1. Animals
Adult (3months, weighing 22-25g) and aged (21months, weighing 28-36g)male C57BL/6 mice were obtained from Beijing SPF Animal Technology Company (Beijing, China). Animals were housed in a temperature- and humidity-controlled room, 2-4 mice per cage, with a standard 12–12 light/dark cycle. They were fed food and water ad libitum. All animals were acclimatized to the environment for one week before the experiment and were fixed cage mates throughout the acclimation and testing periods. Each experimental group consisted of 5-12 mice, and mice in the same cage were in the same treatment group. The experimental animal procedures were approved by the Animal Care Committee of the Chinese People’s Liberation Army General Hospital (Beijing, China). All animal experiments were carried out in accordance with the current laws of China and the National Institutes of Health Guide for the Care and Use of Laboratory Animals.
2. Drugs
The artificial cerebrospinal fluid (ACSF) vehicle contained 140 mM NaCl, 3.0 mM KCl, 2.5 mM CaCl2, 1.0 mM MgCl2, and 1.2 mM Na2HPO4. LPS (Sigma, St. Louis, MO, USA) was dissolved in ACSF (1000ng/mL).
Riluzole (Cayman Chemical Company, USA) was first dissolved in dimethylsulphoxide (DMSO; Fish Scientific, NJ) to 100 mM (27 mg/ml) and then diluted in saline to 0.4 mg/ml with gentle warming. It (4 mg/kg) was then intraperitoneally injected 2h before Morris Water Maze (MWM) acquisition training or LPS microinjection. The same concentration of DMSO (1.6%) was used as solvent control.
3. Experimental design and groups
The experiments were carried out between 8:00 am and 6:00 pm. All mice were sacrificed by deep sodium pentobarbital anesthesia (100 mg/kg) for obtaining the tissue. The following sets of experiments were performed.
Experiment 1: Detection EAAT3 expression in the hippocampus of adult and aged mice
Six adult and six aged mice were randomly selected as Adult and Old groups. Animals were decapitated, and their hippocampi were removed for western blot analysis.
Experiment 2: The establishment of mice with hippocampus EAAT3 knockdown
Recombinant adeno-associated viral (rAAV) vectors were microinjected into the mouse hippocampus by stereotactic technique to construct the hippocampal EAAT3 knockdown model. After receiving bilateral hippocampal microinjection of RNA interference vector (RNAi), 36 adult mice were randomly divided into six groups (n=6 for each): CON (immediately after microinjection, Day 0), D1, D7, D14, D21, and D28. The mice were used to obtain hippocampal tissue for RT-qPCR and Western blot analysis.
Twenty adult mice were randomly separated into two groups according to receiving rAAV-shRNA-NC (NC) or rAAV-shRNA-mSLC1A1 (RNAi) (n=10): NC group, and RNAi group. The spontaneous activities of mice were observed by an Open field test (OFT) 21 days after microinjection in the hippocampus. Five mice in each group were randomly selected to perform brain immunofluorescence after OFT.
Experiment 3: Effect of LPS on hippocampal EAAT3 knockdown mice and mechanism
Adult mice were randomly assigned to four groups according to whether they received rAAV-shRNA-NC (NC), rAAV-shRNA-mSLC1A1 (RNAi), ACSF/LPS (n=12): NC+ACSF group, NC+LPS group, RNAi+ACSF group, and RNAi+LPS group.
Sixteen days after microinjection in the hippocampus, four groups of mice received MWM training for 5 days. Twenty-one days after microinjection in hippocampus, all mice received intracerebroventricular microinjection of ACSF or LPS. After 24h, mice were subjected to the MWM probe test. Six mice in each group were used for harvesting the hippocampus for western blot analysis; in other mice brain tissues were dissected for Golgi-Cox Staining after the behavioral observation.
Experiment 4: Effect of Riluzole on LPS-induced cognitive impairment in the old mice
The old mice were randomly divided into four groups according to whether they received DMSO, Riluzole, or LPS treatment (n=8 in each group): Old+DMSO, Old+Riluzole, Old+DMSO+LPS, and Old+Riluzole+LPS. The mice in Old+DMSO+LPS and Old+Riluzole+LPS received an intraperitoneal injection of DMSO or Riluzole 2 days before LPS microinjection for consecutive 3 days. The probe test for reference memory was conducted 1 day after LPS administration, and the hippocampus was obtained for western blot analysis after the test.
