Enterovirus D68 infection in children with acute lower respiratory tract infection in China

doi:10.21203/rs.3.rs-1401303/v1

Download PDF

Research Article

Enterovirus D68 infection in children with acute lower respiratory tract infection in China

https://doi.org/10.21203/rs.3.rs-1401303/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

Background

EV-D68 infection related acute flaccid paralysis (AFP) attracts much attention since the outbreak in the USA in 2014. Notably, EV-D68 was detected from a child with acute flaccid paralysis for the first time in China in 2018.

Methods

Based on a multicentre study monitoring viral pathogens of acute lower respiratory tract infection in children in China from May 2017 to December 2019, 10 EV-D68 positive specimens were detected from 3071 samples.

Results

These 10 patients presented with mild diseases and no neurological symptoms and signs. The phylogenetic analysis shows that all 10 obtained sequences belong to subclade B3 which circulates dominantly at present all over the world and shares high identity with strains related to AFP in the USA. Moreover, four EV-D68 strains are successfully isolated and it is worth noting that the isolate in this study is able to infect “neuronal-like” cell line SH-SY5Y which was used to identify the neurotropism of enteroviruses. Further, amino acid and nucleotide sites related to neurovirulence were analyzed, but these analysis results are not enough to explain the ability of our strains to infect SH-SY5Y cells. This suggests that the EV-D68 isolate in China has potential neuropathic capacity.

Conclusions

In conclusion, EV-D68 infection was detected in a small number of children with acute lower respiratory tract infections in China from 2017 to 2019. The genotype of EV-D68 in this study is B3, which has the ability to infect “neuronal-like” cell line SH-SY5Y.

Enterovirus D68

Genetic analysis

Acute lower respiratory tract infection

Child

China

Human enteroviruses (HEVs) belonging to the genus Enterovirus within the family Picornaviridae are single-stranded positive-sense RNA and non-enveloped viruses. HEVs are comprised of 116 enterovirus serotypes and divided into 4 speciess (A-D) [1]. Enterovirus D68 (EV-D68) is a member of enterovirus species D and was first isolated from respiratory samples of children with pneumonia and bronchiolitis in California in 1962. EV-D68 had ever been classified as human rhinovirus 87 due to similar growth environment requirements like rhinovirus [2] and then it was re-identified as EV-D68 based on genotyping in 2002 [3].

The whole genome (~7400 nucleotides) of EV-D68 consists of a single open reading frame coding for a polyprotein. Two untranslated regions (UTR) at each end of the open reading frame coiding region. The 5’-end contains a highly structured internal ribosome entry site (IRES) which initials the translation of the viral RNA and relates to the virulence [4, 5]. The 3’-end containing secondary structure relates to the RNA synthesis [6]. The polyprotein is processed by protease 2A and 3C into 11 proteins (4 structural proteins VP1-4 and 7 functional proteins 2A-C as well as 3A-D).

VP1 sequence is used as a target for EV dectection and classification [7].According to VP1 sequences, EV-D68 could be divided into 4 clades (A-D). Clade B circulated dominantly all over the world though clade D was detected occasionally, while clade A and C were rarely detected [8]. Clade B is further divided into subclade B1/B2/B3. Subclade B1 and B3 dominated during the outbreak in the USA in 2014 and 2018 respectively [9, 10]. In China, subclade B1 was first reported in Hong Kong in 2011 and subclade B3 first appeared in China mainland in 2014 [10, 11]. After 2014, subclade B3 was the main detected subclade in China though there was an upsurge of a novel subclade D3 emerged in China in 2016 [11].

EV-D68 infection had been received extensive attention since the outbreak in 2014 [12]. It was associated with severe lower respiratory tract infections among all age groups, predominantly in children. Several studies showed that nearly 50% hospitalized children with EV-D68 infection needed intensive caring during the outbreak of EV-D68 in the USA [12]. EV-D68 infections were reported in many countries, such as Spain [13], Japan [14], Netherlands [15], Canada [16], England [17], etc. Moreover, an increase of cases with acute flaccid paralysis (AFP) had also been observed during the outbreak of EV-D68 [18]. Of some cases with AFP, EV-D68 was detected as the only etiologic agent. Regrettably, EV-D68 was not detected in cerebrospinal fluid (CSF) of patients with AFP [8]. But EV-D68 was detected from the CSF of two cases with aseptic meningitis and meningoencephalitis in Spain [13]. Recently, SH-SY5Y as neuroblastoma cell line determined which EV-D68 strains are neurotropic and neuropathogenic. David et al. found that EV-D68 was able to replicate in SH-SY5Y cell line [19]. What’s more, Alison et al. found that sialic acid was not essential for EV-D68 strains after 2014 to target motor neuros by retrograde axonal transport [20]. These may provide some hints for the reason of EV-D68 associated with neurological diseases.

There was little data about the prevalence of EV-D68 in China after 2017. Notably, EV-D68 was detected from a case for the first time with AFP in China in 2018 [21]. In this study, we explored EV-D68 infection in patients with acute lower respiratory tract infection (ALRTI) based on a multicenter study of a network monitoring viral pathogens of ALRTI from 7 hospitals of 6 provinces in China during 2017-2019. The clinical characteristics of patients with EV-D68 infection and the genome sequences of EV-D68 strains were analyzed. Additionally, SH-SY5Y cell line was used to identify whether EV-D68 isolates obtained in this study have the ability of infecting neuros.

Patients

The 3071 children patients with ALRTI from a multicenter study including 7 hospitals of 6 provinces (Beijing, Ningxia, Zhejiang, Liaoning, Guizhou, Guangdong) were enrolled into this study. The provincial distribution of 3071 patients was 660 from Beijing, 500 from Ningxia, 450 from Zhejiang, 608 from Guangdong, 440 from Guizhou, and 304 from Liaoning. The annual distribution of 3071 patients is 485 in 2017, 1518 in 2018, and 1068 in 2019. The age of the patient ranges from 1 month old to 16 years and 9 months old. Among the 3071 patients, 1840 were male patients and 1231 were female patients. The diagnosis of ALRTI is based on the criteria established by Pediatrics Society and Respiratory Society, Chinese Medical Association [22]. The specimens including nasopharyngeal swabs and sputum were collected.

