Klebsiella oxytoca (n=32), Aeromonas hydrophila (n=18), Enterobacter aerogenes (n=15), Pseudomonas aeruginosa (n=15), Enterobacter cloacae (n=12), Pseudomonas putida (n=12), Citrobacter sp. (n=11), Salmonella sp. (n=9) and Acinetobacter baumannii (n=7) in various samples screened from direct hospital effluents. In comparison, E. coli (n=74), K. pneumoniae (17), E. aerogenes (13), P. aeruginosa (7) and A. baumannii (n=3) were obtained from aquaculture farms downstream of the above sites.

The CLSI recommends screening of E. coli, K. pneumoniae, K. oxytoca, and Proteus mirabilis isolates for ESBL production by the use of cefpodoxime, ceftazidime, aztreonam, cefotaxime, or ceftriaxone, followed by phenotypic confirmation with clavulanate. Only E. coli and K. pneumoniae isolates that showed high resistance to cephalosporin class of antibiotics were subjected to ESBL detection by Double Disc Synergy test (Fig. 1). Of the 209 E. coli isolated from different points, 103 isolates (37.4%) were positive for ESBL production; 76 isolate from direct hospital effluents (27.6%) (H1=23, H2=41, H3=12) and 27 isolates (9.8%) from F3 site. Among the 66 K. pneumoniae isolates, 25 (9%) isolates from hospital points (H1=10, H2=15) and 6 isolates (2.1%) from F3 site were found to be ESBL producers. None of the other bacterial isolates from direct hospital and aquaculture farm samples were positive for ESBL production.

Antimicrobial susceptibility testing and MIC of ESBL isolates

Among the 76 ESBL positive E. coli isolates from direct hospital effluents, all the isolates showed complete resistance to ampicillin, amoxicillin, cefoxitin, cefotetan, cefepime, cefpodoxime, amoxycillin/clavulanate, ceftazidime, cefotaxime, ceftriaxone, ciprofloxacin, ofloxacin, nalidixic acid, aztreonam, trimethoprim/sulfamethoxazole, amikacin, gentamicin and imipenem whereas all the strains were susceptible to azithromycin, meropenem and chloramphenicol. In comparison, out of the 49 hospital effluent K. pneumoniae isolates, 25 ESBL positive isolates (H1=10, H2=15) showed complete resistance to ampicillin, amoxicillin, amoxycillin/clavulanate, cefotaxime, cefotetan, cefoxitin, ceftazidime, ceftriaxone, cefpodoxime and cefepime, whereas K. pneumoniae isolates from H2 (n=15) showed resistance to ciprofloxacin, ofloxacin, nalidixic acid, imipenem, meropenem, aztreonam and trimethoprim/sulfamethoxazole. However, they were sensitive to amikacin, gentamicin, azithromycin and chloramphenicol.

In aquaculture farms (F3 site), 27 E. coli and 6 K. pneumoniae isolates showed high resistance to cephalosporin and quinolone class of antibiotics, the farm which was adjacent (800 m) to the hospital discharge site. The pattern of antibiotic resistance of E. coli and K. pneumoniae from F3 was similar to that found in the direct hospital effluent samples. E. coli and K. pneumoniae isolates from the remaining farms were susceptible to all the tested antibiotics. The antibiotic resistance pattern of ESBL positive isolates collected from direct hospital effluents and aquaculture farm (F3) are shown in Fig. 2.

Majority of the ESBL positive isolates from direct hospital effluent and aquaculture samples had MIC values of ˃32-256 µg/ml to each of the third generation cephalosporin tested, thus confirming high resistance. All the ESBL positive isolates exhibited high level resistance to penicillins (˃256 µg/ml). Frequency of antibiotic resistance was high in those isolates of E. coli and K. pneumoniae which had TEM, SHV and CTX-M genes. E. coli isolates carrying CTX-M ESBL confer high level resistance to ceftazidime (MIC range 64-256 µg/ml) and they had co-resistance to quinolone class of antibiotics and showed an elevated level of MIC value ranging from 8-64 µg/ml. However, in case of K. pneumoniae isolates at the concentration of 128 µg/ml of ceftazidime, only twelve isolates showed resistance, while the remaining thirteen isolates had MIC value of ˃64 µg/ml towards ceftazidime. At the concentration of ≥128-256 µg/ml of cefotaxime and ceftriaxone, all the ESBL positive E. coli isolates were resistant. On the other hand, ESBL positive K. pneumoniae isolates had MIC levels of 64-128 µg/ml of cefotaxime and ceftriaxone; while, MIC range of 32-˃256 μg/ml was observed among E. coli and K. pneumoniae isolates for cefepime. In aquaculture farms, specifically ESBL positive E. coli and K. pneumoniae from F3 site showed elevated level of MIC towards ceftazidime, ceftriaxone and cefotaxime (Table 2).

