DDX17 modulates the expression and alternative splicing of genes involved in apoptosis and proliferation in lung adenocarcinoma cells

doi:10.21203/rs.3.rs-1422174/v1

Download PDF

Article

DDX17 modulates the expression and alternative splicing of genes involved in apoptosis and proliferation in lung adenocarcinoma cells

https://doi.org/10.21203/rs.3.rs-1422174/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

The DEAD-box RNA-binding protein (RBP) DDX17 has been found to be involved in the tumorigenesis of many types of cancers. However, the role of DDX17 in lung adenocarcinoma (LUAD) remains unclear. We silenced DDX17 expression in A549 LUAD cells by small interfering RNA (siRNA). Cell proliferation and apoptosis assays were performed to explore the functions of DDX17. Knockdown of DDX17 by siRNA significantly inhibited proliferation and induced apoptosis in A549 cells. We used high-throughput RNA sequencing (RNA-seq) to identify differentially expressed genes (DEGs) and alternative splicing (AS) events in DDX17 knockdown LUAD cells. DDX17 knockdown increased the expression levels of proapoptotic genes and decreased those of proproliferative genes. Moreover, the DDX17-regulated AS events in A549 cells revealed by computational analysis using ABLas software were strongly validated by quantitative reverse transcription–polymerase chain reaction (RT–qPCR) and were also validated by analysis of The Cancer Genome Atlas (TCGA)-LUAD dataset. These findings suggest that DDX17 may function as an oncogene by regulating both the expression and AS of proliferation- and apoptosis-associated genes in LUAD cells. Our findings may offer new insights into understanding the molecular mechanisms of LUAD and provide a new therapeutic direction for LUAD.

LUAD

DDX17

transcriptome

apoptosis

proliferation

Lung cancer remains the leading cause of cancer-related death worldwide ¹. Non-small-cell lung cancer (NSCLC) accounts for approximately 85% of all lung cancers, and lung adenocarcinoma (LUAD) is the most common type of NSCLC. Recently, progress has been made in understanding the molecular mechanisms of lung cancer, which is critical for lung cancer therapy. For example, the epidermal growth factor receptor (EGFR) signaling pathway plays an important role in cell growth, proliferation and survival ². The Iressa Pan-Asia Study (IPASS) showed that EGFR tyrosine kinase inhibitors (EGFR-TKIs) significantly prolonged the survival of NSCLC patients harboring EGFR mutations, a finding that revolutionized the treatment of lung cancer ³. Tumor immune escape is an important mechanism promoting tumor development ⁴. Programmed death ligand 1 (PD-L1), a molecule in the B7 family, has been implicated in tumor immune escape. Immunotherapies for lung cancer, such as PD-1/PD-L1 monoclonal antibodies, are currently a clinical research focus. Despite remarkable and promising progress in treatments for lung cancer, such as targeted therapy and immunotherapy, the survival rate of patients with lung cancer at 5 years after diagnosis is approximately 20% in most countries ¹. Therefore, new strategies to improve clinical outcomes for NSCLC patients must be explored.

Increased attention has been given to the role of RNA-binding proteins (RBPs) in carcinogenesis ⁵. RBPs can regulate every aspect of RNA biology, including transcription, splicing, modification, and translation, all of which influence gene and protein expression ⁶. Therefore, minor changes in RBPs may lead to significant alterations in gene expression, which can be a cause of human diseases, including cancer. Many studies have demonstrated that RBPs can act as either tumor suppressors or oncogenes in lung cancer ^7-9.

DEAD-box RNA helicase 17 (DDX17), a DEAD-box RNA helicase, is an RBP that participates in DNA repair, histone modification and microRNA (miRNA) regulation ^10,11. DDX17 can recognize and directly bind specific regions in its target RNAs and remodel their structures ¹². DDX17 is involved in several cell signaling pathways that are crucial for survival and apoptosis by regulating gene expression and oncogenesis ⁸. Posttranslational modification of DDX17 may lead to transcriptional activation of cancer stemness-related genes ¹¹. Aberrant DDX17 expression has been found in hepatocellular carcinoma (HCC), colon cancer, glioma and lung cancer ^13-16.

In addition, alternative splicing (AS), a posttranscriptional modification process, plays a crucial role in the production of diverse mature messenger RNA (mRNA) transcripts ¹⁷. It is currently believed that the expression of approximately 95% of human genes is regulated by AS ¹⁸. In addition, accumulated evidence indicates that abnormal AS events (ASEs) frequently occur during the progression and development of many cancers, including LUAD ^19-21. DDX17 can regulate AS of PXN-AS1 in HCC to promote tumor metastasis ²². However, the regulatory role of DDX17 in gene expression and AS in LUAD is incompletely defined.

To study the potential function of DDX17 in regulating gene expression and AS, which might be related to LUAD, we obtained DDX17-regulated transcriptomes in human LUAD cells (A549 cells) by RNA sequencing (RNA-seq). Comparative transcriptome analysis revealed that knockdown of DDX17 led to extensive changes in gene expression profiles and ASEs in A549 cells that were confirmed in The Cancer Genome Atlas (TCGA)-LUAD dataset. These findings support the hypothesis that DDX17 may play a role in LUAD by regulating the expression and AS of genes associated with apoptosis and cell proliferation. Therefore, a further understanding of the role and mechanism of action of DDX17 may provide new therapeutic strategies for LUAD patients.

All small interfering RNA (siRNA) duplexes were purchased from Gemma (Suzhou, China). The siRNA sequences were as follows: Nontargeting control siRNA (siNegative), 5'-UUCUCCGAACGUGUCACGUTT-3’ (sense); siRNA targeting DDX17 (siDDX17-3), 5'- GCACCCAUCCUUAUUGCUATT -3’ (sense).