4. Construction of hippocampal EAAT3 knockdown mouse model mediated by shRNA
Four potential different shRNA sequences (shRNA-mSLC1A1-1~4) targeting mSLC1A1 and the negative control shRNA (shRNA-NC) were designed and synthesized to construct rAAV vectors respectively named rAAV-shRNA-SLC1A1-1~4 and rAAV-shRNA-NC by Gemma Gene Company (Suzhou, China). To identify the most effective shRNA sequence that could knockdown EAAT3 in the hippocampus, we screened 4 different sequences to infect the HT-22 cell line, finding that rAAV-shRNA-SLC1A1-2 displayed the lowest EAAT3 expression level by RT/PCR and western blot (Suppl. Fig. 1).
For stereotactic injection of rAAV vector into the bilateral hippocampus, mice were anesthetized with pentobarbital sodium (70mg/kg) and placed on brain stereotaxic apparatus (RWD Life Science, Shenzhen, China). After exposing the skull via an incision, two small holes were drilled for injection. The stereotactic coordinates were 2.1 posterior, ± 1.7 lateral, and 2.0 ventral from bregma. Injection speed was 50nl/min, and the needle was kept in place for an additional 15 minutes before it was slowly withdrawn. RNAi group and RNAi+LPS group received bilateral hippocampal microinjection of rAAV-RNAi at 1μL per side (1×1013TU/mL), while the NC group and NC+LPS group received an equal volume of negative control rAAV-NC.
5. Open field test
To evaluate the effects of hippocampal injection of rAAV-RNAi on spontaneous activity in mice, an open field test was carried out 21 days after bilateral hippocampal rAAV-RNAi injection. Mice were placed in the corner of an opaque plastic box (50×50×30cm) in which the base was equally divided into 16 parts (4×4). A camera was set up right above the box to record all the activities of the mice. The parameters such as total moving distance, moving speed, and times of grid crossing were recorded for 5 min and analyzed by the ANY-MAZE system. The open field was cleaned with 5% ethyl alcohol and allowed to dry between tests.
6. Establishment of LPS-induced cognitive impairment model
The LPS-induced cognitive impairment mouse model was performed according to the previously described protocol [7]. LPS was administered via the intracerebroventricular (i.c.v.) route; the stereotactic coordinates were 0.5 posterior, ± 1.0 lateral, and 2.0 ventral from bregma. After anesthesia with pentobarbital sodium (65-70 mg/kg ip), mice received 2μL LPS microinjection.
7. MWM test
The MWM test, a hippocampal-dependent test of spatial learning and memory for rodents, was performed as previously described [25] with minor modifications. The water maze was a stainless steel circular pool (diameter 125cm, high 50cm) with a white inner wall, filled with opaque water containing skimmed milk powder at 22 ± 1.0 ℃ (water depth 25cm).
The pool with automatic visual tracking cameras on the ceiling can record the whereabouts of mice. The pool was divided into four equal quadrants Ⅰ, Ⅱ, Ⅲ, and Ⅳ. An escape platform (diameter 10cm) fixed in the first quadrant (target quadrant) was submerged below the water surface 1cm. The spatial learning was evaluated through a 5-day repetitive trial. Mice were randomly released into the pool facing the wall and trained to find the platform within 60s. When the mouse failed to find the platform, it was guided to it. All mice were given four trials (once per quadrant; swim-start position randomized) each day and were allowed to stay on the platform for 10s. After the daily session, mice were dried under a heater and returned to the home cage.
Animals underwent LPS microinjection 24 h after the final acquisition trial, and a probe trial was conducted by removing the hidden platform to assess spatial reference memory 24 h after the microinjection. Total swimming distance, average speed, platform-site crossings, the times of entering the target quadrant (original platform quadrant), and time in the target quadrant were recorded. Each mouse was placed in the pool for 60 s at a time, and the starting point of entry was the third quadrant (opposite to the first quadrant).
8. Real-time reverse transcription polymerase chain reaction (RT-qPCR)
Total cellular RNA samples from mouse hippocampus were extracted using the TrizolTM Reagent (Invitrogen, USA). RT-PCR was performed using the ThermoScript RT-PCR System (Invitrogen). Primers used for amplifying SLC1A1 were: 5'- AAGAACCCTTTCCGCTTTG -3' (sense) and 5'- TTGCCGAACTGGACGAGA -3' (antisense); GAPDH primers were: 5'- CCTTCATTGACCTCAACTACATGG -3' (sense) and 5'- CTCGCTCCTGGAAGATGGTG -3' (antisense).