Molecular characterization of ESBL encoding genes

For a reliable epidemiological investigation of antimicrobial resistance, molecular detection and identification of resistance encoding genes would be necessary. bla_CTX-M, bla_TEM, bla_OXA, bla_CMY and bla_SHV resistance genes were detected in E. coli and K. pneumoniae isolates. For ESBL resistance encoding genes, bla_CTX-M was found to be more prevalent (n=38) followed by bla_TEM (n=21) and bla_SHV(n=18). The plasmid mediated cephalosporin resistance coding genes of bla_SHVgroup was detected in 18 E. coli isolates in combination with bla_CTX-Mresistance gene. Two SHV genotypes such as bla_SHV-1(n=11) and bla_SHV-61(n=7) were found among E. coli isolates in H2 site. It is noteworthy that the number of β-lactamase genes in E. coli was clearly associated with the frequency of the ESBL producer at each sampling site, specifically at the H2 site. In hospital effluent samples, for bla_CTX-Mpositive isolates, bla_CTX-M-15was the predominant genotype (n=38). For bla_TEM, only TEM-95b variant was detected from H1 and H2 E. coli isolates. However, bla_OXA-and the most numerous and diverse AmpC gene type bla_CMY-6 was detected in six and five E. coli isolates from H2 site respectively. It is interesting to note that in none of the ESBL positive K. pneumoniae isolates, the bla_CTX-M, bla_TEM, bla_OXAand bla_CMYgenes were detected; however, three types of bla_SHV genotypes like bla_SHV-266(n=7), bla_SHV-211(n=7) and bla_SHV-148(n=5) were detected in K. pneumoniae isolates from direct hospital effluent samples. In aquaculture farm (F3 site), ESBL-positive E. coli isolates with the encoding genes bla_CMY-6 (n=5), bla_CTX-M-15 (n=6)and bla_OXA-48 (n=3)and ESBL positive K. pneumoniae isolates with bla_SHV-148(n=6) were detected.

Bacterial plasmid conjugation

The plasmid-mediated ESBL resistance was successfully transferred from E. coli with bla_CTX-M-15gene to azide-resistant E. coli J53 isolate. Plasmid isolated from the trans-conjugants and analyzed by PCR showed the specific amplification of bla_CTX-M-15gene (550 bp) in the trans-conjugants. All the trans-conjugant strains tested showed resistance to extended-spectrum cephalosporins. They were more resistant to cefotaxime than to ceftazidime and were susceptible to imipenem. MIC of trans-conjugants for cefotaxime and ceftazidime were related to those for each wild-type isolate, and showed decreased ciprofloxacin sensitivity (MIC 0.2 to 1 µg/ml).

In soil and aquatic ecosystems, anthropogenic activities that affect water quality and, as a result, its long-term use is frequently threatened. Considering aquatic systems as reactors for diverse biological interactions with major genetic consequences, the study of aquatic antibiotic resistance including ARGs, pathogenic and non-pathogenic antibiotic resistant bacteria (ARBs) is important, as it may indicate the degree of alteration of water environments by different types of pollutions. Because antimicrobials and ARBs are routinely released directly into the environment, aquatic habitats such as rivers and streams are recognized to be favorable reservoirs for the spread of antibiotic resistance.

In Kerala, the southernmost state of India, majority of hospitals and factories are located on heavily populated riversides, near cities and towns, which cause MDR isolates, to disseminate quickly through these water bodies. In this study, public water bodies receiving hospital effluents yielded a total of 69.8% MDR isolates, including 48.6% ESBL producers. Total coliforms were found to be substantially higher in samples taken from direct hospital effluent than in samples collected from aquaculture farms located downstream of the main discharge. This result could be explained by the fact that WWTP units in Kerala have not been fully functional, 94% sewage being dumped in open field and water bodies (Kanth 2020). The existence of a large number of Gram-negative isolates indicated that the water quality had deteriorated, altering the river's ecology. Antibiotic resistance in E. coli is becoming a growing concern around the world. This has been linked to the spread of E. coli that produces extended spectrum beta-lactamases (Peirano et al. 2011). Several studies have focused on hospital discharge of ESBL-producing Enterobacteriaceae from different parts of the world (Galvin et al. 2010; Chagas et al. 2011; Brechet et al. 2014; Engda et al. 2018).