EV-68 detection

Viral nucleic acid was extracted by QIAamp MinElute Virus Spin Kit (QIAGEN, Germany). Respiratory viruses including Influenza A, Influenza B, Rhinovirus, Coronavirus NL63/229E/OC43/HKU1, Parainfluenza Virus Type I/II/III/IV, Human Metapneumovirus, Boca Virus, Respiratory Syncytial Virus, Adenovirus Virus, Enterovirus were first screened by Multiplex Real-time PCR Diagnostic Kit Rapid Detection of 16 Speciess of Respiratory Pathogens (Beijing Applied Biological Technologies Co.,Ltd., China).The enterovirus positive specimens were further tested by EV-D68 nucleic acid detection real-time PCR kit (Bioperfectus technologies, China).

Virus isolation and infection assay

All EV-D68 positive specimenswere cultured in Rhabdomyosarcoma (RD) cells. RD cells were maintained in high-glucose Dulbecco’s modified Eagle’s medium (DMEM; Gibco) supplemented with 10% fetal bovine serum (FBS; Gibco). The EV-D68 isolate further infects SH-SY5Y cells. The SH-SY5Y cells were maintained in a 1:1 mixture of DMEM and F-12K (Gibco) medium supplemented with 10% FBS.

Sequence amplification and sequencing

All EV-D68 positive specimens were performed on VP1 sequence sequencing. The EV-D68 isolates were performed on the whole genome sequencing. The strain Beijing-R0132 (Accession Number: KP240936) sequence downloaded from Genbank was referred to design primers (Table 1). SuperScript™ III One-Step RT-PCR System with Platinum™ Taq DNA Polymerase was used to segmentally amplify the sequences. The volume of reaction system is 20 ul, including RNA template 2ul, primer concentration 0.25uM, and the amplification product were sequenced at SinoGenoMax Co., Ltd.

Bioinformatics Analysis

BioEdit v7.2.0 (http://www.mbio.ncsu.edu/BioEdit/page2.html) software was used for identity and diversity analysis of nucleotide and amino acid.

MAFFT (https://www.ebi.ac.uk/Tools/msa/mafft/) software was used for multiple alignment. Phylogenetic trees were generated by MEGA v6.0 (Sudhir Kumar, Arizona State University, Tempe, AZ, USA) software with the neighbour-joining method and the Tajima-Nei model. The reliability of phylogenetic trees was estimated by the bootstrap method with 1000 replicates.

Similarity plot and bootscan analysis were conducted by using Simplot v3.5.1 software(a window size of 200, a step size of 20 and Kimura (2-parameter) distance model with the Fermon strain as a query squence (Accession Number is NC038308).

Clinical Characteristics of Patients with EV-D68 Infection

Among 3071 specimens, ten EV-D68 positive specimens are detected (4 cases from Zhejiang province and 6 cases from Ningxia province). The annual positive specimens of EV-D68 are 1/485 in 2017, 9/1518 in 2018 and 0/1068 in 2019. Four EV-D68 strains (YC17106/NX/CHN/2017, YC18116/NX/CHN/2018, YC18137/NX/CHN/2018, WZ17226/ZJ/CHN/2018) are isolated. Ten VP1 sequences and 4 complete genomes are successfully obtained.

The demographic and clinical characteristics of 10 EV-D68 patients are shown in Table 2. The median age of 10 EV-D68 patients is 32.7 months old (5-92m). Nine patients are male and one patient is female. Nine patients were admitted to the hospital in the summer and autumn.

Among 10 EV-D68 patients, 8 patients were diagnosed with pneumonia and 2 patients with bronchiolitis. No case was diagnosed with severe pneumonia or admitted to the ICU ward. No neurological symptoms and signs were found. All cases had no history of asthma or immunodeficiency. All patients were cured and discharged from hospital.

The patients had common clinical respiratory symptoms, such as cough (100%), dyspnea (50%), stuffy nose (10%). One case with bronchiolitis had diarrhea. Two patients co-infected with 2009H1N1 and respiratory syncytial virus, respectively.

Phylogenetic Analysis

One hundred and sixteen complete genomes of EV-D68 were downloaded from the GenBank database. Based on VP1 sequence typing, 116 VP1 sequences were obtained to construct the phylogenetic tree with 10 VP1 sequences in this study (Accession nubmer: MZ824215-MZ824224).

Ten VP1 sequences from this study share 95.7-99.5% nucleotide identity and 98.0-100.0% amino acid identity with each other. The phylogenetic tree of VP1 sequences (933bp) show that EV-D68 strains could be divided into 4 clades (A-D) and clade B could be further separated into 3 subclades (B1, B2, B3). All 10 VP1 sequences in this study belong to subclade B3 (Figure 1). Moreover, we found in VP1 sequence that clade A and D are characterized by 3-nt deletions at position 418-420 and clade D has another 6-nt insertions at position 916 (Table 3).

Four complete genomes from this study share 96.6-99.1% nucleotide identity in complete genome and 99.3-99.6% amino acid (AA) identity in coding region with each other. Three complete genomes (WZ17226, YC17106, YC18116) are composed of 7335-nt including the 5’-UTR of 701-nt, the coding region of 6567-nt and the 3’-UTR of 67-nt. The strain YC18137 has 4 more nucleotides deletions in the 5’-UTR than three genomes which is similar with the deletions of 5’UTR in the strain USA/FL/2016-19504 (Acession number: KX675261).

Compared with EV-D68 Fermon prototype strain, the nucleotide identity of four complete genomes in this study ranges from 87.2-87.5%. The nucleotide and amino acid identities ranges from 87.3-87.5% and 95.9-96.1% in the coding region respectively. The detailed results show that the nucleotide and AA identity of the structural protein region are more variable than that of the functional protein region. In the structural protein region, the identity of VP1 sequence is the lowest showing the high variabilities of VP1 sequence. In the functional protein region, the AAs of protein 2A is most variable and the AAs of protein 3B is absolutely conserved (AA identity:100%).