Cell culture and transfection

A549 cells (a human LUAD cell line) obtained from the China Center for Type Culture Collection (CCTCC; Wuhan, China) were cultured in minimal essential medium (MEM) supplemented with 10% fetal bovine serum (FBS), 100 μg/ml streptomycin and 100 U/ml penicillin at 37°C in 5% CO₂. A549 cells were transfected with siRNA using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. After 48 h of transfection, cells were harvested for quantitative reverse transcription–polymerase chain reaction (RT–qPCR) analysis.

Assessment of gene expression

Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control. Complementary DNA (cDNA) was synthesized by standard procedures, and RT–qPCR was performed using Bestar SYBR Green RT–PCR Master Mix (DBI Bioscience, Shanghai, China) in a Bio–Rad S1000 thermal cycler. Detailed primer sequences are listed in Table 1. The relative expression level of each mRNA transcript was normalized to the GAPDH mRNA level and calculated by the 2-ΔΔCT method. Statistical comparisons were made using paired Student’s t test in GraphPad Prism 7.0 software (Graphpad Prism software, San Diego, CA, USA).

Cell proliferation assay

Cell proliferation was examined using a Cell Counting Kit-8 (CCK-8; Dojindo, Co., Shanghai, China). In brief, A549 cells were seeded at a density of 6000 cells/well in 96-well culture plates. Cell-free wells were used as blank controls (blank), and cells treated with an equal volume of phosphate-buffered saline (PBS) were used as controls (control). After 24, 48 and 72 h of siRNA transfection, CCK-8 solution (20 μl) was added to the culture medium and incubated for an additional 3 h. Finally, 50 μl of stop solution was added to each well, and the OD450 values were measured with a PerkinElmer EnVision plate reader. The cell proliferation rate was calculated according to the following formula: proliferation rate = (experimental OD value − blank OD value)/(control OD value − blank OD value) × 100%.

Annexin V apoptosis assay

An Annexin V-fluorescein isothiocyanate (FITC) and propidium iodide (PI) detection kit (Shanghai Yeasen Corporation, Shanghai, China) was used to detect apoptosis according to the manufacturer’s instructions. Specifically, A549 cells were cultured in six-well plates for 24 h. and were then transfected with siRNA for 24, 48, or 72 h. Cells were treated with an equal volume of PBS as a control. The treated and control cells were mixed gently, and 5 μl of Annexin V-FITC reagent and 10 μl of 20 μg/ml PI reagent were then added and incubated at room temperature for 10-15 min in the dark. Following incubation, 400 µl of binding buffer was added, mixed, and placed on ice. Flow cytometric analysis was used to detect apoptosis within 1 h. Cells positive for Annexin V-FITC or negative for PI fluorescence were considered apoptotic cells.

Acquisition of RNA-seq data from TCGA

For RNA-seq, LUAD gene-level expression data (526 tumor samples and 59 normal samples) from TCGA were downloaded from the UCSC Xena hub (http://xena.ucsc.edu). Splice junction data in BED format for 518 LUAD tumor and 59 normal samples from TCGA were downloaded from the Genomic Data Commons (GDC) portal for identification of ASEs ⁴¹.

RNA extraction and sequencing

Total RNA was extracted with TRIzol (Ambion, Life Technologies, Carlsbad, CA, USA). RQ1 DNase (Promega, Madison, WI, USA) was used to remove any remaining DNA from the total RNA. RNA quality and quantity were assessed by measuring the absorbance ratio at 260 nm/280 nm (A260/A280) using a Nanodrop One spectrophotometer (Thermo Scientific, San Jose, CA, USA). RNA integrity was further verified by electrophoresis on a 1.5% agarose gel.

Equal amounts of total RNA (1 μg) from each sample were used for RNA-seq library preparation with a KAPA Stranded mRNA-Seq Kit for Illumina® Platforms (#KK8544). Polyadenylated mRNAs were purified with VAHTS mRNA Capture Beads (N401-01). Purified mRNAs were fragmented and were then converted into double-stranded cDNA. Next, the cDNA was subjected to end repair, poly(A) tailing and ligation with a Diluted Roche Adaptor Kit (KK8726). After ligation, the cDNA was fragmented into 300–500 bp fragments. Finally, the DNA fragments were amplified, purified, quantified, and stored at -80°C until used for sequencing. The dUTP-labeled second strand was not amplified, providing strand specificity.

For high-throughput sequencing, libraries were prepared according to the manufacturer's instructions and subjected to 150 nt paired-end sequencing using an Illumina NovaSeq 6000 system.

Cleaning and alignment of raw RNA-seq data

First, raw reads containing more than 2 N bases were discarded. The adaptors were removed from the raw reads, and low-quality bases were trimmed using FASTX-Toolkit (Version 0.0.13). In addition, short reads containing fewer than 16 nt were discarded. Subsequently, clean reads were aligned to the GRCh38 genome by TopHat2, allowing no more than 4 mismatches ⁶⁵. Only the uniquely mapped reads were used to calculate the gene read numbers and fragments per kilobase of transcript per million fragments mapped (FPKM) values ⁶⁶.

Analysis of differentially expressed genes (DEGs)

The R Bioconductor package edgeR (Robinson, McCarthy et al. 2010) was utilized to identify the DEGs. The cutoff criteria for identifying DEGs were set as a p value <0.01 and a fold change>1.5 or < 2/3.