Overall, the resistance trends of ESBL-producing bacteria analyzed in our study were similar to those reported in other studies, i.e., the ESBL producers were resistant to a variety of antibiotic groups, including fluoroquinolones, aminoglycosides, and trimethoprim/sulfamethoxazole, in addition to β-lactams which lead to the selection and persistence of MDR ESBL strains and plasmids in both clinical and community settings. This indicates that the organisms were well exposed and developed resistance to these antibiotics. A study by (Conte et al. 2017) isolated MDR bacterial strains from hospital wastewaters in Brazil, primarily E. coli, K. pneumoniae, and K. oxytoca, which showed high resistance to cefotaxime and ceftazidime. Resistance to these two antibiotics indicates the development of ESBLs, which are characteristic of bacteria found in hospital effluents. In our study, the cephalosporin resistant ESBL positive isolates also showed high resistance to quinolone class of antibiotics. ESBL producing E. coli with ciprofloxacin-resistance was isolated from Ireland's hospital effluent samples, signifying that these genes can coexist (Galvin et al. 2010). Co-selection of phenotypes of cephalosporin and quinolone resistance was previously reported in Enterobacteriaceae in the clinical setting, possibly leading to MDR bacteria (Lavilla et al. 2008). Research on ESBL genes indicated that their levels are significantly associated with other antimicrobial resistance genes especially quinolone genes and their mode of mechanism was regulated by the same promoter (Wu et al. 2016).

In this study, majority of the isolates from direct hospital effluent samples had MIC values of 32-≥256 µg/ml to each of the third generation cephalosporin tested, thus confirming high resistance. At the concentration of 128–256 µg/ml of cefotaxime and ceftriaxone, all the ESBL positive E. coli isolates were resistant; however, ESBL positive K. pneumoniae isolates had MIC levels of 64–128 µg/ml of cefotaxime and ceftriaxone. According to recent findings, a combination of decreased outer membrane permeability and the hydrolytic impact of TEM-1 and SHV-1 β-lactamases enhanced cefotaxime's MIC significantly (Drawz and Bonomo 2010). This difference suggests the presence of CTX-M type ESBLs that hydrolyze cefotaxime and ceftriaxone more efficiently than ceftazidime (Tzouvelekis et al. 2000). All the ESBL positive E. coli and K. pneumoniae showed an elevated level of MIC for ceftazidime (128–256 µg/ml). Previous studies have shown that the enzyme SHV-1 hyper production is one reason for the increased MIC of ceftazidime in Enterobacteriaceae (Rice et al. 2000). Resistance to Cefoxitin, which is a cephamycin, has been observed in both E. coli and K. pneumoniae isolates, is not generally hydrolyzed by ESBLs, but resistance to cefoxitin has been increasing among ESBL producing isolates due to altered membrane porins (Subha and Ananthan 2002). The MDR isolates in this study showed high MIC value to cefepime also due to the high prevalence of CTX-M type ESBLs (Yu et al. 2002).

Among the different genes coding for ESBL production, bla_CTX−M was found to be the most prevalent ESBL encoding gene in E. coli isolates and the prevalence was 32.8%. CTX-M subtype of bla_CTX−M−15 have emerged as the most common ESBL encoding genes among E. coli from clinical and aquatic environments in recent years (Hu et al. 2013). Because of the worldwide use of cefotaxime and ceftriaxone for urinary tract infections, it is not surprising that CTX-M-type ESBLs are now present in many countries. However, no epidemiological studies have yet been conducted that have correlated cefepime use with CTX-M-type ESBL infection. It is notable that elevated cefepime MICs are typical for isolates of Enterobacteriaceae producing CTX-M-type ESBLs, as seen in our study. Previous research has shown that bla_CTX−M−15 is the most commonly distributed genotype linked to significant infections in both public and hospital settings (Canton et al. 2012). Recent studies in Africa and Europe have observed significant increase in Gram-negative bacteria that produce ESBLs, especially those with bla_CTX−M−15 genes, which cause community urinary tract infections (Ibrahimagic et al. 2015).

The second major prevalent group of ESBL encoding gene observed in our study was bla_TEM and its prevalence was 15.6%. Among the variants of TEM gene, bla_TEM−95b was detected in E. coli isolates with high resistance to ampicillin from direct hospital effluent samples. There are very few reports on the genetic determinants of E. coli with bla_TEM−95b variant isolated from hospital wastewater. The bla_TEM−95b gene renders resistance to β-lactam antibiotics similar to those isolates with TEM-1-type β-lactamase. The TEM β-lactamases are one of the most clinically relevant β-lactamase families. TEM-1, the first of this group to be discovered, is a broad-spectrum enzyme that hydrolyzes early cephalosporins as well as several penicillins. The gene encoding bla_TEM−95b shows a mutation at nucleotide 635, causing a change in amino acid 145 converting proline to alanine (Brinas et al. 2002). The roles played by specific mutations in the action spectra of TEM β-lactamase have been previously analyzed and described in several studies (Vakulenko et al. 1998; Sideraki et al. 2001). E. coli isolates carrying bla_TEM−95b gene renders ampicillin resistance phenotype similar to those of other isolates carrying bla_TEM−1 gene.

