FUNDC1 Mediated Mitophagy in Epileptic Hippocampal Neuronal Injury Induced by Magnesium-free Fluid

doi:10.21203/rs.3.rs-1419740/v1

Download PDF

Research Article

FUNDC1 Mediated Mitophagy in Epileptic Hippocampal Neuronal Injury Induced by Magnesium-free Fluid

https://doi.org/10.21203/rs.3.rs-1419740/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Mitophagy plays a key role in epileptic neuronal injury, and recent studies have shown that FUNDC1 plays an important role in regulating mitophagy. However, the specific effect of FUNDC1 on neuronal damage in epilepsy is unknown. In this study, we investigated the role of FUNDC1 in mitophagy and neuronal apoptosis using a hippocampal neuronal culture model of acquired epilepsy (AE) in vitro. We found that mitophagy levels were significantly increased in this model, as indicated by elevated LC3A/B ratios. FUNDC1 overexpression using lentiviral vectors enhanced mitophagy, whereas FUNDC1 down-regulation using lentiviral vectors impaired this process. Overexpression of FUNDC1 significantly decreased AE-induced ROS, enhanced cell viability, reduced oxidative stress, and reduced neuronal apoptosis in epileptic hippocampus, while FUNDC1 down-regulation caused the opposite effect. In conclusion, we demonstrated that FUNDC1 is an important modulator of AE-induced neuronal apoptosis by controlling mitophagy function.

FUNDC1

Mitophagy

Apoptosis

Epilepsy

Epilepsy is a serious chronic neurological disease, which leads to transient brain dysfunction due to sudden abnormal discharges of neurons in the brain, which is characterized by occasional, repetitive and spontaneous, and can be accompanied by cognitive dysfunction, anxiety and depression and other well disorders, seriously affecting the lives of loyalists, causing a huge economic burden to families and society (Kaneko et al., 2017; Lotze and Tracey, 2005). Epidemiological studies have shown that there are currently approximately 65 million patients with epilepsy worldwide(Das et al., 2020). Although there have been a large number of studies on the pathogenesis of epilepsy in recent years, the mechanisms involved in the development of epilepsy have not been clarified. Seizures can damage mitochondria, mainly manifested as mitochondrial cristae swelling and disruption of membrane integrity, while mitochondrial dysfunction can also lead to seizures (Chuang et al., 2004; Qiu et al., 2013). Autophagy is also closely related to epilepsy. Studies have confirmed the presence of abnormalities in autophagy in the brain tissue of experimental epileptic animals and epileptic patients(Yasin et al., 2013). McMahon et al found a significant decrease in the level of cellular autophagy after knockout of the At97 gene in mice, resulting in recurrent spontaneous seizures in mice(Mcmahon et al., 2012).

Mitophagy, as a selective autophagy, has been considered to be a potential mechanism responsible for regulating mitochondrial quality, mainly through autophagosome formation and autophagosome and lysosome fusion to selectively remove mitochondria with intracellular structural damage and dysfunction or degrade unnecessary normal mitochondria, prevent the accumulation of harmful products such as ROS, while ensuring the normal function of mitochondria, and play a key role in meeting cellular energy needs and maintaining the balance of the intracellular environment. Notably, dysfunctional, mainly defective mitophagy is involved in the pathophysiology of various human diseases, including cardiovascular diseases, neurodegenerative diseases, cancer, autoimmune diseases and aging(Wang and Shen, 2020).

FUNDC1, as a mitochondrial outer membrane protein in mammalian cells under hypoxia, is accumulated by interacting with ER-mitochondria contact sites, acting through LIR motifs binding to the autophagy marker LC3. Under hypoxia, FUNDC1 is phosphorylated at tyrosine 18 and serine 13 by SRC kinase and CK2, which reduces its affinity for LC3; however, dephosphorylation by PGAM5 or other yet to be identified phosphatases largely increases its interaction with LC3 or other autophagy genes, thereby initiating mitophagy (Roperto et al., 2019), but the mechanism by which FUNDC1-mediated mitophagy plays a role in the transfer of epileptogenic hippocampal neurons in magnesium-free exterior fluid is not clear.

In this study, we used an in vitro hippocampal neuron epilepsy model to further clarify the role of FUNDC1-mediated mitophagy in the development of epilepsy by intervening FUNDC1 expression by lentiviral re-extraction of Lenti-FUNDC1 and Lenti-FUNDC1-shRNA.

