M-acetylcholine Receptors Regulate Inflammatory Responses Through Arginases 1/2 in Zebrafish

doi:10.21203/rs.3.rs-1403073/v1

PDF

Research Article

M-acetylcholine Receptors Regulate Inflammatory Responses Through Arginases 1/2 in Zebrafish

https://doi.org/10.21203/rs.3.rs-1403073/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted 03 Mar, 2022

You are reading this latest preprint version

Muscarinic acetylcholine receptors (mAChRs) are widely expressed in parasympathetic effector cells and have been proved to play vital roles in synaptic transmission, smooth muscle contraction, digestive secretion. However, there are relatively few literatures revealing the roles of mAChRs in inflammatory process, and its underlying regulatory mechanisms have not been elucidated. Taking the advantages of live imaging of zebrafish, we found that inhibition of mAChRs resulted in increased neutrophils recruitment and proinflammatory cytokines expression, whereas activation of mAChRs led to opposite outcome. Subsequently, we found that mAChRs regulated the expression of arginases (args), and pharmacological intervention of args level could reverse the effects of mAChRs on neutrophils migration and cytokines expression, suggesting that args are important downstream proteins of mAChRs that mediate its regulation of inflammatory response. In this study, we identified Args as novel downstream proteins of mAChRs in the inflammatory process, provided additional evidence for peripheral immune regulation of cholinergic receptors.

mAChRs

cytokines

neutrophils

args

zebrafish

Neural activity has been shown to dominate multiple central and peripheral inflammatory responses and is essential for maintaining immune homeostasis [1, 2]. As an important neurotransmitter in the neuronal system, acetylcholine (Ach) is synthesized from choline and acetyl-CoA by choline acetyl transferase (ChAT), then is transported and released by vesicular acetylcholine transporter (VAChT) to bind to acetylcholine receptors (AChRs) to transmit neural signals [3]. AChRs have been identified to be expressed in both neuronal and non-neuronal cells, mainly including muscarinic acetylcholine receptors (mAChRs) and nicotinic acetylcholine receptors (nAChRs) [4, 5].

The mAChRs, composed of five main subtypes, M1, M2, M3, M4, and M5, are widely expressed in effector cells innervated by parasympathetic ganglionic fibers, including pancreatic cells [6], keratinocytes [7], intestinal epithelium [8] and most immune cells, such as T cells, B cells and monocytes [9]. These finding suggested that non-neuronal cholinergic systems were involved in the regulation of immune cell function [10]. A few studies have shown that compared with wild type, the expression of pro-inflammatory cytokines such as tumor necrosis factor (Tnf-α), Ifn-γ and Il-6 in splenocytes in mAChRs M1/M5 knockout mice were significantly changed [11, 12] and more antigen-specific antibodies were produced in M1/M5 mutant group [12]. Based on static or in vitro experiments, these studies suggested that mAChRs could regulate immune responses at the cytokines level, but roles of mAChRs in the recruitment of immune cells, especially neutrophils, have rarely been reported, and its potential regulatory mechanisms were not been elucidated. Neutrophils are the most important member type of innate immune cells, accounting for about 40%-60% of the total number of leukocytes [13, 14], which is essential for regulating the inflammatory responses [15, 16]. As a model animal, the optical transparency of juveniles makes zebrafish an ideal model for in vivo imaging to study the neutrophils [17, 18]. Hence, this study intends to explore the effects of mAChRs on the recruitment of neutrophils and also the expression of cytokines in zebrafish.

There are two subtypes of arginases, arginase 1 (Arg1) and arginase 2 (Arg2), which are mainly distributed in organs such as liver, kidney and testes [19]. Recent studies also showed that Arg1 and Arg2 were widely expressed in immune cells [20, 21] and found that the expression of Arg1 could be induced by inflammatory signals including interferons and transforming growth factor-beta (Tgf-β) [19]. Given the role of Args in inflammatory response, we speculated that Args might be involved in the regulation of mAChRs on inflammation.

In this study, we used pharmacological methods to inhibit and activate mAChRs, and found that mAChRs could regulate neutrophils recruitment and cytokines expression using in vivo imaging in zebrafish. We further proved that Args, as a downstream protein of mAChRs, could participate in the regulation of inflammatory response in zebrafish. Here, we used zebrafish to provide additional evidence that cholinergic receptors regulate peripheral immune responses, deepening the link between nervous system and immune functions.