The most prevalent carbapenemase gene found in E. coli from hospital discharge points was bla_OXA−48 and the prevalence was found to be 6.7%. To date, 11 OXA-48-like forms have been reported, the most frequent of which is classical OXA-48 (Hendrickx et al. 2020). OXA-48 and its variants are special carbapenemases with low rates of hydrolysis against carbapenems but no intrinsic action toward extended-spectrum cephalosporins. Despite the inability of OXA-48-like carbapenemases to hydrolyze cephalosporin class of antibiotics, pooled isolates showed high variable resistance to ceftazidime and cefepime, which is likely to represent high levels of ESBL co-production (Stewart et al. 2018). After the first OXA-48-like carbapenemase report in Turkey, the enzyme-producing bacterial strains have been extensively investigated in nosocomial and community outbreaks in several parts of the world, especially in the Mediterranean region and in European countries (Gulmez et al. 2008). The observation made in the present study is supported by the findings of other researchers and suggests that bla_OXA−48 is one of the prevalent groups of carbapenemase in Enterobacteriaceae found in hospital effluents and municipal waters highlighting its widespread distribution (Nasri et al. 2017; Parvez and Khan 2018; Ebomah and Okoh 2020). AmpC enzyme production is less common than ESBL production. However, the prevalence of cefoxitin-resistant E. coli has increased worldwide in recent years, reflecting the spread of isolates with plasmid-mediated AmpC β-lactamase. However, in the current study, only five E. coli isolates showed the presence of bla_CMY−6 gene, and the prevalence was merely 7.4%. High prevalence of bla_CMY−6 was detected in clinical isolates of E. coli and K. pneumoniae from Myanmar and northeast of Iran suggests its rapid spread and may become an important public health issue (Rizi et al. 2020; San et al. 2020).

Studies have shown that SHV types can be significantly reduced together with CTX-M and OXA genes through biological treatments such as activated sludge processing and anaerobic digestion, although not all of them can be effectively eliminated from the hospital effluent samples (Yi et al. 2015). In our study, the prevalence of E. coli and K. pneumoniae isolates with bla_SHV was found to be 13.4% and 18.6% respectively can be considered as a proof for the inappropriate waste treatment management system in the hospitals and its spread through water. High prevalence of bla_SHV alleles in untreated hospital wastewater treatment plants in Australia and opined that isolates carrying SHV genes can transfer to surface water through wastewater treatment plants (Gundogdu et al. 2013).

The findings of this study revealed the presence of MDR isolates with ESBL encoding genes in direct hospital effluent samples and aquaculture farms, demonstrating the potential for clinical pathogens to spread into aquatic environments from untreated hospital discharges. The large diversity of ARGs- harboured in the bacteria found in hospital wastewaters in Kerala clearly indicate the risk of spread of AMR to the bacteria in the aquatic environment. Although only a small fraction of emergent AMR variants may sufficiently fit for broader dissemination, spread of Gram-negative hospital pathogens with AMR genes can begin as localized expansions, which can rapidly progress to global dissemination from such tropical hotspots. Therefore the presence of Mobile Genetic Elements (MGEs), ARGs, and antibiotic residues in the effluents put human and environmental health at risk. Existing WWTPs should be augmented by novel treatment methods and government policies should adequately address and give priority to implementation of hospital stewardship programmes as well as regulations for effluent discharge into water bodies.

Acknowledgement

The authors wish to thank the authorities of the Kerala University of Fisheries and Ocean Studies for providing funds and facilities to carry out the work.

Authors Contributions

All authors contributed to the study conception and design. Material preparation, data collection and analysis was performed by Sneha Kalasseril Girijan, Robin Paul and Devika Pillai. The first draft of the manuscript was written by Sneha Kalasseril Girijan. All authors read and approved the final manuscript.

Funding

The authors declare that no funds, grants, or other support were received during the preparation of this manuscript.

Data availability

The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

Ethical Approval

All experiments were performed in strict accordance with the guidelines of the Committee for Purpose of Control and Supervision of Experiments on Animals (CPCSEA) registration number: 1174/ac/08/CPCSEA. The protocol was reviewed and approved by the institutional animal ethics committee of Kerala University of Fisheries and Ocean Studies, India.

Consent to publish

All authors have checked the manuscript and have agreed to the publication.

Consent to Participate

Not applicable

Competing Interests

The author declares no competing interests.