Analysis of AS

The ABLas pipeline was applied to define and quantify the ASEs and regulated ASEs (RASEs) between the samples according to previously described methods ^67,68. In brief, ten types of ASEs were identified by the ABLas pipeline based on the splice junction reads: exon skipping (ES), alternative 5' splice site selection (A5SS), alternative 3' splice site selection (A3SS), intron retention (IR), mutually exclusive exons (MXE), mutually exclusive 5'UTRs (5pMXE), mutually exclusive 3'UTRs (3pMXE), cassette exon (CassetteExon), A3SS&ES and A5SS&ES.

For analysis of RBP-regulated ASEs, Student’s t test was applied to evaluate the significance of the alteration ratio of ASEs. A false discovery rate (FDR) of 0.05 was set as the significance cutoff.

Validation of DEGs and ASEs by RT–qPCR

To confirm the results of RNA-seq-based identification of DEGs in A549 cells, some DEGs were selected for verification by RT–qPCR. Information on the primers is shown in Table 1. A549 cells transfected with DDX17 siRNA were harvested after 48 h for RT–qPCR analysis. cDNA was synthesized from RNA using M-MLV Reverse Transcriptase (Vazyme). RT–qPCR was carried out on a StepOne RealTime PCR System using HieffTM qPCR SYBR® Green Master Mix (Low Rox Plus; Shanghai Yeasen Corporation, Shanghai, China). The thermal cycling conditions used for PCR were as follows: denaturation at 95°C for 5 min, followed by 40 cycles of denaturation at 95°C for 15 sec and annealing and extension at 60°C for 30 sec. PCR amplification was performed in triplicate for each sample. The RNA expression levels of all genes were normalized to the expression level of GAPDH.

Functional enrichment analysis

To comprehensively assess the biological functions of DEGs, Gene Ontology (GO) term and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses were performed with the KOBAS 2.0 server ⁶⁹. The enrichment of each term was determined using the hypergeometric test and Benjamini–Hochberg procedure to control the FDR.

Knockdown of DDX17 inhibits the proliferation and promotes the apoptosis of tumor cells

A CCK-8 assay was performed to evaluate cell proliferation. Compared to transfection with the control vector, siRNA knockdown of DDX17 significantly inhibited the proliferation of A549 cells (Fig. 1a). In addition, apoptosis analysis showed that DDX17 knockdown led to a marked increase in the apoptosis rate in A549 cells (Fig. 1b).

Based on the above results, we speculated that DDX17 may be a prognostic factor in LUAD patients. We analyzed the correlation between DDX17 expression and the clinical outcome of patients with LUAD in the TCGA database using Gene Expression Profiling Interactive Analysis (GEPIA) ²³. Kaplan–Meier (KM) survival analysis showed that higher DDX17 expression was associated with lower overall survival (OS) rates in LUAD patients (Fig. 1c).

DDX17 regulates the transcriptome in A549 cells

To examine DDX17-mediated transcriptional regulation in A549 cells, we constructed six cDNA libraries with three biological replicates each from DDX17 knockdown and control cells, which were subjected to RNA-seq analysis. DDX17 was knocked down by siRNA and quantified by RT–qPCR.

As shown in Fig. 2a, the expression of DDX17 was significantly reduced in A549 cells transfected with the targeting siRNA. Effective DDX17 knockdown was further confirmed by RNA-seq analysis and western blotting (Fig. 2b, c; Supplementary Figure S1). Principal component analysis (PCA) showed that the DDX17 siRNA group was obviously separated from the control group (Fig. 2d).

The DEGs, namely, 992 upregulated genes and 625 downregulated genes, are visualized in an MA plot (Fig. 2e). Heatmap analysis based on the expression patterns of the DEGs demonstrated clear separation between the DDX17 siRNA samples and control samples and high consistency among the three biological replicates (Fig. 2f). These results indicated that DDX17 markedly regulated the expression levels of many genes.

We performed GO analyses to further investigate the potential biological functions of these DEGs (Fig. 2g, h). Functional enrichment analyses indicated that genes upregulated in the DDX17 knockdown group were enriched mainly in biological processes, including regulation of transcription (DNA-dependent), transcription (DNA-dependent), cAMP catabolic process, extracellular matrix organization, and regulation of cell growth, whereas downregulated genes were related primarily to nucleosome assembly, cell cycle arrest, DNA repair, endoplasmic reticulum unfolded protein process, and cell–cell signaling.

DDX17 selectively regulates the expression of genes involved in the progression of cancer cells

C-X-C motif chemokine ligand 5 (CXCL5), C-C motif chemokine ligand 20 (CCL20), Growth differentiation factor 15 (GDF15), Stanniocalcin-2 (STC2) and RAD51 recombinase (RAD51) have been reported to play a role in promoting the proliferation, migration, and invasion of NSCLC cells ^24-28. As shown in Fig. 3, RNA-seq indicated that the mRNA expression of these genes was significantly reduced in the DDX17 knockdown group compared with the control group. To confirm the reliability of the RNA-seq data, RT–qPCR was performed. The qPCR and RNA-seq results exhibited a high degree of concordance.

Similarly, the expression of tumor suppressor genes (e.g., Ankyrin repeat domain 1 (ANKRD1); hexamethylene-bis-acetamide-inducible protein 1 (HEXIM1); Insulin like growth factor binding protein 4 (IGFBP4); Insulin like growth factor binding protein 3 (IGFBP3); ras homolog gene family, member B (RHOB); and P53 apoptosis effector related to PMP22 (PERP)) was significantly increased in the DDX17 knockdown group compared with the control group ^29-34. These results suggested that DDX17 may regulate the apoptosis and proliferation of LUAD cells by altering the expression of these genes.