2.1 Experimental animals

Feeding and mating were carried out according to the operating rules of zebrafish BOOK [22]. Wild-type (WT) and transgenic Tg (lyz:EGFP) zebrafish embryos were cultured with Hank’s solution at a constant temperature of 28.5 ℃, pH of 6.5–7.5, and a day-night light cycle of 14H: 10H environment (light at 8:30 in the morning and darkness at 10:30 at night) [23]. We strictly followed the guidelines and regulations of the Animal Resource Center of Anhui Agricultural University (SYXK (Anhui) 2016-007). At the same time, all protocols conformed to the guidelines of the China National Institute for Food and Drug Control for laboratory animals.

2.2 Pharmacological treatment

In the experiment, atropine (HY-B1205, MCE) and bethanechol (HY-B0406, MCE) were used to antagonize and agonize the functions of mAChR, respectively, according to previous studies [24, 25]. After the toxicity was evaluated by zebrafish hatchability, body length and motor activity, atropine (10 µg/L, 100 µg/L) and bethanechol (1 µM/L, 10 µM/L) were selected for the subsequent inflammation experiment. Zebrafish larvae at 5 dpf (days post fertilization) were treated with atropine (10 µg/L, 100 µg/L) and bethanechol (1 µM/L, 10 µM/L) for 3 h respectively to in vivo evaluate their effects on cytokines expression and neutrophils migration. CB1158 (HY-101979, MCE) was used to inhibit the activity of arg1 and arg2 [26]. To verify whether mAChR affects the inflammatory responses through the arg signaling, 5 dpf zebrafish larval were soaked with atropine (100 µg/L), bethanechol (10 µM/L) and CB-1158 (10 µM/L) for 3 h, respectively.

2.3 Morphological observation

Zebrafish embryos of 24 hpf (hours post fertilization) were continuously soaked with atropine (10 µg/L, 100 µg/L) and bethanechol (1 µM/L, 10 µM/L) and the solutions were changed every day. The tail wagging rate (1 min) at 30 hpf; heart rate (20 s) at 48 hpf and 72 hpf; body length at 96 hpf, survival rate during 4 days of larvae were detected using a stereomicroscope. About fifty zebrafish in each group were used in the experiments.

2.4 Behavior test

The motor behavior of larval zebrafish at 5 dpf was assessed by Viewpoint (France) using the photo motor response (PMR) model [17]. The control, atropine (10 µg/L, 100 µg/L), bethanechol (1 µM/L, 10 µM/L) groups were arranged in a 48 wells plate in different experiments, with 16 fish in each group. The experimental procedure was set up as follows: 30 minutes of darkness for dark adaptation, followed by 3 cycles of 5 minutes of light and 5 minutes of dark to monitor the activity of larval zebrafish.

2.5 Tail fin damage and imaging

After larvae of 5–7 dpf were anesthetized with 0.1 g/mL MS-222 solution (Sigma, E10521), the tail fin of the zebrafish was damaged by a surgical blade at the tail pigmented end using a stereo microscope. After the caudal fin injury zebrafish larvae were treated with atropine (10 µg/L, 100 µg/L) and bethanechol (1 µM/L, 10 µM/L). About 30 zebrafish larvae were used in each group. Three hours post injury, the migration of neutrophils in the caudal fin was observed under a fluorescence microscope, and the number of neurophils was analyzed by ImageJ software.

2.6 Lipopolysaccharide (LPS) micro-injection

Zebrafish larvae of 3 dpf were anesthetized with a small amount of 0.1g/mL MS-222 solution, and 50 nl of the prepared LPS (0.2 µg/L, S11060, yuanye) solution was injected into the intraperitoneal of zebrafish larvae with a micro-injection apparatus. After the injection, zebrafish larvae were treated with atropine (10 µg/L, 100 µg/L) and bethanechol (1 µM/L, 10 µM/L). Each group contained 30 zebrafish larvae.