In order to verify whether these findings are applicable among different subclades of EV-D68 and other serotypes of enterovirus species D, four complete genomes from this study compared with 8 subclades of EV-D68 and 4 serotypes of enterovirus species D. The results are consistent with the genetic analysis compared with EV-D68 Fermon prototype strain, except that the AA identity of protein 3B presents higher variabilities in different serotypes of enterovirus species D (Table 4).

Recombination analysis

Recombination events easily occurr in enteroviruses among different subclades and serotypes. To explore it, the phylogenetic trees of each protein (VP2-4, 2A-2C, 3A-3D) were constructed. The sequences comprised each subclade of EV-D68 and other serotypes of enterovirus species D such as EV-D70/90/111/120. The result shows that 4 sequences from this study are always in the same cluster with EV-D68 subclade B3 (Figure 2A-J). To confirm this finding, the recombination analysis in Simplot was conducted. The results of similarity plot and bootscan analysis also suggest that no recombination events are found (Figure 2K-L).

Infection in Cell Line SH-SY5Y

David et al. found that EV-D68 subclade B1 strains related to AFP could infect “neuronal-like” cell line SH-SY5Y, but Fermon prototype strain couldn’t [19]. However, the subclade B3 strains which circulated dominantly nowadays were not tested the ability of infecting cell line SH-SY5Y in their study. Four EV-D68 isolates obtained in this study belonged to subclade B3 and share high identity with each other. So the strain WZ17226 was selected as a representative strain for the experiment. The titer of strain WZ17226 was first determined in RD cells in a standard 50% tissue culture infective dose (TCID₅₀) assay and calculated by the Reed-Muench method. The results showed that the viral titer of strain WZ17226 in RD cells was ~10^6.0TCID₅₀/ml by 72h post-infection. Then, the strain WZ17226 was used to infect “neuronal-like” cell line SH-SY5Y and cytopathic effect was observed. The viral titer was ~10^4.4TCID₅₀/ml in SH-SY5Y cells by 72h post-infection (Figure 3). The titer difference between the two cells was statistically significant. This results indicated that the EV-D68 isolate in this study was able to infect neurocyte, but had lower replication ability in SH-SY5Y than RD cells.

Genetic Variation Analysis

The infection in SH-SY5Y cells indicated that the strains in this study has the ability of infecting neurocyte . But the patients in this study didn’t present with any neurological symptoms and signs. In order to investgate whether the sequence differences determin the neurotropism, the complete genome sequences of 9 strains related to AFP (AFP strain) in the USA were downloaded (including 6 subclade B1 strains and 3 subclade B3 strains) and used to analyze the genetic variation of amino acids. Amino acid substitutions in the coding region may have a greater impact on the virulence of the virus. Firstly, the results of the coding region show that there are 31 AA substitutions, including 15/862 AA substitutions in structural protein sequences and 16/1331 in functional protein regions. The AA substitutions in capsid proteins are mostly distributed in VP1 and VP2, while the functional protein 2B and 3B have no AA substitution (Table 5). There was a study showed that 6 AA substitutions (M291T, V341A, T860N, D927N, S1108G and R2005K) related to neurovirulence were found in subclade B1 AFP strains [23]. In this study, these 6 AA substitutions were indeed found in subclade B1 AFP strains in 2014 but not in our four subclade B3 strains, three subclade B3 AFP strains in 2016 as well as one subclade B1 AFP strain in the USA in 2013. Secondly, the noncoding region was analyzed. There were three mutations positions in 5’UTR (127T, 262C, 339T) of subclade B1 strains and other AFP-causing enteroviruses such as EV-D70 [24]. But these three nucleotide substitutions are also not observed in our four strains and subclade B3 AFP strains. The 3’UTR may form a pseudoknot structure which may influence the replication of EV-D68. This structure appeared in all 2014 Chinese strains but not in 2014 American strains [6]. We found that this pseudoknot structure could also be observed in our four subclade B3 strains in 2018 and American subclade B3 AFP strains in 2016. These results suggested that these existing differences in complete genome may not be enough to explain the neurovirulence of EV-D68.

Based on a multicenter study monitoring viral pathogens of ALRTI, we investigated the prevalence of EV-D68 infection in children with ALRTI in parts of China from May 2017 to December 2019. Ten cases with EV-D68 infection were identified among 3071 patients with ALRTI. Additionally, no epidemiological link was found among these patients and this result suggests that there was no outbreak of respiratory tract infection in children caused by EV-D68 during the study period of this project. In China, the peak of EV-D68 appeared every two years since 2014 [11].In this study, the number of EV-D68 cases was 9 in 2018, 1 in 2017 and 0 in 2019. To a certain extent, our results confirmed this trend but the number of cases with EV-D68 infection is too small. In the USA, the outbreak of EV-D68 also happened every two years since 2014 [9, 25]. Since both subclade B1 and B3 were first discovered in Asia before the outbreak in the USA, two studies speculated that the outbreaks of EV-D68 due to subclade B1 and B3 in the USA may originate from strains that emerged in Asia [26, 27]. Further studies are needed to confirm this hypothesis.

Moreover, we paid attention to the different subclades of infection in different age groups. EV-D68 could infect all age groups people, but most EV-D68 strains were from children predominantly and belonged to clade B. All strains from children in this study also belonged to clade B. However, a study showed that all strains from patients (> 18 years old) belonged to clade D in Hong Kong [26]. In 2016, a novel subclade D3 co-circulated with subclade B3 and most subclade D3 strains (11/15) were detected from patients (> 18 years old) in China [11]. These results suggest that clade B is prone to infect children and clade D is prone to infect adults. Multiply alignment of VP1 sequence indicated that clade A and D characterized as 3-nt deletions at position 418–420. Clade D had extra 6-nt insertions at position 916. Further studies are need to explore whether these deletions and insertions contributed to these two clades (B and D) infecting different age groups.