Animal and Experimental Reagents

Healthy SD rats within 24 hours of birth, SPF grade (Zhengzhou University, China). Reagents: magnesium-free external solution (2.5 mmol/L KCl, 145 mmol/L NaCl, 10 mmol/L glucose, 0.002 mmol/L glycine ,2 mmol/L CaCl₂ and 10 mmol/L HEPES, pH 7.4)(Blair et al., 2006; Kiese et al., 2017): normal extracellular solution (magnesium free external solution + 1 mmol/L MgCl₂); RNA kit (Invitrogen, America); reverse transcription kit(Yeasen, Shanghai ,China); TUNEL kit (Roche, Germany); DHE kit (Beyotime, China), TMRE kit (Beyotime, China) NSE antibody (Abcam, UK); FUNDC1 antibody (Sigma, America), LC3B antibody (Abcam,UK); lentiviral empty vector Lenti-pGV, overexpression of FUNDC1 lentiviral empty vector Lenti-FUNDC1, low-expression FUNDC1 lentiviral vector Lenti-FUNDC1-ShRNA (GeneChem, Shanghai ,China).

Culture of Primary Hippocampal Neurons

All animal protocols were approved by the Animal Care and Utilization Committee of Zhengzhou University, China, confirming that all animal studies and experimental manipulations were in strict compliance with international animal research guidelines.

The hippocampal tissue of SD rats with24 hours after birth was isolated under aseptic conditions, the surface blood vessels were removed and cut into tissue blocks and transferred to a Petri dish, digested with 0.125% trypsin and added with implantation culture medium to terminate digestion, the supernatant was discarded, resuspended and washed and added with implantation culture medium to make cells. Neuronal cells were seeded in 6-well cell culture plates previously coated with L-poly at a density of 3.5×10⁵cells/ml and cultured in a 37 ° C incubator with 5% CO2 for 4 h before the implantation culture medium was replaced with the maintenance culture medium. Maintenance medium was changed in half every 2 days. The purity of hippocampal neuro was detected by immunohistochemical staining, and the next experiment was performed when the purity was > 95%.

Experimental Design

After discarding the maintenance culture medium, rat hippocampal neurons were rinsed three times with magnesium-free external solution and cultured with magnesium-free external solution for 3 h to induce hippocampal neuron epilepsy model.

Primary hippocampal neurons were randomly divided into: (1) control group (CON group): neurons were treated with normal extracellular solution for 3 h; (2) magnesium-free induction group (AE group): neurons were treated with magnesium-free external solution for 3 h: (3) Lenti-pGV group (negative control group): neurons were successfully transfected by Lenti-pGV and continued to be cultured with maintenance medium and treated with magnesium-free external solution for 3 h: (4)Lenti-FUNDC1 group (overexpression FUNDC1 group): neurons were successfully transfected by Lenti-FUNDC1 and continued to be cultured with maintenance medium, and neurons were treated with magnesium-free external solution for 3 h. (5) Lenti-FUNDC1-shRNA group (low expression FUNDC1 group): neurons were successfully transfected by Lenti-FUNDC1-shRNA and continued to be cultured with maintenance medium and treated with magnesium-free external solution for 3 h. In each group, after treatment with normal cell extract or magnesium-free extract for 3 h, culture with maintenance culture medium was continued for 24 h before the next experiment (Table 1).

Table 1 Processing flow of neuronal cells in each group
Group	Lentiviral transfection	Modeling	After modeling
CON	None, normal culture	Normal extracellular solution treatment for 3h	Maintenance medium for 24h
AE	None, normal culture	Magnesium-free external solution treatment for 3h
NC	Transfected with Lenti-pGV	Magnesium-free external solution treatment for 3h
LV-FUNDC1	Transfection with Lenti + FUNDC1	Magnesium-free external solution treatment for 3h
Sh-FUNDC1	Transfection with Lenti + FUNDC1 + shRNA	Magnesium-free external solution treatment for 3h

NSE staining

Neuronal cells were seeded into 24-well plates with cell coverslips for culture, and neuronal purity identification was performed using NSE staining on day 7. The maintenance medium of each well was aspirated and discarded, rinsed twice with PBS buffer, fixed with 4% paraformaldehyde for 30 min, broken with 0.2% Triton X-100 for 5 min, and incubated with 10% goat serum for 1 h. NSE primary antibody (1:200) was added and incubated overnight at 4 ° C. The primary antibody was aspirated and discarded, rinsed with PBS, and the secondary antibody was added and incubated for 1 h in the dark. After rinsing with PBS, 10 μl of anti-fluorescence attenuation mounting medium containing DAPI was added to the slide, and the cells were removed from the slide and covered on the slide. Ten fields were randomly selected and observed under a fluorescence microscope to calculate the positive rate of NSE positive cells and take the mean value, that is, neuronal purity.