DDX17 selectively regulates AS of genes involved in cell proliferation, migration, invasion, and apoptosis

To investigate the impact of DDX17 knockdown on AS of genes in A549 cells, we evaluated splicing alterations in the RNA-seq data using the ABLas pipeline. A total of 2094 RASEs were detected (Fig. 4a). Among the nine types of ASEs, ES, A5SS, A3SS and CassetteExon were the main types detected. Hierarchical clustering of RASEs revealed obvious separation between the DDX17 siRNA samples and the control samples, with a high degree of consistency among the three biological replicates (Fig. 4b). To explore the possible association between the regulated alternatively spliced genes (RASGs) and DEGs, we examined the overlap between the two datasets (Fig. 4c). Both the expression level and AS of 71 genes were significantly affected by DDX17 knockdown.

GO functional enrichment analysis showed that RASGs were enriched mainly in biological processes related to the terms apoptotic process, DNA repair, cellular protein metabolic process, viral reproduction, positive regulation of translation, and positive regulation of apoptotic process (Fig. 4d). Among these RASGs, the following have previously been reported to mediate the proliferation, migration, invasion, and apoptosis of cancer cells: Ribosomal protein S27a (RPS27A); LSM1 homolog, mRNA degradation associated (LSM1); Legumain (LGMN); Inverted formin 2 (INF2); LDL receptor related protein 5 (LRP5); and Filamin A (FLNA) ^35-40. Significantly fewer ES events in LSM1, CassetteExon events in INF2, CassetteExon events in LGMN and A3SS events in LRP5 were detected by RNA-seq in the DDX17 knockdown group than in the control group (Fig. 4e, f and Supplementary Fig. 2). Conversely, significantly more A5SS events in RPS27A and CassetteExon events in FLNA were detected in the DDX17 knockdown group than in the control group. These results were confirmed by RT–PCR. In particular, these findings indicate that DDX17 can regulate both the AS and mRNA expression of LGMN.

DDX17 regulates the transcriptome in LUAD in the TCGA database

To further confirm the transcriptional activity of DDX17, we analyzed gene expression data from TCGA datasets (including 526 LUAD samples and 59 normal lung samples) by using the UCSC Xena platform (https://xena.ucsc.edu/). We selected 20 samples with the highest DDX17 expression and 20 samples with the lowest DDX17 expression to assess the transcriptional regulation of DDX17. A total of 5243 genes were differentially regulated, among which 4218 were upregulated and 1025 genes were downregulated (Fig. 5a). The DEGs were visualized in a heatmap, which showed clear separation between the two groups (Fig. 5b). The Venn diagram of the DEGs showed that 67 genes were upregulated in LUAD samples with high DDX17 expression compared to those with low DDX17 expression, whereas these genes were downregulated in A549 cells after DDX17 knockdown (Fig. 5c). Similarly, 23 genes were downregulated in LUAD samples with high DDX17 expression compared to those with low DDX17 expression, whereas these genes were upregulated in A549 cells after DDX17 knockdown (Fig. 5d). Among these 23 genes, apoptosis-related genes such as IGFBP4, IGFBP3 and PERP were upregulated in LUAD samples with low DDX17 expression compared to those with high DDX17 expression in the TCGA database (Fig. 5e). In addition, KM survival analysis showed that high IGFBP4 expression was associated with better OS in LUAD patients in the TCGA database.

DDX17 regulates AS of genes in LUAD in the TCGA database

Finally, to investigate whether DDX17 influences AS of genes in LUAD patients, we analyzed BED format splicing data (including 518 LUAD samples and 59 normal lung samples) from the GDC portal ⁴¹. We selected 20 samples with the highest DDX17 expression and 20 samples with the lowest DDX17 expression to assess ASEs regulated by DDX17. Similar to the observations in A549 cells, A5SS, A3SS and CassetteExon were the main types of ASEs regulated by DDX17 in LUAD patients (Fig. 6a). By analyzing the overlap between the RASEs in the TCGA database and the RASEs in siDDX17 cells, we found significant overlap (175 genes) between the RASGs in the LUAD data and the RNA-seq data (Fig. 6b). GO functional enrichment analysis indicated that these genes were enriched mainly in biological processes related to the terms RNA splicing; mRNA processing; phosphorylation; positive regulation of transcription (DNA-templated); mRNA splicing, via spliceosome; and proliferation (Fig. 6c). Then, these overlapping genes were subjected to KEGG pathway enrichment analysis and were found to be enriched mainly in biological processes related to bacterial invasion of epithelial cells, focal adhesion, Epstein−Barr virus infection, the mRNA surveillance pathway, and the proteasome (Fig. 6d). Among the overlapping genes, significantly fewer A5SS events in LSM1, CassetteExon events in INF2, A5SS events in FLNA, A5SS events in RPS27A, and A3SS events in LGMN were detected by RNA-seq in LUAD samples with low DDX17 expression than in those with high DDX17 expression, whereas A3SS events in LRP5 were more prevalent in LUAD samples with high DDX17 expression (Fig. 6e).

The DEAD-box RNA helicases are the largest family of RNA helicases that play a significant role in all aspects of RNA metabolism, including the regulation of gene expression and AS ^42–44. DDX17, a DEAD-box ATPase, is highly expressed in many types of human cancers, where it participates in tumor initiation, progression, and metastasis ^11,13−15. However, the role of DDX17 in LUAD is incompletely determined.

In this study, we showed that siRNA knockdown of DDX17 significantly inhibited proliferation and led to increased apoptosis in A549 cells. In addition, using TCGA data, we showed that high DDX17 expression was associated with poor survival in LUAD patients. This oncogenic effect of DDX17 in LUAD is consistent with the results of studies on other cancer types ^13,14,45.