Huang et al. performed a retrospective study of EV-D68-related diseases in Beijing, China during the 2011–2015 periods. Most of patients (11/12) with EV-D68 infection were children. The 83.3% patients (10/12) had fever and no patient presented with AFP [28]. The results of following EV-D68 infection surveillance for ARTI cases in Beijing from 2015–2017 showed that 71.43% patients had fever and no AFP was found among 42 EV-D68 cases, and only 2 patients were admitted to ICU [11]. However, a study in the USA showed that about 50% patients of 277 hospitalized children with EV-D68 infection were admitted to ICU of 277 hospitalized children with EV-D68 infection, and some cases had neurologic signs, including AFP and opsoclonus/myoclonus syndrome [9]. This result indicated that the clinical characteristics of cases with EV-D68 infection in the USA were different from those in China. Some studies showed that patients with asthma or reactive airway disease tended to show severe illness with EV-D68 infection[29]. During the outbreak in the USA in 2018, a study found that the number of admissions for asthma and EV-D68 infection were positively correlated [9], and patients with asthma required intensive care more frequently [12]. A nation-wide study in Japan in 2015 also verified the association between EV-D68 and asthma hospitalizations/mechanical ventilations but didn’t prove a direct relationship between EV-D68 and asthma exacerbation [30]. Moreover, a study in China in 2015 showed that EV-D68 may be associated with a history of recurrent wheezing and asthma exacerbation but cases were too few and they didn’t perform a statistical analysis [31]. In this study, all 10 patients with EV-D68 infection presented with mild disease and had no a history of asthma. Whether asthma is related to the severity of EV-D68 infection in China still needs to be explored.

The replacement of the virus genotype always caused an epidemc. A study showed that a novel clade of EV-D68 was found during the 2014 outbreak in the USA [24]. Furthermore, two another outbreaks of a novel subclade B3 happened in the USA in 2016 [25] and 2018 [9]. Xiang et al. analyzed the genotypes of EV-D68 strains from China in 2014, and found that there was a genotype replacement from 2006–2014 in China, but no outbreak of EV-D68 was reported in China. Then they further analyzed the genome sequences of Chinese EV-D68 strains and American strains in 2014. They found that six coding polymorphisms (M291T, V341A, T860N, D927N, S1108G and R2005K) related to neurovirulence didn’t appear in Chinese strains, and the X loop sequences of the 3’-UTR related to viral replication that should be complementary were not complementary in American strains in 2014. They speculated that these differences may contribute to the different prevalence of EV-D68 between China and the USA [6]. Based on the latest genotyping, EV-D68 strains from China in 2014 were reclassified as subclade B3 [11]. From 2014–2018 in China, the main detected genotype was still subclade B3 and there was no genetic divergence. Moreover, the strains during the outbreak in the USA in 2014 belonged to subclade B1 [10]. According to genetic variation analysis, the differences of gene sequence found by Xiang do exist between subclade B1 and B3 both from China and America. Additionally, subclade B1 and B3 were the predominant genotypes duiring the outbreak in the USA in 2014 and 2018 respectively [9]. Neurological complications occurred in some patients with EV-D68 infection in the two outbreaks. This reminds us that both subclade B1 and B3 could both cause the outbreak of EV-D68 and be associated with neurological complications.

It is worth noting that EV-D68 was the first time detected from a child with acute flaccid myelitis in China in 2018 [21]. This suggested that EV-D68 infection may be associated with neurological complication in China. SH-SY5Y is a “neuronal-like” cell line drevied from neuroblastoma. David et al. was successful to used it as a cell model to identity the neurotropism of EV-D68 strains [19]. We found that EV-D68 isolate (WZ17226) in this study also had the capacity to infect SH-SY5Y and cause cytopathic effect. We further analyzed genetic variations of the strains in these study. Compared with the American subclade B1 and B3 AFP strains, our strains is highly homologous to American subclade B3 AFP strains. Moreover, one study reported that a mouse AFP model was succesfully established by using the strain Beijing-R0132 which belongs to subclade B3 [32]. These results suggest that the strains circulating in China have potential capability to cause neurological complications. It is very necessary to strengthen the surveillance of EV-D68 infection in China.

In conclusion, small number of pediatric cases of ALRTI were associated with EV-D68 infection in China. The patients in this study presented with mild diseases and no neurological symptoms and signs. All 10 EV-D68 strains still belonged to subclade B3. Additionally, the EV-D68 isolate in this study also has the ability to infect “neuronal-like” cell line SH-SY5Y. It reminds us that the EV-D68 strains in China were able to cause severe diseases. Are there other mechanisms for entering nerve cells or the influence of host factors? More studies about the pathogenesis of EV-D68 are needed.

AA: Amino acid

AFP: Acute flaccid paralysis

ALRTI: Acute lower respiratory tract infection

CSF: Cerebrospinal fluid

EV-D68: Enterovirus D68

IRES: Internal ribosome entry site

UTR: Untranslated regions

PCR: Polymerase chain reaction

RD cell: Rhabdomyosarcoma cell

TCID₅₀: 50% tissue culture infective dose

VP: Viral protein

Ethics approval and consent to participate

This study was approved by the Medical Ethics Committee of Beijing Children’s Hospital, Capital Medical University (No. 2017-k-15).

Consent for publication

Not applicable.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Competing interests

The authors declare that they have no conflict of interest.

Funding

This work was supported by the National Natural Science Foundation of China (Grant Number

81971922). Beijing Natural Science Foundation (Grant Number L192014), National Science and

Technology Major Projects (Grant Number 2017ZX10104001-005-010, 2017ZX10103004-004) and

the CAMS Innovation Fund for Medical Sciences (CIFMS) (Grant Number 2019-I2M-5-026). These

sponsors had no role in the study design, data analysis, manuscript preparation, or decision to publish.