Ahmed A.M, Shimamoto T (2008) Emergence of a cefepime-and cefpirome-resistant Citrobacter freundii clinical isolate harbouring a novel chromosomally encoded AmpC β-lactamase, CMY-37. Int J Antimicrob Agents 32:256-61. https://doi.org/10.1016/j.ijantimicag.2008.04.019
Batchelor M, Hopkins K, Threlfall E J, Clifton-Hadley FA, Stallwood AD, Davies RH, Liebana E (2005) bla CTX-M genes in clinical Salmonella isolates recovered from humans in England and Wales from 1992 to 2003. Antimicrob Agents Chemother 49:1319-22. https://doi.org/10.1128/AAC.49.4.1319-1322.2005
Bauer AW, Kirby WM, Sherris JC, Turck M (1966) Antibiotic susceptibility testing by standardized single disc method. Am J Clin Pathol 44:493- 496. PMID: 5325707
Brechet C, Plantin J, Sauget M, Thouverez M, Talon D, Cholley P, Guyeux C, Hocquet D, Bertrand X (2014) Wastewater treatment plants release large amounts of extended-spectrum β-lactamase–producing Escherichia coli into the environment. Clin Infect Dis 58:1658-65. http://doi.org/10.1093/cid/ciu190
Brinas L Zaraga M, Saenz Y, Ruiz-Larrea F, Torres C (2002) Beta-lactamases in ampicillin-resistant Escherichia coli isolates from foods, humans, and healthy animals. Antimicrob Agents Chemother 46:3156-3160. https://doi.org/10.1128/AAC.46.10.3156-3163.2002
Bush K (2018) Past and present perspectives on β-lactamases. Antimicrob Agents Chemother 62:e01076-18. https://doi.org/10.1128/AAC.01076-18
Bush K, Bradford PA (2016) β-Lactams and β-lactamase inhibitors: an overview. Cold Spring Harb Perspect Med 6:a025247. https://doi.org/10.1101/cshperspect.a025247
Bush K, Jacoby GA (2010) Updated functional classification of β-lactamases. Antimicrob Agents Chemother 54:969-976. https://doi.org/10.1128/AAC.01009-09
Canton R, Gonzalez-Alba JM, Galan JC (2012) CTX-M enzymes: origin and diffusion. Front Microbiol 3:110. https://doi.org/10.3389/fmicb.2012.00110
Chagas TPG, Seki LM, Cury JC, Oliveira JAL, Davila AMR, Silva DM, Asensi MD (2011) Multiresistance beta-lactamase-encoding genes and bacterial diversity in hospital wastewater in Rio de Janeiro, Brazil. J Appl Microbiol 111:572-581. http://doi.org/10.1111/j.1365-2672.2011.05072.x
CLSI Clinical and Laboratory Standards Institute (2017) Performance standards for antimicrobial susceptibility testing; twenty-third informational supplement. Document M100-27^th ed. Wayne, PA
Conte D, Palmeiro JK, da Silva Nogueira K, de Lima TM, Cardoso MA, Pontarolo R, Pontes FL, Dalla-Costa LM (2017) Characterization of CTX-M enzymes, quinolone resistance determinants, and antimicrobial residues from hospital sewage, wastewater treatment plant, and river water. Ecotoxicol Environ Safe 136:62-9. http://doi.org/10.1016/j.ecoenv.2016.10.031
Drawz SM, Bonomo RA (2010) Three decades of beta-lactamase inhibitors. Clin Microbiol Rev 23:160-201. http://doi.org/10.1128/CMR.00037-09
Ebomah KE, Okoh AI (2020) Detection of carbapenem-resistance genes in Klebsiella species recovered from selected environmental niches in the Eastern Cape Province, South Africa. Antibiot 9:425. https://doi.org/10.3390/antibiotics9070425
Engda T, Moges F, Gelaw A, Eshete S, Mekonnen F (2018) Prevalence and antimicrobial susceptibility patterns of extended spectrum beta-lactamase producing Entrobacteriaceae in the University of Gondar Referral Hospital environments, northwest Ethiopia. BMC Res Notes 11:1-7. https://doi.org/10.1186/s13104-018-3443-1
Galvin S, Boyle F, Hickey P, Vellinga A, Morris D, Cormican M (2010) Enumeration and characterization of antimicrobial-resistant Escherichia coli bacteria in effluent from municipal, hospital, and secondary treatment facility sources. Appl. Environ. Microbiol. 76:4772-4779. http://doi.org/10.1128/AEM.02898-09
Gniadkowski M (2001) Evolution and epidemiology of extended-spectrum β-lactamases (ESBLs) and ESBL-producing microorganisms. Clin Microbiol Infect 7:597-608. https://doi.org/10.1046/j.1198-743x.2001.00330.x
Gulmez D, Woodford N, Palepou MF, Mushtaq S, Metan G, Yakupogullari Y, Kocagoz S, Uzun O, Hascelik G, Livermore DM (2008) Carbapenem-resistant Escherichia coli and Klebsiella pneumoniae isolates from Turkey with OXA-48-like carbapenemases and outer membrane protein loss. Int J Antimicrob Agents 31:523-6. https://doi.org/10.1016/j.ijantimicag.2008.01.017
Gundogdu A, Jennison AV, Smith HV, Stratton H, Katouli M (2013) Extended-spectrum β-lactamase producing Escherichia coli in hospital wastewaters and sewage treatment plants in Queensland, Australia. Can J Microbiol 59:737-45. https://doi.org/10.1139/cjm-2013-0515