We next examined DDX17-mediated transcriptional regulation in A549 cells and identified 1617 DEGs, namely, 992 upregulated DEGs and 625 downregulated DEGs. GO functional enrichment analysis indicated that the downregulated genes, such as CXCL5, CCL20 and RAD51, in the DDX17 knockdown group were enriched mainly in nucleosome assembly, cell cycle arrest, DNA repair, endoplasmic reticulum unfolded protein process, and cell–cell signaling.

CXCL5, a member of the CXC-type chemokine family, is overexpressed in many cancers and can promote tumor cell proliferation, migration and invasion ^46–49. In addition, high expression of CXCL5 was found to be associated with poor tumor differentiation and poor survival of NSCLC patients ²⁴. CCL20 can promote lung cancer cell proliferation and migration by activating the ERK and PI3K signaling pathways ²⁵. RAD51 is an ATPase that is essential for the repair of DNA damage ⁵⁰. High expression of RAD51 is an indicator of adverse prognosis in NSCLC patients ⁵¹. In KRAS-mutant lung cancer cells, RAD51 may facilitate DNA damage repair and promote cell survival ⁵².

In contrast, the upregulated genes, such as IGFBP4, IGFBP3, and PERP, in the DDX17 knockdown group were enriched mainly in biological processes, including regulation of transcription (DNA-dependent), transcription (DNA-dependent), and regulation of cell growth. To further confirm transcriptional regulation by DDX17 in clinical samples, we compared 20 samples with the highest DDX17 expression with 20 samples with the lowest DDX17 expression in the TCGA-LUAD dataset. The expression of some overlapping genes was affected by DDX17 interference both in LUAD samples and in A549 cells. Among these overlapping genes, IGFBP4, IGFBP3 and PERP were significantly upregulated both in LUAD samples with low DDX17 expression and in DDX17 knockdown A549 cells.

PERP is a plasma membrane protein and a key mediator of p53-mediated apoptotic pathways ⁵³. By inducing apoptosis and suppressing VEGF expression, PERP gene therapy was found to attenuate LUAD cell growth in a human lung cancer xenograft model ³⁴. IGFBP3 and IGFBP4 are members of the insulin-like growth factor (IGF) binding protein family, whose members can bind to IGFs and regulate cell proliferation and apoptosis ⁵⁴. IGFBP4 overexpression can inhibit tumor proliferation and induce apoptosis by increasing the expression level of the proapoptotic protein BAX and decreasing that of the antiapoptotic protein BCL2 in A549 lung cancer cells ⁵⁵. IFGBP3 overexpression may induce lung cancer cell apoptosis and increase cisplatin sensitivity by suppressing IGF1 signaling ³². Further studies are warranted to explore whether DDX17 can regulate the survival of lung cancer cells by regulating the expression of these genes.

DDX17 is an important regulator of AS, and its deregulation is considered a hallmark of cancer and a potential therapeutic target ^56,57. DDX17 and DDX5 may play a critical role in tumor cell migration by simultaneously regulating the transcriptional activity and AS of NFAT5 in HeLa cells ⁵⁸. In addition, DDX17 regulates AS of PXN-AS1, leading to the production of a novel transcript that promotes HCC metastasis ²².

In the present study, numerous DDX17-regulated ASEs were observed both in A549 cells and in LUAD patients in the TCGA dataset. GO functional enrichment analysis showed that the RASGs were enriched mainly in biological process terms related to apoptotic process, DNA repair, cellular protein metabolic process, viral reproduction, positive regulation of translation, and positive regulation of apoptotic process. These ASEs in LSM1, INF2, LGMN, LRP5, RPS27A, and FLNA were significantly affected by DDX17 in A549 cells, and this finding was confirmed in LUAD samples in TCGA datasets.

LGMN is highly expressed in various tumors and can promote tumor progression and invasion ⁵⁹. Inhibition of LGMN may be a potent strategy for cancer therapy ⁶⁰. Our findings showed that DDX17 knockdown significantly affected both the gene expression and AS of LGMN in A549 cells. However, the type of ASE (CassetteExon) in LGMN affected by DDX17 knockdown in A549 cells was inconsistent with the type (A3SS) identified in the TCGA-LUAD dataset.

INF2 is a member of the formin family of proteins, which regulate the polymerization of actin ⁶¹. INF2 may induce apoptosis or act as an oncogene in different cancers ^39,62−64. In the present study, knockdown of DDX17 significantly reduced CassetteExon events in INF2 in A549 cells, and this result was confirmed in the TCGA—LUAD dataset. Therefore, we hypothesized that DDX17 may promote LUAD cell proliferation by regulating AS of INF2. This hypothesis is currently being tested in our laboratory.

In conclusion, DDX17 can regulate both AS and transcription in LUAD cells. DDX17 knockdown significantly inhibits proliferation and induces apoptosis in A549 cells. Furthermore, we showed that DDX17 can regulate the expression or AS of some cancer-related genes and speculated that INF2 may be a target gene of DDX17 in regulating AS in LUAD. Further studies are required to investigate whether DDX17-mediated signaling contributes to the tumorigenesis of LUAD.

Author contributions

All authors have approved the final version of the manuscript. C.H. wrote the manuscript and conducted the experiments. G.Z., Y.H.L. and J.Y.Z. helped conduct the experiments. Z.X.R. reviewed the manuscript.

Availability of data and materials

The data discussed in this publication are accessible under GEO Series accession number GSE196835.

Competing interests

The authors declare no competing interests.