2.7 QPCR

After zebrafish of 5 dpf were continuously soaked in atropine (10 µg/L, 100 µg/L) and bethanechol (1 µM/L, 10 µM/L) for 3 h, 30 zebrafish larvae in each group were collected into EP tubes with 500 µl TRIZOL (Takara, 9108). After sonication of the tissue, total RNAs were extracted using chloroform and isopropanol. Then, the extracted total RNAs were reversely converted to cDNA using a reverse transcription kit and Q-PCR was performed using a commercial kit. Specific primers (Table 1) were used to detect gene expression by RT-qPCR with TB Green® Fast qPCR Mix (Takara, RR430S). Each experiment was carried out 3 times. The experimental data were calculated with 2^−ΔΔct according to previous study [27].

Table 1
Gene name	Sequence (5’-3’)	Application
qtnf-α-F	GCGCTTTTCTGAATCCTACG	Expression analysis
qtnf-α-R	TGCCCAGTCTGTCTCCTTCT	Expression analysis
qil-1β-F	GTACTCAAGGAGATCAGCGG	Expression analysis
qil-1β-R	CTCGGTGTCTTTCCTGTCCA	Expression analysis
qil-6-F	GCTATTCCTGTCTGCTACACTGG	Expression analysis
qil-6-R	TGAGGAGAGGAGTGCTGATCC	Expression analysis
qil-8-F	CCACACACACTCCACACACA	Expression analysis
qil-8-R	CCACTGAATTGTCCTTTCATCA	Expression analysis
qarg1-F	TCCGTTCTCCAAAGGACAGC	Expression analysis
qarg1-R	CTTCACCACACAACCTTGCC	Expression analysis
qarg2-F	GGGGAGATCACAGCTTAGCG	Expression analysis
qarg2-R	AAGGTGAAGTCAGAGGCGTG	Expression analysis
qβ-actin-F	ACGAACGACCAACCTAAACTCT	Expression analysis
qβ-actin-R	TTAGACAACTACCTCCCTTTGC	Expression analysis
Primer designed for cloning and expression analysis in this study.

2.8 Statistical analysis

The GraphPad Prim 9.0 was used to analyze the experiment data. The data were analyzed with one-way ANOVA, t-test and displayed as mean ± SD.

3.1 Atropine and bethanechol showed no obvious effects on the growth and activity of larvae.

In this experiment, we used atropine (mAChRs antagonist) and bethanechol (mAChR agonist) to inhibit or activate the functions of mAChRs to study the effect of mAChRs on the inflammatory responses [28, 29]. In order to determine whether the concentrations of atropine and bethanechol used in the experiments are pharmacologically toxic to zebrafish larvae. Zebrafish of 24 hpf were continuously soaked in atropine (10 µg/L, 100 µg/L) and bethanechol (1 µM/L, 10 µM/L). We assessed growth and development status of larvae by monitoring a series of data such as heart rate, tail wagging, body length, survival rate and activity within 96 hpf of larvae.

Compared with control group, 10 µg/L atropine had no significant effect on the survival rate (96 hpf), tail wagging (30 hpf), heart rate (48 hpf, 72 hpf) and body length (96 hpf) of zebrafish larvae (Fig. 1A-D); 100 µg/L atropine had only a slight increase in heart rate (48 hpf, 72 hpf) (Fig. 1B); The overall morpha of the juveniles in atropine group observed by stereomicroscope was not significantly different from the control group (Fig. 1E). Compared with control group, 1 µM/L bethanechol also had no significant effect on the survival rate (96 hpf), tail wagging (30 hpf), heart rate (48 hpf, 72 hpf), and body length (96 hpf) of the larvae (Fig. 2A-D); 10 µM/L bethanechol also only slightly increased the heart rate (Fig. 2B); The overall morpha of larvave observed by stereomicroscope in bethanechol group was not significantly different from control group (Fig. 2E). In addition, we detected the activity of zebrafish larvave by PMR experiments using a behavioral monitor. Compared with control group, atropine and bethanechol treatment had no significant effect on the activity of zebrafish larval under both light and dark conditions (Fig. 1F and 2F).

Together, these results indicated that concentrations of atropine (10 µg/L and 100 µg/L) and bethanechol (1 µM/L, 10 µM/L) we used in the study had no significant effect on the basic physiological functions of zebrafish larvae.