Author Contributions

QL, XC and ZX proposed and designed this research. QL, JA, YZ, RW, YD, MZ performed the detection experiments. QL, XC organized and analyzed the data. QL wrote the manuscript and made the Figures and Tables. ZX and XC checked and finalized the manuscript. LL and CL provided clinical sample resources. All authors read and approved the final manuscript.

Acknowledgments

Thanks to all the partners and teachers who helped me with this paper

Simmonds P, Gorbalenya AE, Harvala H, Hovi T, Knowles NJ, Lindberg AM, Oberste MS, Palmenberg AC, Reuter G, Skern T et al: Recommendations for the nomenclature of enteroviruses and rhinoviruses. Archives of Virology 2020, 165(3):793–797.
Savolainen C, Blomqvist S, Mulders MN, Hovi T: Genetic clustering of all 102 human rhinovirus prototype strains: serotype 87 is close to human enterovirus 70. Journal of general virology 2002, 83(Pt 2):333.
Ishiko H, Miura R, Shimada Y, Hayashi A, Nakajima H, Yamazaki S, Takeda N: Human Rhinovirus 87 Identified as Human Enterovirus 68 by VP4-Based Molecular Diagnosis. Intervirology 2002, 45(3):136–141.
Li R, Zou Q, Chen L, Zhang H, Wang Y: Molecular analysis of virulent determinants of enterovirus 71. PLoS One 2011, 6(10):e26237.
Yeh MT, Wang SW, Yu CK, Lin KH, Lei HY, Su IJ, Wang JR: A single nucleotide in stem loop II of 5'-untranslated region contributes to virulence of enterovirus 71 in mice. PLoS One 2011, 6(11):e27082.
Xiang Z, Xie Z, Liu L, Ren L, Xiao Y, Paranhos-Baccalà G, Wang J: Genetic divergence of enterovirus D68 in China and the United States. Scientific reports 2016, 6(1):27800–27800.
Oberste MS, Maher K, Kilpatrick DR, Pallansch MA: Molecular evolution of the human enteroviruses: correlation of serotype with VP1 sequence and application to picornavirus classification. J Virol 1999, 73(3):1941–1948.
Sun J, Hu X-Y, Yu X-F: Current Understanding of Human Enterovirus D68. Viruses 2019, 11(6):490.
Wang H, Diaz A, Moyer K, Mele-Casas M, Ara-Montojo MF, Torrus I, McCoy K, Mejias A, Leber AL: Molecular and Clinical Comparison of Enterovirus D68 Outbreaks among Hospitalized Children, Ohio, USA, 2014 and 2018. Emerging Infectious Diseases 2019, 25(11):2055–2063.
Huang W, Wang G, Zhuge J, Nolan SM, Dimitrova N, Fallon JT: Whole-Genome Sequence Analysis Reveals the Enterovirus D68 Isolates during the United States 2014 Outbreak Mainly Belong to a Novel Clade. Scientific Reports 2015, 5(1).
Shen L, Gong C, Xiang Z, Zhang T, Li M, Li A, Luo M, Huang F: Upsurge of Enterovirus D68 and Circulation of the New Subclade D3 and Subclade B3 in Beijing, China, 2016. Scientific reports 2019, 9(1):6073–6073.
Messacar K, Abzug MJ, Dominguez SR: 2014 outbreak of enterovirus D68 in North America. J Med Virol 2016, 88(5):739–745.
Gonzalez-Sanz R, Taravillo I, Reina J, Navascues A, Moreno-Docon A, Aranzamendi M, Romero MP, Del CM, Perez-Gonzalez C, Perez-Castro S et al: Enterovirus D68-associated respiratory and neurological illness in Spain, 2014–2018. Emerg Microbes Infect 2019, 8(1):1438–1444.
Funakoshi Y, Ito K, Morino S, Kinoshita K, Morikawa Y, Kono T, Doan YH, Shimizu H, Hanaoka N, Konagaya M et al: Enterovirus D68 respiratory infection in a children's hospital in Japan in 2015. Pediatr Int 2019, 61(8):768–776.
Knoester M, Scholvinck EH, Poelman R, Smit S, Vermont CL, Niesters HG, Van Leer-Buter CC: Upsurge of Enterovirus D68, the Netherlands, 2016. Emerg Infect Dis 2017, 23(1):140–143.
Drews SJ, Simmonds K, Usman HR, Yee K, Fathima S, Tipples G, Tellier R, Pabbaraju K, Wong S, Talbot J: Characterization of enterovirus activity, including that of enterovirus D68, in pediatric patients in Alberta, Canada, in 2014. J Clin Microbiol 2015, 53(3):1042–1045.
Kamau E, Harvala H, Blomqvist S, Nguyen D, Horby P, Pebody R, Simmonds P: Increase in Enterovirus D68 Infections in Young Children, United Kingdom, 2006–2016. Emerg Infect Dis 2019, 25(6):1200–1203.
Messacar K, Asturias EJ, Hixon AM, Van Leer-Buter C, Niesters HGM, Tyler KL, Abzug MJ, Dominguez SR: Enterovirus D68 and acute flaccid myelitis—evaluating the evidence for causality. The Lancet Infectious Diseases 2018, 18(8):e239-e247.
Brown DM, Hixon AM, Oldfield LM, Zhang Y, Novotny M, Wang W, Das SR, Shabman RS, Tyler KL, Scheuermann RH: Contemporary Circulating Enterovirus D68 Strains Have Acquired the Capacity for Viral Entry and Replication in Human Neuronal Cells. mBio 2018, 9(5).
Hixon AM, Clarke P, Tyler KL: Contemporary Circulating Enterovirus D68 Strains Infect and Undergo Retrograde Axonal Transport in Spinal Motor Neurons Independent of Sialic Acid. J Virol 2019, 93(16).
Wang X, Zhang P, Li J, Chu Y, Li Z, Yang Y, Li F, Cui S, Huo D, Wang Y et al: Enterovirus D68 in a 6-year-old acute flaccid myelitis case in China, 2018: a case report. BMC Infectious Diseases 2020, 20(1).
China NHC: Guideline for diagnosis and treatment of community-acquired pneumonia in Children (2019 version). Chinese Journal of Clinical Infectious Diseases 2019, 12(01):6–13.
Greninger AL, Naccache SN, Messacar K, Clayton A, Yu G, Somasekar S, Federman S, Stryke D, Anderson C, Yagi S et al: A novel outbreak enterovirus D68 strain associated with acute flaccid myelitis cases in the USA (2012-14): a retrospective cohort study. Lancet Infect Dis 2015, 15(6):671–682.
Zhang Y, Cao J, Zhang S, Lee AJ, Sun G, Larsen CN, Zhao H, Gu Z, He S, Klem EB et al: Genetic changes found in a distinct clade of Enterovirus D68 associated with paralysis during the 2014 outbreak. Virus Evol 2016, 2(1):vew015.
Wang G, Zhuge J, Huang W, Nolan SM, Gilrane VL, Yin C, Dimitrova N, Fallon JT: Enterovirus D68 Subclade B3 Strain Circulating and Causing an Outbreak in the United States in 2016. Sci Rep 2017, 7(1):1242.
Lau SK, Yip CC, Zhao PS, Chow WN, To KK, Wu AK, Yuen KY, Woo PC: Enterovirus D68 Infections Associated with Severe Respiratory Illness in Elderly Patients and Emergence of a Novel Clade in Hong Kong. Sci Rep 2016, 6:25147.
Yip C, Lo J, Sridhar S, Lung D, Luk S, Chan K-H, Chan J, Cheng V, Woo P, Yuen K-Y et al: First Report of a Fatal Case Associated with EV-D68 Infection in Hong Kong and Emergence of an Interclade Recombinant in China Revealed by Genome Analysis. International Journal of Molecular Sciences 2017, 18(5):1065.
Zhang T, Li A, Chen M, Wu J, Huang F: Respiratory infections associated with enterovirus D68 from 2011 to 2015 in Beijing, China. J Med Virol 2016, 88(9):1529–1534.
Moss RB: Enterovirus 68 Infection–Association with Asthma. J Allergy Clin Immunol Pract 2016, 4(2):226–228.
Korematsu S, Nagashima K, Sato Y, Nagao M, Hasegawa S, Nakamura H, Sugiura S, Miura K, Okada K, Fujisawa T: "Spike" in acute asthma exacerbations during enterovirus D68 epidemic in Japan: A nation-wide survey. Allergol Int 2018, 67(1):55–60.
Xiao Q, Ren L, Zheng S, Wang L, Xie X, Deng Y, Zhao Y, Zhao X, Luo Z, Fu Z et al: Prevalence and molecular characterizations of enterovirus D68 among children with acute respiratory infection in China between 2012 and 2014. Sci Rep 2015, 5:16639.
Sun S, Bian L, Gao F, Du R, Hu Y, Fu Y, Su Y, Wu X, Mao Q, Liang Z: A neonatal mouse model of Enterovirus D68 infection induces both interstitial pneumonia and acute flaccid myelitis. Antiviral Research 2019, 161:108–115.