QPCR

Total RNA was extracted from hippocampal neurons by columnar extraction, followed by reverse transcription of cDNA using a reverse transcription kit and cDNA to RNA conversion using a QPCR kit with the following primer sequences:

Table 1 The primer sequences for QRT-PCR.

Gene	Sequences
LC3-F	GCACAGCATGGTGAGTGTAT
LC3-R	GAAGGTTTCTTGGGAGGCATAG
FUNDC1-F	AGGTGGTGGTTTTCTTCTTCTACAG
FUNDC1-R	ATGTTCTGCTTGATAAAGTCTGTTG
GAPDH-F	GACAACTTTGGCATCGTGGA
GAPDH-R	ATGCAGGGATGTTCTGG

LC3: microtubule-associated proteins 1A/1B light chain 3

CCK8 Assay

CCK8 is a widely used method for cell proliferation and cytotoxicity determination based on water-soluble tetrazolium salts. The maintenance culture medium was removed and CCK8 solution was added in the dark and incubated at 37 ° C for 90 min in the dark. The absorbance was measured at 450 nm to calculate cell viability.

TMRE Assay

The changes of mitochondrial membrane potential in early stage were determined by TMRE to determine the status of early apoptosis. The culture medium was sucked and discarded, rinsed with PBS, added with TMRE staining working solution in the dark, incubated at 37 ° C for 30 min, and rapidly imaged under a fluorescence microscope to maintain the same exposure.

TUNEL Assay

Apoptosis was detected by terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) assay. The reptile containing primary neurons was fixed with 4% paraformaldehyde for 1 h, and the membrane was broken with 0.2% Triton X-100 for 10 min. Neurons were mixed with TUNEL reaction solution for 1 h at 37 ° C and reacted with POD for 1 h at 37 ° C, DAB substrate was added, and the reaction was performed for 1 min at room temperature, followed by counterstaining with hematoxylin for several seconds, gradient dehydration for 2 min, xylene transparency for 10 min, and mounting with neutral resin. Apoptotic cells were observed under a fluorescence microscope, and the number of positive cells was calculated.

Determination of ROS

Intracellular superoxide anion levels were determined by DHE to determine cellular oxidative stress levels. The culture medium was sucked and discarded, rinsed with PBS, added with DHE staining working solution in the dark, incubated at 37°C for 30 min, and rapidly imaged under a fluorescence microscope to maintain the same exposure.

Cell Immunofluorescence

Immunofluorescence was used to examine whether the magnesium-free induced in vitro epilepsy model induced Fundc1 recruitment to mitophagy and expression of Fundc1 and LC3B. After fixation with 4% paraformaldehyde for 30 min, the membrane was broken with 0.2% Triton X-100 for 5 min and incubated with 10% goat serum for 1 h, followed by incubation with goat anti-FUNDC1 (1:200; Sigma) and goat anti-LC3B (1:200; Abcam) overnight at 4 °C. The primary antibody was aspirated and discarded, rinsed with PBS, and the secondary antibody was added and incubated for 1 h in the dark. After rinsing with PBS, 10 μl of anti-fluorescence attenuation mounting medium containing DAPI was added to the slide, and the cells were removed from the slide and covered on the slide. Observe under a fluorescence microscope and maintain the same exposure setting.

Infection with Lentiviral Vectors

Lentivirus-transfected neuronal cells Hippocampal neurons were placed on 6-well plates at a density of 3 x 10⁵ cells/ml, and after 5 days of culture, neuronal cells were transfected using Lenti-pGV, Lenti-FUNDC1, and Lenti-FUNDC1-shRNA, respectively, at a multiplicity of infection of 10. After 12 hours of culture, the culture medium containing lentiviral vectors was discarded and normal culture medium was added; after 72 hours of culture, the infection efficiency was observed using a fluorescence microscope, and the next intervention and detection were performed.