Hendrickx AP, Landman F, de Haan A, Borst D, Witteveen S, van Santen-Verheuvel MG, Schouls LM (2020) blaOXA-48-like genome architecture among carbapenemase-producing Escherichia coli and Klebsiella pneumoniae in the Netherlands. Microb Genom 7:1-14. https://doi.org/10.1099/mgen.0.000512
Holt JG, Krieg NR, Sneath PHA, Staley JT, Williams ST (1994) Bergeys Manual of Determinative Bacteriology. Ninth edition. Maryland, USA
Hu YY, Cai JC, Zhou HW, Chi D, Zhang XF, Chen WL, Zhang R, Chen GX (2013) Molecular typing of CTX-M-producing Escherichia coli isolates from environmental water, swine feces, specimens from healthy humans, and human patients. Appl Environ Microbiol 79:5988-96. http://doi.org/ 10.1128/AEM.01740-13
Ibrahim AA, El-Diasty MM, Mahmoud MM, Nada HS (2014) Molecular characterization of multidrug-resistant Salmonella species from meat in Delta Area, Egypt. Ann Vet Anim Sci 1:11. https://doi.org/10.26609/avas.2014.1.1.1
Ibrahimagic A, Bedenic B, Kamberovic F, Uzunovic S (2015) High prevalence of CTX-M-15 and first report of CTX-M-3, CTX-M-22, CTX-M-28 and plasmid-mediated AmpC beta-lactamase producing Enterobacteriaceae causing urinary tract infections in Bosnia and Herzegovina in hospital and community settings. J Infect Chemother 21: 363-9. https://doi.org/10.1016/j.jiac.2015.01.003
Kalasseril SG, Krishnan R, Vattiringal RK., Paul R, Mathew P, Pillai D (2020) Detection of New Delhi metallo-β-lactamase 1 and cephalosporin resistance genes among carbapenem-resistant Enterobacteriaceae in water bodies adjacent to hospitals in India. Curr Microbiol 77: 2886-95. http://doi.org/doi: 10.1007/s00284-020-02107-y
Kanth A (2020) Kerala dumps 94% sewage in the open every day. The New Indian Express reports.
Kim DW, Cha CJ (2021) Antibiotic resistome from the One-Health perspective: understanding and controlling antimicrobial resistance transmission. Exp Mol Med 53:301-9. http://doi.org/10.1038/s12276-021-00569-z
Lavilla S, Gonzalez-Lopez JJ, Sabate M, Garcia-Fernandez A, Larrosa MN, Bartolome RM, Carattoli A, Prats G (2008) Prevalence of qnr genes among extended-spectrum beta-lactamase producing enterobacterial isolates in Barcelona, Spain. J Antimicrob Chemother 61:291-295. http://doi.org/10.1093/jac/dkm448
Linscott AJ, Brown WJ (2005) Evaluation of four commercially available extended-spectrum beta-lactamase phenotypic confirmation tests. J Clin Microbiol 43:1081-5. https://doi.org/ 10.1128/JCM.43.3.1081-1085.2005
Livermore DM (1995) beta-Lactamases in laboratory and clinical resistance. Clin Microbiol Rev 8:557-84. https://doi.org/10.1128/CMR.8.4.557
Nasri E, Subirats J, Sanchez-Melsio A, Mansour HB, Borrego CM, Balcázar JL (2017) Abundance of carbapenemase genes (blaKPC, blaNDM and blaOXA-48) in wastewater effluents from Tunisian hospitals. Environ Pollut 229:371-4. https://doi.org/10.1016/j.envpol.2017.05.095
Osinska A, Korzeniewska E, Harnisz M, Felis E, Bajkacz S, Jachimowicz P, Niestępski S, Konopka I (2020) Small-scale wastewater treatment plants as a source of the dissemination of antibiotic resistance genes in the aquatic environment. J Hazard Mater 381:121221. https://doi.org/10.1016/j.jhazmat.2019.121221
Parvez S, Khan AU (2018) Hospital sewage water: a reservoir for variants of New Delhi metallo-β-lactamase (NDM)-and extended-spectrum β-lactamase (ESBL)-producing Enterobacteriaceae. Int J Antimicrob Agents 51:82-8. https://doi.org/10.1016/j.ijantimicag.2017.08.032
Paterson DL, Bonomo RA (2005) Extended-spectrum beta-lactamases: a clinical update. Clin Microbiol Rev 18:657-86. https://doi.org/10.1128/CMR.18.4.657-686.2005
Peirano G, van Greune CHJ, Pitout JDD (2011) Characteristics of infections caused by extended-spectrum β-lactamase-producing Escherichia coli from community hospitals in South Africa. Diagn Microbiol Infect Dis 69:449–453
Piotrowska M, Kowalska S, Popowska M (2019) Diversity of β-lactam resistance genes in gram-negative rods isolated from a municipal wastewater treatment plant. Ann Microbiol 69:591-601. https://doi.org/10.1007/s13213-019-01450-1
Quinn JP, Miyashiro D, Sahm D, Flamm R, Bush K (1989) Novel plasmid-mediated beta-lactamase (TEM-10) conferring selective resistance to ceftazidime and aztreonam in clinical isolates of Klebsiella pneumoniae. Antimicrob Agents Chemother 33:1451-6. https://doi.org/10.1128/AAC.33.9.1451
Rice LB, Carias LL, Hujer AM, Bonafede M, Hutton R, Hoyen C, Bonomo RA (2000) High-level expression of chromosomally encoded SHV-1 β-lactamase and an outer membrane protein change confer resistance to ceftazidime and piperacillin-tazobactam in a clinical isolate of Klebsiella pneumoniae. Antimicrob Agents Chemother 44:362-7. http://doi.org/10.1128/aac.44.2.362-367.2000