3.2 Inhibition of mAChRs increased neutrophils recruitment and proinflammatory cytokine levels

Neutrophils are important members of the innate immune system and are essential for host immune defense. We induced acute inflammation by damaging the caudal fin of transgenic zebrafish Tg(lyz:EGFP) (5 dpf) labeled with fluorescent neutrophils, and assessed whether inhibition of mAChRs affected neutrophils migration towards the inflammatory site by in vivo imaging. The results showed that 10 µg/L atropine treatment had no significant effect on the migration of neutrophils to injury, but 100 µg/L atropine treatment significantly increased this process (Fig. 3A left and 3B). Meanwhile, we found that there was no statistical difference in the number of neutrophils in the statistical area between the treatment group and the control group without caudal fin injury (Fig. 3A right and 3C), indicating that the increase in neutrophils recruitment caused by mAChRs inhibition is indeed due to the enhancement of its inflammatory response ability, rather than the differences in the initial number of neutrophils in the caudal fins between groups.

Expression of pro-inflammatory cytokines is a key event in the inflammatory process and is often used to assess inflammation levels. After LPS microinjection, zebrafish larvae were treated with atropine (10 µg/L, 100 µg/L) for 3h, and then the cytokines expression were detected. The results showed that the expression of pro-inflammatory cytokines il-1β and il-8 were significantly increased after 10 µg/L atropine treatment (Fig. 3D). Compared with the control group, tnf-α, il-1β, il-6 and il-8 levels in 100 µg/L atropine group were significantly increased (Fig. 3D). These results suggested that mAChRs suppression significantly up-regulated the levels of pro-inflammatory cytokines in zebrafish.

Overall, we demonstrated that inhibition of mAChRs in zebrafish up-regulates inflammatory responses by up-regulating neutrophils migration and increasing proinflammatory cytokines levels.

3.3 Activation of mAChRs decreased neutrophils migration and proinflammatory cytokines levels.

According to the above experimental design, we explored whether activation of mAChRs could down-regulated neutrophils migration and pro-inflammatory cytokines levels. There was no significant difference in the number of neutrophils in a certain area of the uninjured caudal fin between the treated and control groups (Fig. 4A right and 4C). However, the number of neutrophils migrating at the site of caudal fin injury in 1 µM/L and 10 µM/L bethanechol groups was significantly decreased compared with control group (Fig. 4A left and 4B). Compared with control group, the 1 µM/L bethanechol treatment down-regulated the levels of tnf-α, il-1β, il-6 (Fig. 4D), but had no significant effect on il-8 (Fig. 4D), and the levels of tnf-α, il-1β, il-6 and il-8 were all significantly decreased in the 10 µM/L bethanechol group (Fig. 4D).

In conclusion, we demonstrate that mAChR activation in zebrafish down-regulated inflammatory responses by reducing neutrophils migration and decreasing proinflammatory cytokines levels.

3.4 The mAChRs regulated the level of arg1 and arg2 in zebrafish larvae.

The above results indicated that inhibition or activation of mAChRs regulated the expression of cytokines, and Args have also been shown to be involved in the regulation of inflammatory processes in mice. Therefore, we wondered whether mAChRs have effects on the expression of arg1/2 in zebrafish.

In the experiment, we found that LPS injection significantly increased the expression of arg1 and arg2 in zebrafish. Compared with the LPS group, the levels of arg1 and arg2 in 10 µg/L atropine group were not significantly changed (Fig. 5A), but the levels of arg1 andarg2 in the 100 µg/L atropine group were significantly up-regulated (Fig. 5A); In addition, we found that 1 µM/L and 10 µM/L bethanechol significantly down-regulated the expression of arg1 and arg2 induced by LPS (Fig. 5B).

3.5 The args reversed the inflammatory increase caused by inhibition of mAChRs.

Here, we aim to prove whether args was involved in the regulation of mAChRs on inflammatory responses in zebrafish. In the experiment, we used an inhibitor, CB-1158, to inhibit args expression and found that CB-1158 (10 µM/L) could significantly decrease the level of args induced by inhibition of mAChRs in larvae (Fig. 5A). Then, we found that inhibition of args significantly down-regulated the increase in neutrophils migration towards the injured fin caused by atropine treatment, but inhibition of args could not further decrease the reduction in neutrophils recruitment induced by bethanechol treatment (Fig. 6A left and 7A left). There was no significant difference in the number of neutrophils in statistical area of the uninjured caudal fin between the treated and control groups (Fig. 6A right, 6C and 7A right, 7C). Similarly, the levels of tnf-α, il-1β, il-6 and il-8 were significantly decreased in the atropine and CB-1158 dual treatment groups compared with the atropine group (Fig. 6D). However, CB-1158 treatment only further significantly decreased the reduction of il-1β levels induced by bethanechol treatment (Fig. 7D), while tnf-α, il-6 and il-8 levels did not change significantly (Fig. 7D).