Statistical processing

All results were expressed as mean ± standard deviation (SD) and analyzed using GraphPad Prism 8 software version 3.0. One-way analysis of variance was used for comparison. P values < 0.05 were considered statistically significant.

FUNDC1 overexpression attenuated AE-induced neuronal apoptosis

QPCR was used to detect the expression of FUNDC1 to confirm the infection efficiency of the lentiviral vector. Pretreatment with Lenti-FUNDC1 increased FUNDC1 expression and pretreatment with Lenti-FUNDC1-shRNA decreased FUNDC1 expression compared with control (Fig. 1A). Neuronal survival was significantly reduced in the AE group compared with the control group as determined by the CCK8 assay (Fig. 1B). FUNDC1 overexpression using Lenti-FUNDC1 could attenuate AE-induced neuronal death, whereas downregulation of this protein using Lenti-FUNDC1-shRNA exacerbated AE-induced neuronal death (Fig. 1B). Statistically, there was no significant difference between the AE group and negative control groups (Fig. 1B).

Early mitochondrial membrane potential was determined by TMRE to determine early apoptosis, and normal cells showed bright red fluorescence after TMRE staining. Neuronal apoptosis was significantly increased in the AE group (Fig. 2A). However, overexpression of FUNDC1 attenuated AE-induced neuronal apoptosis, whereas downregulation of FUNDC1 exacerbated this process (Fig. 2A). There was no significant difference between the AE group and negative control group (Fig. 2A).

The apoptosis cell was measured by TUNEL assay. Neuronal apoptosis was significantly increased in the AE group (Fig. 2B). However, overexpression of FUNDC1 attenuated AE-induced neuronal apoptosis, whereas downregulation of FUNDC1 exacerbated this process (Fig. 2B). There was no significant difference between the AE group and negative control group (Fig. 2B).

FUNDC1 overexpression enhanced AE-induced mitophagy

LC3A/B ratio was significantly higher in the AE group than in the control group (Fig. 3). Relative to the AE group, overexpression of FUNDC1 increased the LC3A/B ratio, whereas its downregulation decreased this ratio (Fig. 3). No difference was found between the AE group and negative control group (Fig. 3). To further evaluate the effect of FUNDC1 on mitophagy, neurons were immunohistochemically stained for FUNDC1 and LC3B. We found that the expression of these proteins was increased in AE compared with controls (Fig. 3).

Overexpression of FUNDC1 further increased LC3B expression (Fig. 4). In contrast, down-regulation of FUNDC1 reduced LC3B expression (Fig. 4). There was no significant difference between the AE group and negative control group (Fig. 4). Together, these data suggest that mitophagy levels are regulated by FUNDC1.

FUNDC1 overexpression attenuated AE-induced intracellular ROS production

Compared with the control group, the level of intracellular ROS was increased in the AE group. FUNDC1 overexpression significantly reduced intracellular ROS levels compared with the AE group (Fig. 5). In contrast, downregulation of FUNDC1 had the opposite effect, exacerbating the defects observed in the AE response. There was no significant difference the AE group and negative control group (Fig. 5).

In recent years, more and more literature studies have found that autophagy is inseparable from neuronal injury caused by epilepsy, and autophagy has an important regulatory role in controlling neuronal cell death (Glatigny et al., 2019; Nikoletopoulou and Tavernarakis, 2018; Wongyoung et al., 2019); the application of microscopy in hippocampal tissues of patients with refractory temporal lobe epilepsy revealed that damaged mitochondria accumulate abnormally. Studies have reported that: in hippocampal tissue samples from patients with refractory epilepsy found: a large number of abnormal accumulation of damaged mitochondria with neuronal death around hippocampal neurons, presumably related to diminished mitophagy during seizures (Wu et al., 2018). And recent studies have also shown that defective mitophagy is sufficient to cause epilepsy pathogenesis (2020; Mcmahon et al., 2012; Xu et al., 2016).

Mitophagy refers to the whole process of selective removal of injured or abnormal mitochondria by lysosomes by the body through autophagic mechanisms(Fu et al., 2019; Shefa et al., 2019). Studies have shown that mitophagy is closely related to epilepsy pathogenesis. Early studies showed that loss of mitochondrial membrane potential is a signal for mitophagy (Lemasters, 2005; Twig et al., 2008). FUNDC1 mediates selective mitophagy by interacting with LC3 through LIR to couple with the core autophagy machinery (Liu et al., 2012).