Table 1. Primers for complete genome amplification of EV-D68

Primer	Sequence	Position
EV-D68 F1	5‘-TTAAAACAGCCTTGGGGTTGTT-3’	1-218
EV-D68 R1	5‘-AGCGGATAACGGATAGGTTGT-3’	1-218
EV-D68 F2	5‘-GGTTGTTCCCACTCCAAGG-3’	16-1143
EV-D68 R2	5’-ACCACCATCCTGTACTTCCA-3‘	16-1143
EV-D68 F3	5‘-ATGAAGCAGTAGCCATTGACAA-3’	1039-2228
EV-D68 R3	5‘-AGTGACATAGCCAACATTAGCA-3’	1039-2228
EV-D68 F4-VP1	5‘-TGTAACCCTGATAATACCTTGGAT-3’	2135-2902
EV-D68 R4-VP1	5‘-ACACTAGCATTACTACCTGACTG-3’	2135-2902
EV-D68 F5-VP1	5‘-AGATAAGAACTTTTTCAAATGGACAAT-3’	2648-3446
EV-D68 R5-VP1	5‘-GCACTTGCATCTTGCTATTTG-3’	2648-3446
EV-D68 F6	5‘-TCACTTAGCCACTACAGAGGAG-3’	3332-4499
EV-D68 R6	5‘-GTCTGGAGGCAGGGAATAAATG-3’	3332-4499
EV-D68 F7	5‘-ACATGGCTCTCCAGGAACT-3’	4400-5543
EV-D68 R7	5‘-ATCAGTCAAGTCTCTAAGTGCA-3’	4400-5543
EV-D68 F8	5‘-CACACGCATCTGTTGGAGAA-3’	5458-6590
EV-D68 R8	5‘-AGCATCATAGCCAGTGTAATCA-3’	5458-6590
EV-D68 F9	5‘-CCTTTACGCCACATTTCACAA-3’	6458-7263
EV-D68 R9	5‘-AGAACGAATCTAACCATTTCCG-3’	6458-7263
EV-D68 F10	5‘-CCAGTGATGCCAATGAAGGAG-3’	7050-7335
EV-D68 R10	5‘-GCCCCCAAGTGACCAAAATTT-3’	7050-7335

Table 2. Demographic and clinical characteristics of 10 patients with EV-D68 infection

Characteristics	n=10
Demographics
Median age, m (IQR)	32.5(5-92)
Sex, no(%)
M	9 (90.00)
F	1 (10.00)
Clinical presentation, no. (%)
Cough	10 (100.00)
Fever	0 (0.00)
Dyspnea	5 (50.00)
Rhinocleisis	1 (10.00)
Diarrhea	1 (10.00)
Neurologic	0 (0.00)
Diagnosis, no. (%)
Pneumonia	8 (80.00)
Bronchiolitis (with diarrhea)	2 (20.00）
Past History, no. (%)
Asthma	0 (0.00)
Immunodeficiency	0 (0.00)
PICU admission，no.(%)	0 (0.00)
Hospitalization，d (IQR)	5.6 (4-8)
EV-D68, enterovirus D68; IQR, interquartile range; PICU, pediatric intensive care unit.