Rizi KS, Mosavat A, Youssefi M, Jamehdar SA, Ghazvini K, Safdari H, Amini Y, Farsiani H (2020) High prevalence of blaCMY AmpC beta-lactamase in ESBL co-producing Escherichia coli and Klebsiella spp. clinical isolates in the northeast of Iran. J Glob Antimicrob Resist 22:477-82. https://doi.org/10.1016/j.jgar.2020.03.011
Rossolini GM, Mantengoli E (2005) Treatment and control of severe infections caused by multiresistant Pseudomonas aeruginosa. Clin Microbiol Infect 11:17-32. https://doi.org/10.1111/j.1469-0691.2005.01161.x
San N, Aung MS, Urushibara N, San T, Maw WW, Lwin MM, Mar TT, Myint YY, Thu PP, Hlaing MS, Ganesh B (2020) Genetic Diversity of CMY beta-lactamase genes in clinical isolates of Escherichia coli in Myanmar: identification of three novel types and updated phylogenetic classification of bla CMY. Microb Drug Resist 26:497-504. https://doi.org/10.1089/mdr.2019.0234
Sanders CC, Sanders Jr WE (1979) Emergence of resistance to cefamandole: possible role of cefoxitin-inducible beta-lactamases. Antimicrob Agents Chemother 15:792-7. https://doi.org/10.1128/aac.15.6.792
Sharma J, Sharma M, Ray P (2010) Detection of TEM & SHV genes in Escherichia coli & Klebsiella pneumoniae isolates in a tertiary care hospital from India. Indian. J Med Res 132:332-336. PMID: 20847381
Sideraki V, Huang W, Palzkill T, Gilbert HF (2001) A secondary drug resistance mutation of TEM-1 β-lactamase that suppresses misfolding and aggregation. Proc Natl Acad Sci USA 98:283-8. https://doi.org/10.1073/pnas.011454198
Sneha KG, Robin P, Rejish KVJ, DevikaP (2020) Investigating the impact of hospital antibiotic usage on aquatic environment and aquaculture systems: A molecular study of quinolone resistance in Escherichia coli. Sci Total Environ 748: 141538. http://doi.org/10.1016/j.scitotenv.2020.141538
Stadler T, Meinel D, Aguilar-Bultet L, Huisman JS, Schindler R, Egli A, Seth-Smith HM, Eichenberger L, Brodmann P, Hubner P, Bagutti C (2018) Transmission of ESBL-producing Enterobacteriaceae and their mobile genetic elements—identification of sources by whole genome sequencing: study protocol for an observational study in Switzerland. BMJ open 8:e021823. https://doi.org/10.1136/bmjopen-2018-021823
Stewart A, Harris P, Henderson A, Paterson D (2018) Treatment of infections by OXA-48-producing Enterobacteriaceae. Antimicrob Agents Chemother 62:e01195-18. https://doi.org/ 10.1128/AAC.01195-18
Subha A, Ananthan S (2002) Extended spectrum beta lactamase (ESBL) mediated resistance to third generation cephalosporins among Klebsiella pneumoniae in Chennai. Indian J Med Microbiol 20:92. PMID: 17657040
Tzouvelekis LS, Tzelepi E, Tassios PT, Legakis NJ (2000) CTX-M-type β-lactamases: an emerging group of extended-spectrum enzymes. Int J Antimicrob Agents 14:137-42. http://doi.org/10.1016/s0924-8579(99)00165-x
Vakulenko SB, Geryk B, Kotra LP, Mobashery S, Lerner SA (1998) Selection and characterization of β-lactam–β-lactamase inactivator-resistant mutants following PCR mutagenesis of the TEM-1 β-lactamase gene. Antimicrob Agents Chemother 42:1542-8. https://doi.org/10.1128/AAC.42.7.1542
Villegas MV, Correa A, Perez F, Zuluaga T, Radice M, Gutkind G, Casellas JM, Ayala J, Lolans K, Quinn JP, Colombian Nosocomial Resistance Study Group (2004) CTX-M-12 β-Lactamase in a Klebsiella pneumoniae clinical isolate in Colombia. Antimicrob Agents Chemother 48:629-631. https://doi.org/ 10.1128/AAC.48.2.629-631.2004
Wang A, Yang Y, Lu Q, Wang Y, Chen Y, Deng L, Ding H, Deng Q, Zhang H, Wang C, Liu L, Xu X, Wang L, Shen X (2008) Presence of qnr gene in Escherichia coli and Klebsiella pneumoniae resistant to ciprofloxacin isolated from pediatric patients in China. BMC Infect Dis 8:68. http://doi.org/10.1186/1471-2334-8-68
Wu H, Wang M, Liu Y, Wang X, Wang Y, Lu J, Xu H (2016) Characterization and antimicrobial resistance in Klebsiella species isolated from chicken broilers. Int J Food Microbio 232:95-102. http://doi.org/10.1016/j.ijfoodmicro.2016.06.001
Yi T, Kim TG, Cho KS (2015) Fate and behavior of extended-spectrum β-lactamase-producing genes in municipal sewage treatment plants. J Environ Sci Health Part A Tox Hazard Subst Environ Eng 50:1160-1168. https://doi.org/10.1080/10934529.2015.1047673
Yu WL, Pfaller MA, Winokur PL, Jones RN (2002) Cefepime MIC as a predictor of the extended-spectrum β-lactamase type in Klebsiella pneumoniae, Taiwan. Emerg Infect Dis 8:522. http://doi.org/10.3201/eid0805.010346
Zheng D, Yin G, Liu M, Chen C, Jiang Y, Hou L, Zheng Y (2021) A systematic review of antibiotics and antibiotic resistance genes in estuarine and coastal environments. Sci Total Environ 22:146009. https://doi.org/10.1016/j.scitotenv.2021.146009