Sung, H. et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin 71, 209–249, doi:10.3322/caac.21660 (2021).
Gawad Ph.D, J., Chavan, B., Bawane, P., Mhaske, A. & Tauro, S. OVERVIEW OF CELL SIGNALING AND CELL COMMUNICATION. Journal of Pharmaceutical Biology 5, 104–107 (2015).
Chan, B. A. & Hughes, B. G. M. Targeted therapy for non-small cell lung cancer: current standards and the promise of the future. Transl Lung Cancer Res 4, 36–54, doi:10.3978/j.issn.2218-6751.2014.05.01 (2015).
Liu, L. et al. Noncoding RNAs: the shot callers in tumor immune escape. Signal Transduct Target Ther 5, 102–102, doi:10.1038/s41392-020-0194-y (2020).
Pereira, B., Billaud, M. & Almeida, R. RNA-Binding Proteins in Cancer: Old Players and New Actors. Trends Cancer 3, 506–528, doi:10.1016/j.trecan.2017.05.003 (2017).
Gebauer, F., Schwarzl, T., Valcárcel, J. & Hentze, M. W. RNA-binding proteins in human genetic disease. Nat Rev Genet 22, 185–198, doi:10.1038/s41576-020-00302-y (2021).
Bitaraf, A. et al. The oncogenic and tumor suppressive roles of RNA-binding proteins in human cancers. J Cell Physiol 236, 6200–6224, doi:10.1002/jcp.30311 (2021).
Sarkar, M. & Ghosh, M. K. DEAD box RNA helicases: crucial regulators of gene expression and oncogenesis. Front Biosci (Landmark Ed) 21, 225–250, doi:10.2741/4386 (2016).
Shen, D. J., Jiang, Y. H., Li, J. Q., Xu, L. W. & Tao, K. Y. The RNA-binding protein RBM47 inhibits non-small cell lung carcinoma metastasis through modulation of AXIN1 mRNA stability and Wnt/β-catentin signaling. Surg Oncol 34, 31–39, doi:10.1016/j.suronc.2020.02.011 (2020).
Kao, S. H. et al. Regulation of miRNA Biogenesis and Histone Modification by K63-Polyubiquitinated DDX17 Controls Cancer Stem-like Features. Cancer Res 79, 2549–2563, doi:10.1158/0008-5472.Can-18-2376 (2019).
Wu, K. J. The role of miRNA biogenesis and DDX17 in tumorigenesis and cancer stemness. Biomed J 43, 107–114, doi:10.1016/j.bj.2020.03.001 (2020).
Ngo, T. D., Partin, A. C. & Nam, Y. RNA Specificity and Autoregulation of DDX17, a Modulator of MicroRNA Biogenesis. Cell Rep 29, 4024–4035.e4025, doi:10.1016/j.celrep.2019.11.059 (2019).
Xue, Y. et al. DDX17 promotes hepatocellular carcinoma progression via inhibiting Klf4 transcriptional activity. Cell Death Dis 10, 814, doi:10.1038/s41419-019-2044-9 (2019).
Shin, S., Rossow, K. L., Grande, J. P. & Janknecht, R. Involvement of RNA Helicases p68 and p72 in Colon Cancer. Cancer Research 67, 7572–7578, doi:10.1158/0008-5472.Can-06-4652 (2007).
Luo, Q. et al. Upregulation of DEAD box helicase 5 and 17 are correlated with the progression and poor prognosis in gliomas. Pathol Res Pract 216, 152828, doi:10.1016/j.prp.2020.152828 (2020).
Li, K. et al. DDX17 nucleocytoplasmic shuttling promotes acquired gefitinib resistance in non-small cell lung cancer cells via activation of β-catenin. Cancer Lett 400, 194–202, doi:10.1016/j.canlet.2017.02.029 (2017).
Peng, Q. et al. Impacts and mechanisms of alternative mRNA splicing in cancer metabolism, immune response, and therapeutics. Molecular Therapy, doi:https://doi.org/10.1016/j.ymthe.2021.11.010 (2021).
Le, K. Q., Prabhakar, B. S., Hong, W. J. & Li, L. C. Alternative splicing as a biomarker and potential target for drug discovery. Acta Pharmacol Sin 36, 1212–1218, doi:10.1038/aps.2015.43 (2015).
Deng, K., Yao, J., Huang, J., Ding, Y. & Zuo, J. Abnormal alternative splicing promotes tumor resistance in targeted therapy and immunotherapy. Transl Oncol 14, 101077, doi:10.1016/j.tranon.2021.101077 (2021).
Bonomi, S. et al. Oncogenic alternative splicing switches: role in cancer progression and prospects for therapy. Int J Cell Biol 2013, 962038, doi:10.1155/2013/962038 (2013).
Coomer, A. O., Black, F., Greystoke, A., Munkley, J. & Elliott, D. J. Alternative splicing in lung cancer. Biochim Biophys Acta Gene Regul Mech 1862, 194388, doi:10.1016/j.bbagrm.2019.05.006 (2019).
Zhou, H. Z. et al. DDX17-regulated alternative splicing that produced a novel oncogenic isoform of PXN-AS1 to promote HCC metastasis. Hepatology, doi:10.1002/hep.32195 (2021).
Tang, Z., Kang, B., Li, C., Chen, T. & Zhang, Z. GEPIA2: an enhanced web server for large-scale expression profiling and interactive analysis. Nucleic Acids Res 47, W556-w560, doi:10.1093/nar/gkz430 (2019).
Wang, L. et al. CXCL5 regulation of proliferation and migration in human non-small cell lung cancer cells. Journal of Physiology and Biochemistry 74, 313–324, doi:10.1007/s13105-018-0619-z (2018).
Wang, B. et al. Production of CCL20 from lung cancer cells induces the cell migration and proliferation through PI3K pathway. J Cell Mol Med 20, 920–929, doi:10.1111/jcmm.12781 (2016).