In conclusion, inhibition of args could reverse the increase of neutrophils migration and cytokines expression caused by inhibition of mAChRs to a certain extent in zebrafish, but the inflammatory response induced by activation of mAChRs could not be significantly altered.

As a G protein-coupled receptor, mAchRs, composed of multiple subunits (M1, M2, M3, M4, M5), can participate in a variety of life activities such as nerve signal transduction [30]. Recent studies showed that five subtypes of mAchRs were expressed in T cells, B cells and other immune cells [9]; In M1/M5 receptor knockout mice, the secretion levels of pro-inflammatory cytokines were changed [31]. These results demonstrated that the non-neuronal cholinergic system was involved in the regulation of immune cell function. In general, there are relatively few reports on the role of mAchRs in systemic immune response, and almost no reports on the role of mAchRs in the dynamic behavior of peripheral blood neutrophils and other immune cells, and its potential regulatory mechanism is still unclear. In this study, we took advantage of zebrafish larval transparency and in vivo imaging to explore the role of mAchRs in inflammatory response and investigate whether mAchRs regulate inflammation through arginase in zebrafish.

We used atropine (an antagonist of mAChRs) and bethanechol (an agonist of mAChRs) to inhibit or activate mAChRs to study the roles of mAChRs in inflammatory response. The results showed that inhibition of mAChRs up-regulated neutrophils migration and cytokines expression (Fig. 3A and 3D), while activation of mAChRs down-regulated neutrophils recruitment and cytokines expression (Fig. 4A and 4D) in the caudal fin injury model of zebrafish larvae. Taken together, these results suggested that pharmacological interventions of mAchRs could regulate inflammatory responses in zebrafish. We know that there are nine kinds of subtypes of mAChRs in zebrafish, and in this part of the study, we only interfered with the function of mAChRs by pharmacological means. Therefore, we can not provide evidence for which receptor subtypes play a more important role in inflammation, especially neutrophil migration, although we did experiment with RNA interference of some subtypes (data not shown). We will investigate this question further by CRISPR/Cas9 knockdown of specific receptor subtypes.

Arginase is widely expressed in a variety of immune cells and has been shown to play important roles in immune response [19]. Therefore, we speculated that mAchRs might affect the inflammatory process by regulating Args in zebrafish. Our results showed that LPS injection induced increased expression of arg1 and arg2, suggesting that arg1 and arg2 were positively correlated with inflammatory response, and inhibition of mAChRs could further promote the up-regulation of arg1 and arg2 levels during this process, while activation of mAchRs reduced the expression of arg1 and arg2 (Fig. 5A and 5B). The regulatory effect of mAchRs on arg1 and arg2 is basically similar to the effect on cytokines expression and neutrophils migration. Next, we wondered if mAChRs could modulate the inflammatory response by modulating arg1 and arg2 in zebrafish. We inhibited the expression of arg1 and arg2 by CB-1158, and found that inhibition of arg1 and arg2 significantly reversed the increase of neutrophils migration and cytokines expression induced by supression of mAChRs (Fig. 6A and 6D). However, inhibition of arg1 and arg2 could not further down-regulate the reduction of neutrophils migration and cytokines expression induced by activation of mAChRs (Fig. 7A and 7D), which might be due to the fact that arg1 and arg2 were already at a very low expression level during activation of mAChRs. Our study for the first time found the association between mAchRs and Args, and concluded that mAChRs regulate inflammatory responses in zebrafish by regulating arg1 and arg2 levels. Admittedly, in this study, we have not proved how mAchRs regulate arg1 and arg2 expression, and it is a worthwhile question to find out which other proteins are involved in this regulation process.

Our study shows that mAchRs, as an important component of cholinergic anti-inflammatory pathway, played roles in in vivo recruitment of neutrophils and secretion of pro-inflammatory cytokines in zebrafish, providing new theoretical evidence for the immune research of mAchRs.

We conclude that mAchRs significantly affect neutrophils migration and pro-inflammatory cytokines expression by regulating arg1 and arg2 levels in zebrafish.