9. Western blot
The total protein and membrane protein were extracted from hippocampal tissue of the mice using a Whole Protein Extraction Kit (KGP250, KeyGEN, Nanjing, China) and a Membrane Protein and Cytoplasmic Protein Extraction Kit (KGP350, KeyGEN, Nanjing, China), respectively. The protein concentrations were then determined by BCA Protein Assay (KeyGEN, Nanjing, China). Equal amounts (30 μg) of proteins were separated by SDS-PAGE and transferred to a polyvinylidene fluoride membrane (Millipore, Billerica, MA, USA). The membrane was blocked with 5% skim milk for 2h at room temperature, then incubated overnight at 4°C with the following primary antibody: rabbit anti-EAAT3 (1:1,000; Cell Signaling Technology), rabbit anti-AMPA Receptor 1 (GluA1) (1:1,000; Cell Signaling Technology), rabbit anti-Phospho-GluA1-Ser845 (1:1,000; Cell Signaling Technology), rabbit anti-GAPDH (1:1000, Abcam) and rabbit anti-β-actin antibody (1:1000, Cell Signaling Technology). after which, it was washed three times (5 min each) in Tris-buffered saline-Tween 20 (TBST) buffer, incubated in the goat anti-rabbit horseradish peroxidase (HRP)-conjugated secondary antibody (1:2000 in TBST buffer) at room temperature for 1h, and washed again. The optical densities of each protein band were measured with ImageLab software (Bio-Rad). Each experiment was repeated at least four times. Relative expression levels of proteins were normalized to β-actin.
10. Fluorescence immunohistochemistry
The brain tissue of mice was fixed with 4% paraformaldehyde for 2 days and then embedded in paraffin. Coronal 3μm sections were prepared and stained with fluorescence immunohistochemistry. First, paraffin sections were dewaxed and placed in the EDTA buffer (pH8.0) to repair the antigen. Second, sections were washed in 0.01% Triton X-100 in phosphate-buffered saline (PBS-T) and blocked with 3% hydrogen peroxide for 15 min at room temperature. Then, samples were incubated overnight at 4℃ in the appropriate primary antibody, anti-EAAT3 (1:400; Cell Signaling Technology). Next, the sections were incubated with the appropriate fluorescent secondary antibody, anti-rabbit IgG (1:400; ZF-0513), for 30 min at 37℃. After washing out the secondary antibodies, sections were incubated with 4',6-diamidino-2-phenylindole (DAPI) for nuclear staining. Immunofluorescence was captured with a scanning confocal microscope.
11. Golgi-Cox Staining
The Golgi-Cox method is one of the most effective techniques for studying the morphology of neuronal dendrites and dendritic spines [26]. The brains of mice were quickly removed and rinsed with double distilled water and were stained with the FD Rapid Golgi Stain™ kit (FD Neuro Technologies, Ellicott City, MD, USA) according to manufacturer’s instructions. Coronal slices (100 µm thickness) were obtained by using a cryostat (Leica, Wetzlar, Germany), and then were placed on a gelatin-coated microscope slide, stained and dehydrated. Images were taken by using an Eclipse Ci-L microscope (Nikon, Japan) and Image-Pro Plus 6.0 software. Sholl analyses were performed using the ImageJ 1.51K Sholl plugin. Spine density was estimated as the number of spines per 10 µm of dendrite length. The number of dendrites was estimated by counting dendritic intersections with multiple circular regions of interest centered on the cell soma with a spacing of 10 μm.
12. Statistical analysis
All data were analyzed by an observer who was blinded to the experimental protocol. Fisher exact probability method was used for descriptive analyses. Statistical comparisons between and within groups were made by two-way ANOVA, followed by a Tukey test where necessary. For acquisition training, data were analyzed using two-way ANOVA (treatment × trial time) with repeated measures (trial days) followed by the Bonferroni post hoc test. For all other data, two-way ANOVA was used. The results of behavioral counting were expressed as median (first quartile, third quartile), and the other results were expressed as mean ± standard error (SE); P values <0.05 were considered as statistically significant.