This study showed that low expression of FUNDC1 resulted in decreased mitophagy, increased neuronal apoptosis, and increased oxidative stress levels, and overexpression of FUNDC1 increased neuronal mitophagy and reduced apoptosis with oxidative stress exerting a protective effect on neurons. FUNDC1 can promote mitophagy by interacting with mitochondria and recruiting LC3 to the mitochondrial surface (Wang, 2010). In this study, we showed that overexpression of FUNDC1 significantly increased the total amount of mitophagy marker LC3B in magnesium-free epileptic hippocampal neurons, and we also found that overexpression of FUNDC1 significantly decreased AE-induced ROS and reduced neuronal apoptosis in epileptic hippocampus, while low expression of FUNDC1 exerted the opposite effect. This suggests that overexpression of FUNDC1 can protect neurons from apoptosis and attenuate AE-induced neuronal damage, and FUNDC1 may play a protective role in epileptic hippocampal neurons by regulating mitophagy.

Acknowledgements We thank the Academy of Medical Sciences of Zhengzhou University for supporting the translational medicine platform.

Author Contributions Authors YZ (Yinna Zhang)and YL (Yajun Lian)participated in the conception and design of the study; XL (Xiaolei Lian) performed the statistical analysis; YZ (Yinna Zhang), HS (Hanqing Sheng), RF (Rui Feng) performed the experiments; YZ (Yinna Zhang) wrote the manuscript. All authors contributed to the revision of the manuscript and read and approved the submitted version.

Funding This study was supported by a grant from the National Natural Science Foundation of China (Grant No: 81771397).

Compliance with Ethical Standards

Conflicts of interest The authors have no conflicts of interest to declare.

Ethical Standards All applicable international, national, and/or institutional guidelines for the care and use of animals were ethically approved.