Acknowledgements

This work was supported by the National Natural Science Foundation of China ( 31701027), the Major special science and technology project of Anhui Province (202103b06020023).

Author’s Contribution

All authors participated in the experimental design, experimental research, analysis of experimental results, data analysis, and the writing of the first draft of the paper. Da-long Ren is the creator and director of the project, directing experimental design, data analysis, thesis writing and revision. All authors read and agree to the final text.

Availability of data and materials

Not applicable.

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no conflict of interest.

Pavlov VA, Chavan SS, Tracey KJ: Molecular and Functional Neuroscience in Immunity. In Annual Review of Immunology, Vol 36.Volume 36. Edited by Littman DR, Yokoyama WM; 2018: 783-812: Annual Review of Immunology].
Chavan SS, Pavlov VA, Tracey KJ: Mechanisms and Therapeutic Relevance of Neuro-immune Communication.Immunity 2017, 46:927-942.
Picciotto MR, Higley MJ, Mineur YS: Acetylcholine as a neuromodulator: cholinergic signaling shapes nervous system function and behavior.Neuron 2012, 76:116-129.
Paleari L, Grozio A, Cesario A, Russo P: The cholinergic system and cancer.Seminars in Cancer Biology 2008, 18:211-217.
Mitsushima D, Sano A, Takahashi T: A cholinergic trigger drives learning-induced plasticity at hippocampal synapses.Nature Communications 2013, 4.
Rodriguez-Diaz R, Dando R, Jacques-Silva MC, Fachado A, Molina J, Abdulreda MH, Ricordi C, Roper SD, Berggren PO, Caicedo A: Alpha cells secrete acetylcholine as a non-neuronal paracrine signal priming beta cell function in humans.Nat Med 2011, 17:888-892.
Grando SA, Kist DA, Qi M, Dahl MV: Human keratinocytes synthesize, secrete, and degrade acetylcholine.J Invest Dermatol 1993, 101:32-36.
Hirota CL, McKay DM: Cholinergic regulation of epithelial ion transport in the mammalian intestine.British Journal of Pharmacology 2006, 149:463-479.
Wessler I, Kirkpatrick CJ: Acetylcholine beyond neurons: the non-neuronal cholinergic system in humans.British Journal of Pharmacology 2008, 154:1558-1571.
Besedovsky HO, del Rey A: Immune-neuro-endocrine interactions: facts and hypotheses.Endocr Rev 1996, 17:64-102.
Kawashima K, Fujii T, Moriwaki Y, Misawa H: Critical roles of acetylcholine and the muscarinic and nicotinic acetylcholine receptors in the regulation of immune function.Life Sci 2012, 91:1027-1032.
Fujii T, Mashimo M, Moriwaki Y, Misawa H, Ono S, Horiguchi K, Kawashima K: Expression and Function of the Cholinergic System in Immune Cells.Front Immunol 2017, 8:1085.
Kolaczkowska E, Kubes P: Neutrophil recruitment and function in health and inflammation.Nature Reviews Immunology 2013, 13:159-175.
Ley K, Hoffman HM, Kubes P, Cassatella MA, Zychlinsky A, Hedrick CC, Catz SD: Neutrophils: New insights and open questions.Science Immunology 2018, 3.
Nathan C: Neutrophils and immunity: challenges and opportunities.Nat Rev Immunol 2006, 6:173-182.
Herrero-Cervera A, Soehnlein O, Kenne E: Neutrophils in chronic inflammatory diseases.Cellular & Molecular Immunology 2022.
Liu W, Zhang L, Sun S, Tang LS, He SM, Chen AQ, Yao LN, Ren DL: Cordycepin inhibits inflammatory responses through suppression of ERK activation in zebrafish.Developmental and Comparative Immunology 2021, 124.
Shelef MA, Tauzin S, Huttenlocher A: Neutrophil migration: moving from zebrafish models to human autoimmunity.Immunological Reviews 2013, 256:269-281.
Lemos H, Huang L, Prendergast GC, Mellor AL: Immune control by amino acid catabolism during tumorigenesis and therapy.Nat Rev Cancer 2019, 19:162-175.