Table 3. The VP1 deletions and insertions in clade A and D of EV-D68

	Accession Number	Position 418-420	Position 916
Prototype	NC038308	TGTGGCAGTAAATGGTAATAA	GCCTCACAACA - - - - - - TAGTAACCAC
Clade B	MZ824221	TGTAGCAGTGAATGGTAGTAG	GCCTCATAATA - - - - - - TAGTGACTAC
	MZ824222	TGTAGCAGTGAATGGTAGTAG	GCCTCATAATA - - - - - - TAGTGACTAC
	MZ824223	TGTAGCAGTGAATGGTAGTAG	GCCTCACAATA - - - - - - TAGTGACTAC
	MZ824224	TGTAGCAGTGAATGGTAGTAG	GCCTCATAATA - - - - - - TAGTGACTAC
	KT285320	TGTAGCAGTGAATGGTAGTAG	GCCTCATAATA - - - - - - TAGTGAACAC
	MT791927	TGTAGCAGTGAATGGTAGTAG	GCCTCACAATA - - - - - - TAGTGACCAC
Clade C	KX675261	TGTAGCAGTGAATGGCAGTAG	GCCTCATAATA - - - - - - TAGTGACTAC
	KX255400	TGTGGCAGTGAATGGTAGTAG	GCCTCATAATA - - - - - - TAGTGACCAC
	KX433164	TGTAGCAGTGAATGGTAGTAG	GCCTCGCAATA - - - - - - TAGTGACCAC
	KX384960	TGTGGCAGTGAATGGTAGTAG	GCCTCATAATA - - - - - - TAGTGACCAC
Clade A	MN240495	TGTGGCAGTA - - - AGTAGCAG	GCCTCACAATA - - - - - - TAGTGACCAC
	JX070222	TGTGGCAGTA - - - AGTAGCAG	GCCTCACAATA - - - - - - TAGTGACCAC
	JX101846	TGTGGCAGTA - - - AGTAGCAG	GCCTCACAATA - - - - - - TAGTGACCAC
Clade D	KT764078	TGTGGCAGTA - - - GGTAGCAA	GCCTCATGACATCCGGCTAGTGAATAC
	KT285319	TGTGGCAGTA - - - GGTAGCAA	GCCTCATGACATCCGGTTAGTGAATAC
	KT306743	TGTGGCAGTA - - - GGTAGCAA	GCCTCATGACATCCGGTTAGTGAATAC
	KU242683	TGTGGCAGTA - - - GGTAGCAA	GCCTCATGATATCAGGTTAGTGACCAA
	KF726085	TGTGGCAGTA - - - GGTAGCAA	GCCTCATGATATCAGGTTAGTGACCAA
	MT789751	TGTGGCAGTG - - - GGTAGCAA	GCCTCATGACATCCGGTTAGTGAATAC
	MH341731	TGTGGCAGTG - - - GGTAGCAA	GCCTCATGATATCCGGTTAGTGAATAC
	MH341730	TGTGGCAGTG - - - GGTAGCAA	GCCTCATGATATCCGGTTAGTGAATAC

Table 4. Nucleotide and amino acid identities of four complete genomes in this study compared with different subclades of EV-D68 and four other serotypes of enterovirues species D