(2020). Correction to: Mitophagy Reduces Oxidative Stress Via Keap1 (Kelch-Like Epichlorohydrin-Associated Protein 1)/Nrf2 (Nuclear Factor-E2-Related Factor 2)/PHB2 (Prohibitin 2) Pathway After Subarachnoid Hemorrhage in Rats. Stroke 51, e57.
Blair, R.E., Deshpande, L.S., Sombati, S., Falenski, K.W., Martin, B.R., and DeLorenzo, R.J. (2006). Activation of the cannabinoid type-1 receptor mediates the anticonvulsant properties of cannabinoids in the hippocampal neuronal culture models of acquired epilepsy and status epilepticus. J Pharmacol Exp Ther 317, 1072-1078.
Chuang, Y., Chang, A., Lin, J., Hsu, S., and Chan, S. (2004). Mitochondrial Dysfunction and Ultrastructural Damage in the Hippocampus during Kainic Acid–induced Status Epilepticus in the Rat. Epilepsia 45.
Das, A., Cash, S.S., and Sejnowski, T.J. (2020). Heterogeneity of Preictal Dynamics in Human Epileptic Seizures. IEEE Access PP, 1-1.
Fu, W.Y., Liu, Y., and Yin, H. (2019). Mitochondrial Dynamics: Biogenesis, Fission, Fusion, and Mitophagy in the Regulation of Stem Cell Behaviors. Stem Cells Int 2019.
Glatigny, M., Moriceau, S., Rivagorda, M., Ramos-Brossier, M., Nascimbeni, A.C., Lante, F., Shanley, M.R., Boudarene, N., Rousseaud, A., Friedman, A.K., et al. (2019). Autophagy Is Required for Memory Formation and Reverses Age-Related Memory Decline. Curr Biol 29, 435-+.
Kaneko, Y., Pappas, C., Malapira, T., Vale, F., Tajiri, N., and Borlongan, C. (2017). Extracellular HMGB1 Modulates Glutamate Metabolism Associated with Kainic Acid-Induced Epilepsy-Like Hyperactivity in Primary Rat Neural Cells. Cell Physiol Biochem 41, 947-959.
Kiese, K., Jablonski, J., Hackenbracht, J., Wrosch, J.K., Groemer, T.W., Kornhuber, J., Blumcke, I., and Kobow, K. (2017). Epigenetic control of epilepsy target genes contributes to a cellular memory of epileptogenesis in cultured rat hippocampal neurons. Acta Neuropathol Commun 5, 79.
Lemasters, J.J. (2005). Perspective - Selective mitochondrial autophagy, or mitophagy, as a targeted defense against oxidative stress, mitochondrial dysfunction, and aging. Rejuv Res 8, 3-5.
Liu, L., Feng, D., Chen, G., Chen, M., Zheng, Q.X., Song, P.P., Ma, Q., Zhu, C.Z., Wang, R., Qi, W.J., et al. (2012). Mitochondrial outer-membrane protein FUNDC1 mediates hypoxia-induced mitophagy in mammalian cells. Nat Cell Biol 14, 177-185.
Lotze, M.T., and Tracey, K.J. (2005). High-mobility group box 1 protein (HMGB1): nuclear weapon in the immune arsenal. Nature Reviews Immunology 5, 331-342.
Mcmahon, J., Huang, X., Yang, J., Komatsu, M., Yue, Z., Qian, J., Zhu, X., and Huang, Y. (2012). Impaired Autophagy in Neurons after Disinhibition of Mammalian Target of Rapamycin and Its Contribution to Epileptogenesis. Journal of Neuroscience the Official Journal of the Society for Neuroscience 32, 15704.
Nikoletopoulou, V., and Tavernarakis, N. (2018). Regulation and Roles of Autophagy at Synapses. Trends Cell Biol 28, 646-661.
Qiu, X.X., Cao, L.L., Yang, X., and Chi, Z.F. (2013). Alteration of mitochondrial fission and fusion in hippocampus of rats with status epilepticus. Journal of Shandong University(Health Sciences).
Roperto, S., Russo, V., Falco, F.D., Rosati, A., and Roperto, F. (2019). FUNDC1-mediated mitophagy in bovine papillomavirus-infected urothelial cells. Veterinary Microbiology 234.
Shefa, U., Jeong, N.Y., Song, I.O., Chung, H.J., Kim, D., Jung, J., and Huh, Y. (2019). Mitophagy links oxidative stress conditions and neurodegenerative diseases. Neural Regen Res 14, 749-756.
Twig, G., Elorza, A., Molina, A.J.A., Mohamed, H., Wikstrom, J.D., Walzer, G., Stiles, L., Haigh, S.E., Katz, S., Las, G., et al. (2008). Fission and selective fusion govern mitochondrial segregation and elimination by autophagy. Embo J 27, 433-446.
Wang, J.A. (2010). Preclinical and clinical research on inflammation after intracerebral hemorrhage. Prog Neurobiol 92, 463-477.
Wang, L., and Shen, H.M. (2020). Seeing is believing: a novel tool for quantitating mitophagy. Cell Research.
Wongyoung, Lee, Sung, Hyun, and Kim (2019). Autophagy at synapses in neurodegenerative diseases. Archives of pharmacal research.
Wu, M.Q., Liu, X.Y., Chi, X.S., Zhang, L., Xiong, W.X., Chiang, S.M.V., Zhou, D., and Li, J.M. (2018). Mitophagy in Refractory Temporal Lobe Epilepsy Patients with Hippocampal Sclerosis. Cell Mol Neurobiol 38, 479-486.
Xu, X., Hu, Y.D., Xiong, Y., Li, Z.G., Wang, W., Du, C., Yang, Y., Zhang, Y.K., Xiao, F., and Wang, X.F. (2016). Association of Microtubule Dynamics with Chronic Epilepsy. Mol Neurobiol 53, 5013-5024.
Yasin, S.A., Ali, A.M., Tata, M., and Picker…, S. (2013). mTOR-dependent abnormalities in autophagy characterize human malformations of cortical development: evidence from focal cortical dysplasia and tuberous sclerosis. Acta Neuropathologica 126, 207-218.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

FUNDC1 Mediated Mitophagy in Epileptic Hippocampal Neuronal Injury Induced by Magnesium-free Fluid

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

FUNDC1 overexpression attenuated AE-induced neuronal apoptosis

FUNDC1 overexpression enhanced AE-induced mitophagy

FUNDC1 overexpression attenuated AE-induced intracellular ROS production

Discussion

Declarations

References

Additional Declarations

Status:

Version 1