Arlauckas SP, Garren SB, Garris CS, Kohler RH, Oh J, Pittet MJ, Weissleder R: Arg1 expression defines immunosuppressive subsets of tumor-associated macrophages.Theranostics 2018, 8:5842-5854.
Grzywa TM, Sosnowska A, Matryba P, Rydzynska Z, Jasinski M, Nowis D, Golab J: Myeloid Cell-Derived Arginase in Cancer Immune Response.Front Immunol 2020, 11:938.
Westerfield M: The Zebrafish Book. A Guide for the Laboratory Use of Zebrafish (Danio rerio), 4th Edition. .University of Oregon Press, Eugene 2000.
Ren DL, Sun AA, Li YJ, Chen M, Ge SC, Hu B: Exogenous melatonin inhibits neutrophil migration through suppression of ERK activation.J Endocrinol 2015, 227:49-60.
Maeda S, Xu J, Kadji FMN, Clark MJ, Zhao JW, Tsutsumi N, Aoki J, Sunahara RK, Inoue A, Garcia KC, Kobilka BK: Structure and selectivity engineering of the M-1 muscarinic receptor toxin complex.Science 2020, 369:161-+.
Liu L, Rittenhouse AR: Pharmacological discrimination between muscarinic receptor signal transduction cascades with bethanechol chloride.British Journal of Pharmacology 2003, 138:1259-1270.
Steggerda SM, Bennett MK, Chen J, Emberley E, Huang T, Janes JR, Li W, MacKinnon AL, Makkouk A, Marguier G, et al: Inhibition of arginase by CB-1158 blocks myeloid cell-mediated immune suppression in the tumor microenvironment.J Immunother Cancer 2017, 5:101.
Ren DL, Wang XB, Hu B: Circadian gene period1b regulates proinflammatory cytokine expression through NF-κB signalling in zebrafish.Fish Shellfish Immunol 2018, 80:528-533.
Palacios-Filardo J, Udakis M, Brown GA, Tehan BG, Congreve MS, Nathan PJ, Brown AJH, Mellor JR: Acetylcholine prioritises direct synaptic inputs from entorhinal cortex to CA1 by differential modulation of feedforward inhibitory circuits.Nature Communications 2021, 12.
Prathumsap N, Ongnok B, Khuanjing T, Arinno A, Maneechote C, Apaijai N, Chunchai T, Arunsak B, Shinlapawittayatorn K, Chattipakorn SC, Chattipakorn N: Acetylcholine receptor agonists provide cardioprotection in doxorubicin-induced cardiotoxicity via modulating muscarinic M2 and α7 nicotinic receptor expression.Translational Research 2021.
Kubo T, Fukuda K, Mikami A, Maeda A, Takahashi H, Mishina M, Haga T, Haga K, Ichiyama A, Kangawa K, et al.: Cloning, sequencing and expression of complementary DNA encoding the muscarinic acetylcholine receptor.Nature 1986, 323:411-416.
Fujii YX, Tashiro A, Arimoto K, Fujigaya H, Moriwaki Y, Misawa H, Fujii T, Matsui M, Kasahara T, Kawashima K: Diminished antigen-specific IgG1 and interleukin-6 production and acetylcholinesterase expression in combined M1 and M5 muscarinic acetylcholine receptor knockout mice.Journal of Neuroimmunology 2007, 188:80-85.

No competing interests reported.

PDF

Version 1

posted 03 Mar, 2022

You are reading this latest preprint version

M-acetylcholine Receptors Regulate Inflammatory Responses Through Arginases 1/2 in Zebrafish

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials And Methods

2.1 Experimental animals

2.2 Pharmacological treatment

2.3 Morphological observation

2.4 Behavior test

2.5 Tail fin damage and imaging

2.6 Lipopolysaccharide (LPS) micro-injection

2.7 QPCR

2.8 Statistical analysis

3. Results

3.1 Atropine and bethanechol showed no obvious effects on the growth and activity of larvae.

3.2 Inhibition of mAChRs increased neutrophils recruitment and proinflammatory cytokine levels

3.3 Activation of mAChRs decreased neutrophils migration and proinflammatory cytokines levels.

3.4 The mAChRs regulated the level of arg1 and arg2 in zebrafish larvae.

3.5 The args reversed the inflammatory increase caused by inhibition of mAChRs.

4. Discussion

5. Conclusion

Declarations

References

Competing Interests

Status:

Version 1