Nucleotide identity (%) (Amino acid identity (%))
Region	WZ17226/ZJ/CHN/2018, YC17106/NX/CHN/2017,YC18116/NX/CHN/2018,YC18137/NX/CHN/2018
Region	Fermon	A	B1	B2	B3	C	D1	D2	D3	EV-D111	EV-D94	EV70	EV-120
5'UTR	86.6-86.7	90.5-92.1	97.4-97.8	94.9-95.4	97.9-99	94.5-95.5	90.2-91.2	90.8-92.5	85.7-86.7	71.8-72.1	74.4-75.1	74.2-74.9	——
VP4	87.4-88.4(98.5-98.5)	88.8-89.3(98.5-98.5)	94.2-95.1(98.5-98.5)	91.3-92.2(97.1-97.1)	98.5-99.5(100-100)	90.3-91.3(98.5-98.5)	85.5-85.9(98.5-98.5)	87.4-88.8(98.5-98.5)	85-86.4(98.5-98.5)	77.2-78.2(94.2-94.2)	77.7-79.2(88.4-88.4)	75.3-76.3(92.7-92.7)	75.8-75.8(89.8-89.8)
VP2	86.8-87.5(95.1-95.5)	88.1-88.3(95.9-96.3)	94.4-95.9(97.1-97.5)	92.6-93.5(98.3-98.7)	96.9-99.1(99.5-100)	90.8-91.8(97.5-97.9)	88.1-8.8(96.3-96.7)	90-90.7(95.5-95.9)	87.5-88.1(96.7-97.1)	69.4-69.6(79.2-79.2)	74.1-74.3(86.2-86.6)	68.5-69.2(79.2-79.2)	——
VP3	85.2-85.8(94.0-94.8)	89.2-89.2(96.1-96.5)	94.8-95.4(98.7-99.1)	92.9-93.4(98.7-99.1)	97.1-97.7(99.1-100)	92.4-93.6(98.7-99.1)	89.2-89.5(95.3-95.7)	89.3-90.2(96.1-96.5)	88.3-89(95.3-95.7)	70.6-70.9(80-80.8)	70.9-72(80.8-81.7)	68.5-69.5(78.7-79.5)	——
VP1	85.2-85.4(90.9-91.2)	86.7-87.7(93.8-94.1)	94.8-95.6(97-97.4)	92.4-93(98-98.3)	97.4-98(99-99.3)	90-90.6(94.8-95.1)	85.4-86(92.6-92.9)	86.4-87.1(91.9-92.2)	85.6-86.3(92.2-92.6)	63-63.5(67.9-68.2)	66.8-67(68.9-69.2)	62.4-63.1(67.2-67.2)	62.9-63.1(65.7-65.7）
2A	86.3-89.9(95.9-96.5)	88.2-88.8(96.5-97.9)	94.1-95.6(96.5-97.9)	92-92.2(95.9-97.2)	97.2-97.9(98.6-100)	91.1-92.2(97.2-98.6)	88.6-90.7(95.2-95.9)	89.5-90.7(97.2-97.9)	89.5-90.2(95.9-96.5)	73.4-73.9(83.6-85)	72.1-72.7(83.6-85)	72.1-72.5(78.2-79.5)	——
2B	87.2-87.8(98.9-98.9)	90.5-91.2(100-100)	95.2-95.2(100-100)	92.9-93.2(97.9-97.9)	97.9-99.3(100-100)	89.5-90.2(98.9-98.9)	90.9-92.9(97.9-97.9)	92.2-92.9(100-100)	88.5-89.2(98.9-98.9)	74.4-75(86.8-86.8)	73.4-74.4(86.8-86.8)	69.3-70.3(85.8-85.8)	——
2C	87.6-87.9(96.9-97.5)	90.5-91.1(97.5-98.1)	94.6-95(98.1-98.7)	92.9-93.2(98.1-98.7)	97.8-98.3(99-99.6)	92.4-93.2(98.1-98.7)	89.2-89.7(96.9-97.5)	88.5-90(97.2-97.8)	89-89.7(96.6-97.2)	78-78.6(88.5-89.5)	76.8-77.1(87.9-88.5)	77-77.5(86.7-87.3)	——
3A	89.1-89.8(97.7-97.7)	91.7-92.5(98.8-98.8)	98.1-98.5(100-100)	95.5-95.8(100-100)	98.1-99.2(100-100)	93.2-94.3(100-100)	91-92.5(98.8-98.8)	91.3-92.8(98.8-98.8)	88.7-90.2(96.6-96.6)	79.7-80.5(89.8-89.8)	80.1-80.5(89.8-89.8)	74.9-75.6(88.7-88.7)	——
3B	86.3-87.8(100-100)	89.3-90.9(100-100)	92.4-96.9(100-100)	92.4-93.9(100-100)	95.4-100(100-100)	90.9-92.4(100-100)	86.3-87.8(100-100)	87.8-89.3(100-100)	89.3-90.3(100-100)	71.2-75.7(81.8-81.8)	72.7-75.7(86.3-86.3)	74.2-75.7(86.3-86.3)	——
3C	86.5-86.8(98.3-98.3)	90.5-91(97.8-97.8)	95.9-97.4(99.4-99.4)	93.8-94.5(98.3-98.3)	96.3-98.3(100-100)	91.4-93.6(98..3-98.3)	89-91.2(97.8-97.8)	89.2-90.3(96.7-96.7)	89.9-91.6(98.3-98.3)	74.6-75.2(87.9-87.9)	73.5-74.3(88.5-88.5)	72.8-73.2(83-83)	——
3D	89.4-89.7(97.1-97.8)	91.2-91.8(98-98.2)	96.4-96.8(98.4-99.1)	93.8-94.3(98.9-99.5)	98.1-98.8(99.3-100)	92.5-93.1(98-98.6)	91-91.3(98.2-98.4)	90.8-91.4(97.8-98)	89.7-90.2(97.5-98.2)	77.6-77.8(90.8-91.4)	77.9-78.1(90.3-91)	77-77.8(88.6-89.2)	——
3'UTR	89.2-93.8	90.7-95.3	93.8-98.4	90.7-95.3	95.3-100	90.1-94.3	90.7-95.3	90.7-95.3	83-97.6	60-62.5	61.2-63.7	51.2-53.6	——
Complete genome	87.2-87.5	89.9-90.1	95.7-96	93.4-93.6	97.6-98.5	92.1-92.4	89.2-89.5	89.7-90.3	88.2-88.6	73.1-73.2	74.2-74.2	72-72.3	——
Coding region	87.3-87.5(95.9-96.1)	89.7-89.9(93-97.3)	95.5-95.8(98.3-98.5)	93.3-93.5(98.4-98.6)	97.5-98.2(99.4-99.7)	91.8-92(97.8-98.1)	89-89.3(96.5-96.8)	89.6-90.1(96.7-96.9)	88.5-88.9(96.3-96.6)	73.4-73.5(83.8-84)	74.2-74.4(84.7-84.8)	72-72.4(82-82.2)	——
Structural protein region	86-86.2(93.7-97.8)	88.1-88.3(95.4-95.8)	95.1-95.4(97.6-98)	92.7-93.1(98.2-98.6)	97.4-98.6(99.4-99.6)	91-91.2(97.1-97.4)	87.2-87.6(94.9-95.2)	88.5-88.9(94.6-95)	87.1-87.5(94.9-95.2)	68-68.3(76.1-76.3)	70.8-71.1(78.4-78.8)	67-67.4(75.6-75.8)	——
Fuctional protein region	88.1-88.4(97.3-97.6)	90.7-91(98-98.1)	95.7-96.1(98.6-98.9)	93.4-93.7(98.4-98.7)	97.6-98.5(99.4-99.7)	92.2-92.6(98.4-98.6)	90.2-90.5(97.5-97.8)	90.3-91(97.9-98.2)	89.4-89.8(97.1-97.5)	76.8-76.9(88.7-89.2)	76.3-76.7(88.6-89)	75.2-75.7(86.1-86.5)	——

Table 5 is available in the Supplemental Files section.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

Enterovirus D68 infection in children with acute lower respiratory tract infection in China

Status:

Version 1

Abstract

Background

Methods

Results

Conclusions

Figures

Background

Materials And Methods

Results

Discussion

Conclusion

Abbreviations

Declarations

References

Tables

Additional Declarations

Supplementary Files

Status:

Version 1