1.1 Study population
The study population was selected from KBD endemic areas of Shaanxi province, China. A biological specimen library was created from blood samples drawn from 226 KBD patients and 248 healthy subjects (Table 1). All the study participants received prudent radiographic examination. The national diagnosis criteria of KBD (WS/T207-2010) was used to select patients with KBD. Individuals with genetic bone and cartilage diseases, arthritis related disease and other skeletal disorders were excluded from this study. Individuals who met the selection criteria were recruited to participate in the study after submitting their signed informed consent. The proposed study design met the approval of the Human Ethics Committee of Xi'an Jiaotong University, People's Republic of China.
1.2 Quantifying the mRNA expression in KBD patients and chondrocytes
Total RNA from KBD patients and controls (n=8 in each group), as well as chondrocytes (n=3 in each group), was extracted using the Trizol KIT (Life Technologies, Carlsbad, CA). RNA extracts were reverse-transcribed into cDNA using the RevertAidTM First Strand cDNA Synthesis Kit (MBI, Fermentas, Vilnius, Lithuania) following the manufacturer's instructions. Relative quantification of GPX3, GPX1 and GPX4 mRNA was performed by iQe5 quantitative real-time PCR Detection Systems (qRT-PCR) (Bio-Rad, Philadelphia, PA) with β-actin as a reference. The sequences of primers are listed in Table 2. qRT-PCR was performed in a 20 μL reaction mixture containing cDNA (1.6 μL), each primer(0.8μL), 2×SYBR Premix Ex Taq Ⅱ (10μL) (Takara, Mountain View, CA), and ddH2O (6.8 μL) using the TaqMan method (94°C for 2 min, and 40 cycles of 94°C for 10 s and 72°C for 30 s). All reactions were performed in duplicate. Relative expression levels of GPX3, GPX1 and GPX4 mRNAs were normalized to β-actin and analyzed by iQe5 software (version 2.0, Bio-Rad, Philadelphia, PA).
1.3 Quantitative methylation analysis
1.3.1 The design and synthesis of primers
Primers covering CpGs for quantitative methylation analysis were designed by Agena's software (http://www.epidesigner.com/index.html) and synthesized by Liuhe Huada Gene Technology Co., Ltd (Beijing, China). The primer sequences are as follows: the forward primer, Fw: GGAATAAGAAATGTTTTTTAGAATGGA, and the reverse primer, Rv: ACCAAAAACAAAAAAAACAAACAAA, which are also illustrated in Figure 1A. The target fragment of GPX3 contained 25 CpGs, which is showed in Figure 1B.
1.3.2 Quantitative methylation by MALDI-TOF MS
EZ-96 DNA methylation kit (Zymo Research) was used to treat the genomic DNA (200 ng) of each participant with bisulfite according to the manufacturer’s instructions. The Sequenom Mass ARRAY platform (CapitalBio, Beijing, China) containing a matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometer and RNA base-specific cleavage (Mass CLEAVE), were both employed to quantify the methylation of GPX3 CpGs. Quantitative methylation data was obtained via a Spectro CHIP (SEQUENOM) and a Mass ARRAY Compact System (SEQUENOM). The EpiTYPER software version 1.0 (SEQUENOM) was used to analyze and display the results.
1.4 Qualitative methylation analysis
Genomic DNA of the study populationwas extracted from whole blood samples (n=80 in each group) using TIANamp Genomic DNA Kit (Tiangen Biotech, Beijing, China). The genomic DNA was treated with bisulfite using EZ-96 DNA methylation kit (ZYMO Research, Irvine, CA) according to the manufacturer’s instructions and amplified by methylation-specific polymerase chain reaction (MSP). The sequences of primer are as follows: methylated primers (F: 5’-TATGTTATTGTCGTTTCGGGAC-3’; R: 5’-GTCCGTCTAAAATATCCGACG-3’, products size: 177bp) and unmethylated primers (F: 5’-TTTATGTTATTGTTGTTTTGGGATG-3’; R: 5’-ATCCATCTAAAATATCCAACACTCC-3’, products size: 186bp).
Next, a 50μL PCR mixture containing 5μL 10×PCR buffer, 4μL dNTP mixture, 1μL of each primer, 3μL bisulfite-modified DNA, 35.75μL ddH2O, and 0.25μL hot-start Taq-polymerase (Takara, Mountain View, CA) for each blood sample was prepared. PCR conditions were set as: 94 °C for 10 min (initial denaturation), followed by 40 cycles of 94 °C for 30 s, 60 °C for 30 s and 72 °C for 30 s, and a final extension of 72 °C for 10 min. Finally, PCR products were resolved in 2% agarose gels, stained with ethidium bromide, and visualized in ultraviolet light (GBox F3, Syngene, UK).
1.5 C28/I2 human chondrocytes injured by tBHP
Human chondrocyte cell line named C28/I2, was provided by Professor Mary B Goldring (Hospital for Special Surgery, Weill Cornell Medical College, New York, USA). C28/I2 was cultured in DMEM/F-12 (Hyclone, Logan, UT) supplemented with 12% FBS (SiJiQing, Zhejiang, China) and 1% penicillin/streptomycin solution in a humidified incubator at 37°C and 5% CO2. Upon reaching 90% confluence, chondrocytes were seeded on 96-well culture plates. Our experiment contained 6 groups: control group (C), purely Selenium (Se) group (S2, 0.10 μg/mL Na2SeO3), tertbutyl hydroperoxide (tBHP) injury group (O, 150 μmol/L tBHP), low Se group (OS1, 0.05 μg/mL Na2SeO3 + 150 μmol/L tBHP), medium Se group (OS2, 0.10 μg/mL Na2SeO3 + 150 μmol/L tBHP) and high Se group (OS3, 0.15 μg/mL Na2SeO3 + 150 μmol/L tBHP). OS1, OS2 and OS3 were treated with increasing concentrations of Na2SeO3 (0.05, 0.10 and 0.15 μg/mL) for 24 h as pre-protection, and then treated with 150 μmol/L tBHP for 24 h. Chondrocytes were stained with 2% Hoechst 33342 in DMEM/F-12 containing 12% FBS and incubated at 37℃ for 30 min. Apoptosis in chondrocytes was monitored under a fluorescence microscope. Five high-power fields (100×) were selected randomly to count apoptotic cells and calculate the apoptotic rate in each group (n=3).
1.6 Statistical analysis
Quantitative data was presented as mean ± standard deviation (SD). Groups were compared using the student’s t-test. Curve-fitting method was used for obtaining the correlation between GPX1, GPX3 and GPX4 mRNA expressions and apoptosis rate of chondrocytes. All statistical analyses were performed using SPSS 23.0, and the significance level α=0.05 were considered to have statistical significance (SPSS Inc., Chicago, IL, USA).