Zhao, C. et al. C5a induces A549 cell proliferation of non-small cell lung cancer via GDF15 gene activation mediated by GCN5-dependent KLF5 acetylation. Oncogene 37, 4821–4837, doi:10.1038/s41388-018-0298-9 (2018).
Na, S. S. et al. Stanniocalcin-2 (STC2): A potential lung cancer biomarker promotes lung cancer metastasis and progression. Biochim Biophys Acta 1854, 668–676, doi:10.1016/j.bbapap.2014.11.002 (2015).
Hu, J. et al. High expression of RAD51 promotes DNA damage repair and survival in KRAS-mutant lung cancer cells. BMB Rep 52, 151–156, doi:10.5483/BMBRep.2019.52.2.213 (2019).
Jiménez, A. P. et al. The tumor suppressor RASSF1A induces the YAP1 target gene ANKRD1 that is epigenetically inactivated in human cancers and inhibits tumor growth. Oncotarget 8, 88437–88452, doi:10.18632/oncotarget.18177 (2017).
Tan, Justin L. et al. Stress from Nucleotide Depletion Activates the Transcriptional Regulator HEXIM1 to Suppress Melanoma. Molecular Cell 62, 34–46, doi:https://doi.org/10.1016/j.molcel.2016.03.013 (2016).
Li, W. et al. Insulin-like growth factor binding protein-4 inhibits cell growth, migration and invasion, and downregulates COX-2 expression in A549 lung cancer cells. Cell Biol Int 41, 384–391, doi:10.1002/cbin.10732 (2017).
Wang, Y. A. et al. IGFBP3 Modulates Lung Tumorigenesis and Cell Growth through IGF1 Signaling. Mol Cancer Res 15, 896–904, doi:10.1158/1541-7786.Mcr-16-0390 (2017).
Chen, W. et al. RhoB Acts as a Tumor Suppressor That Inhibits Malignancy of Clear Cell Renal Cell Carcinoma. PLoS One 11, e0157599, doi:10.1371/journal.pone.0157599 (2016).
Chen, K., Luo, Z., Li, Z., Liu, Y. & Zhao, Q. PERP gene therapy attenuates lung cancer xenograft via inducing apoptosis and suppressing VEGF. Cancer Biol Ther 12, 1114–1119, doi:10.4161/cbt.12.12.18435 (2011).
Yu, Z. et al. MALDI-MS-based biomarker analysis of extracellular vesicles from human lung carcinoma cells. RSC Advances 11, 25375–25380, doi:10.1039/D1RA04305F (2021).
Watson, P. M. et al. CaSm (LSm-1) overexpression in lung cancer and mesothelioma is required for transformed phenotypes. Am J Respir Cell Mol Biol 38, 671–678, doi:10.1165/rcmb.2007-0205OC (2008).
Roslan, Z., Muhamad, M., Selvaratnam, L. & Ab-Rahim, S. The Roles of Low-Density Lipoprotein Receptor-Related Proteins 5, 6, and 8 in Cancer: A Review. J Oncol 2019, 4536302, doi:10.1155/2019/4536302 (2019).
Zhang, W. & Lin, Y. The Mechanism of Asparagine Endopeptidase in the Progression of Malignant Tumors: A Review. Cells 10, doi:10.3390/cells10051153 (2021).
Qian, J. et al. Tanshinone IIA promotes IL2-mediated SW480 colorectal cancer cell apoptosis by triggering INF2-related mitochondrial fission and activating the Mst1-Hippo pathway. Biomed Pharmacother 108, 1658–1669, doi:10.1016/j.biopha.2018.09.170 (2018).
Zhang, Y. et al. FLNa negatively regulated proliferation and metastasis in lung adenocarcinoma A549 cells via suppression of EGFR. Acta Biochim Biophys Sin (Shanghai) 50, 164–170, doi:10.1093/abbs/gmx135 (2018).
Kahles, A. et al. Comprehensive Analysis of Alternative Splicing Across Tumors from 8,705 Patients. Cancer Cell 34, 211–224.e216, doi:10.1016/j.ccell.2018.07.001 (2018).
Sarkar, M. & Ghosh, M. K. DEAD box RNA helicases: crucial regulators of gene expression and oncogenesis. Frontiers in Bioscience-Landmark 21, 225–250, doi:10.2741/4386 (2016).
Zhang, L. & Li, X. DEAD-Box RNA Helicases in Cell Cycle Control and Clinical Therapy. Cells 10, doi:10.3390/cells10061540 (2021).
Linder, P. & Jankowsky, E. From unwinding to clamping — the DEAD box RNA helicase family. Nature Reviews Molecular Cell Biology 12, 505–516, doi:10.1038/nrm3154 (2011).
Wu, X. C., Yan, W. G., Ji, Z. G., Zheng, G. Y. & Liu, G. H. Long noncoding RNA SNHG20 promotes prostate cancer progression via upregulating DDX17. Arch Med Sci 17, 1752–1765, doi:10.5114/aoms.2019.85653 (2021).
Li, A. et al. Overexpression of CXCL5 is associated with poor survival in patients with pancreatic cancer. Am J Pathol 178, 1340–1349, doi:10.1016/j.ajpath.2010.11.058 (2011).
Zhou, S. L. et al. CXCL5 contributes to tumor metastasis and recurrence of intrahepatic cholangiocarcinoma by recruiting infiltrative intratumoral neutrophils. Carcinogenesis 35, 597–605, doi:10.1093/carcin/bgt397 (2014).
Mao, Z. et al. CXCL5 promotes gastric cancer metastasis by inducing epithelial-mesenchymal transition and activating neutrophils. Oncogenesis 9, 63, doi:10.1038/s41389-020-00249-z (2020).