Table 1

List of primers used for PCR amplification

Specefic gene for amplification		Primer sequence (5’-3’)		Amplicon size	Reference
bla_OXA-48	Forward		TCAACTTTCAAGATCGCA	591 bp	Ibrahim et al. 2014
	Reverse		GTGTGTTTAGAATGGTGA
bla_SHV	Forward		TTAACTCCCTGTTAGCCA	795 bp	Sharma et al. 2010
	Reverse		GATTTGCTGATTTCGCCC
bla_TEM	Forward		ATAAAATTCTTGAAGACGAAA	1080 bp	Sharma et al. 2010
	Reverse		GACAGTTACCAATGCTTAATC
bla_CMY	Forward		TGGAACGAAGGCTACGTA	1007 bp	Ibrahim et al. 2014
	Reverse		GACAGCCTCTTTCTCCACA
bla_CTX-M	Forward		CGCTTTGCGATGTGCAG	550 bp	Villegas et al. 2004
	Reverse		ACCGCGATATCGTTGGT3

Table 2

MIC values for cephalosporin resistant Escherichia coli isolates from different sampling points (expressed in µg/ml)

Antibiotics	H1	H2	H3	F3
Ampicillin	128	256	128	256
Ciprofloxacin	32	64	8-16	32
Cefepime	>128	>256	32	256
Ceftazidime	128	256	128	128
Cefotaxime	>128	256	128	128
Ceftriaxone	>128	256	128	128

MIC: minimum inhibitory concentration; Tested range of antibiotics is 0.125->512 µg/ml

PDF

Version 1

posted 24 Mar, 2022

You are reading this latest preprint version

Genetic diversity and prevalence of extended spectrum beta-lactamase producing Escherichia coli and Klebsiella pneumoniae in aquatic environment receiving untreated hospital effluents

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Study area

Sample collection and processing

Identification of E. coli and K. pneumoniae isolates from samples

Antimicrobial susceptibility testing

Phenotypic detection of ESBL production

Molecular detection of ESBL-encoding genes

Bacterial plasmid isolation and conjugation

Results

Bacterial identification and ESBL detection

Antimicrobial susceptibility testing and MIC of ESBL isolates

Molecular characterization of ESBL encoding genes

Bacterial plasmid conjugation

Discussion

Conclusion

Declarations

References

Tables

Status:

Version 1