Zhao, J. et al. Tumor-derived CXCL5 promotes human colorectal cancer metastasis through activation of the ERK/Elk-1/Snail and AKT/GSK3β/β-catenin pathways. Molecular Cancer 16, 70, doi:10.1186/s12943-017-0629-4 (2017).
Bonilla, B., Hengel, S. R., Grundy, M. K. & Bernstein, K. A. RAD51 Gene Family Structure and Function. Annu Rev Genet 54, 25–46, doi:10.1146/annurev-genet-021920-092410 (2020).
Qiao, G. B. et al. High-level expression of Rad51 is an independent prognostic marker of survival in non-small-cell lung cancer patients. Br J Cancer 93, 137–143, doi:10.1038/sj.bjc.6602665 (2005).
Hu, J. et al. High expression of RAD51 promotes DNA damage repair and survival in KRAS-mutant lung cancer cells. BMB Rep. 52, 151–156, doi:10.5483/BMBRep.2019.52.2.213 (2019).
Ihrie, R. A. et al. Perp is a mediator of p53-dependent apoptosis in diverse cell types. Curr Biol 13, 1985–1990, doi:10.1016/j.cub.2003.10.055 (2003).
Brahmkhatri, V. P., Prasanna, C. & Atreya, H. S. Insulin-like growth factor system in cancer: novel targeted therapies. Biomed Res Int 2015, 538019–538019, doi:10.1155/2015/538019 (2015).
Wei, W., Wang, L., Xu, L. & Zeng, J. Anticancer mechanism of breviscapine in non-small cell lung cancer A549 cells acts via ROS-mediated upregulation of IGFBP4. Journal of thoracic disease 13, 2475–2485, doi:10.21037/jtd-21-551 (2021).
Hönig, A., Auboeuf, D., Parker, M. M., O'Malley, B. W. & Berget, S. M. Regulation of alternative splicing by the ATP-dependent DEAD-box RNA helicase p72. Mol Cell Biol 22, 5698–5707, doi:10.1128/mcb.22.16.5698-5707.2002 (2002).
Urbanski, L. M., Leclair, N. & Anczuków, O. Alternative-splicing defects in cancer: Splicing regulators and their downstream targets, guiding the way to novel cancer therapeutics. Wiley Interdiscip Rev RNA 9, e1476, doi:10.1002/wrna.1476 (2018).
Germann, S. et al. Dual role of the ddx5/ddx17 RNA helicases in the control of the pro-migratory NFAT5 transcription factor. Oncogene 31, 4536–4549, doi:10.1038/onc.2011.618 (2012).
Zhen, Y. et al. Clinicopathologic significance of legumain overexpression in cancer: a systematic review and meta-analysis. Scientific Reports 5, 16599, doi:10.1038/srep16599 (2015).
Zhao, T. et al. Esomeprazole inhibits the lysosomal cysteine protease legumain to prevent cancer metastasis. Invest New Drugs 39, 337–347, doi:10.1007/s10637-020-01011-3 (2021).
Zhao, Y., Zhang, H., Wang, H., Ye, M. & Jin, X. Role of formin INF2 in human diseases. Molecular Biology Reports 49, 735–746, doi:10.1007/s11033-021-06869-x (2022).
Heuser, V. D. et al. Formin Proteins FHOD1 and INF2 in Triple-Negative Breast Cancer: Association With Basal Markers and Functional Activities. Breast Cancer (Auckl) 12, 1178223418792247, doi:10.1177/1178223418792247 (2018).
Jin, X. et al. Dysregulation of INF2-mediated mitochondrial fission in SPOP-mutated prostate cancer. PLoS Genet 13, e1006748, doi:10.1371/journal.pgen.1006748 (2017).
Heuser, V. D. et al. Multiple formin proteins participate in glioblastoma migration. BMC Cancer 20, 710, doi:10.1186/s12885-020-07211-7 (2020).
Kim, D. et al. TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol 14, R36, doi:10.1186/gb-2013-14-4-r36 (2013).
Trapnell, C. et al. Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat Biotechnol 28, 511–515, doi:10.1038/nbt.1621 (2010).
Jin, L. et al. Transcriptome analysis reveals the complexity of alternative splicing regulation in the fungus Verticillium dahliae. BMC Genomics 18, 130, doi:10.1186/s12864-017-3507-y (2017).
Xia, H. et al. CELF1 preferentially binds to exon-intron boundary and regulates alternative splicing in HeLa cells. Biochimica et Biophysica Acta (BBA) - Gene Regulatory Mechanisms 1860, 911–921, doi:https://doi.org/10.1016/j.bbagrm.2017.07.004 (2017).
Xie, C. et al. KOBAS 2.0: a web server for annotation and identification of enriched pathways and diseases. Nucleic Acids Res 39, W316-322, doi:10.1093/nar/gkr483 (2011).

Table 1. Primers sets; related to the experimental procedures.

Gene	Primer	Sequence (5'-3')	Related Figures
GAPDH	Forward	GGTCGGAGTCAACGGATTTG	Fig. 2a
GAPDH	Reverse	GGAAGATGGTGATGGGATTTC	Fig. 2a
DDX17	Forward	GGGTACCGCCTATACCTTCT	Fig. 2a
DDX17	Reverse	TGTTGGCTGAAGAAGTGGTC	Fig. 2a

RT–qPCR primers used for gene expression verification.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

DDX17 modulates the expression and alternative splicing of genes involved in apoptosis and proliferation in lung adenocarcinoma cells

Status:

Version 1

Abstract

Figures

Introduction

Material And Methods

Results

Discussion

Declarations

References

Tables

Additional Declarations

Supplementary Files

Status:

Version 1