G-CSF Upregulates the Expression of Aquaporin-9 through CEBPB to Enhance the Cytotoxic Activity of Arsenic Trioxide to Acute Myeloid Leukemia Cells

doi:10.21203/rs.3.rs-1423336/v1

Download PDF

Research Article

G-CSF Upregulates the Expression of Aquaporin-9 through CEBPB to Enhance the Cytotoxic Activity of Arsenic Trioxide to Acute Myeloid Leukemia Cells

https://doi.org/10.21203/rs.3.rs-1423336/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

Background: Arsenic trioxide (ATO) is widely used for acute promyelocytic leukemia (APL) treatment, but it can’t show satisfactory efficacy in non-APL leukemia. Aquaporin-9 (AQP9), a transmembrane transporter, is required for ATO uptake. Acute myeloid leukemia (AML) other than APL cells express relatively lower levels of AQP9, which limits the cytotoxic activity of ATO in those types of leukemia cells. Recently, we found that granulocyte colony stimulating factor (G-CSF) can upregulate the expression of AQP9. We hypothesized that the combination of G-CSF with ATO may enhance the antitumor effect of ATO in non-APL leukemia cells. We also aimed to elucidate the underlying mechanisms by which G-CSF upregulates the expression of AQP9.

Methods: AML cell lines including THP-1 and HL-60 were pretreated with or without G-CSF (100ng/ml) for 24 hours, followed by the treatment with ATO (2μM) for 48 hours. Cell morphology was observed under microscope after Wright-Giemsa staining. Flow cytometry was performed to evaluate the cell apoptosis levels. The intracellular concentrations of ATO were determined by the atomic fluorescence spectrometry. The mRNA and protein expression were respectively measured by quantitative reverse transcription PCR (RT-qRCR) and western blotting. Target genes were knocked down by transfection with small interfering RNA (siRNA), or overexpressed by transfection with overexpression plasmids. The cell line derived xenograft mouse model was established to confirm the results of the in vitro experiments.

Results: Compared with using ATO alone, the combination of ATO with G-CSF induced apoptosis in AML cells more dramatically. G-CSF upregulated the expression of AQP9 and enhanced the intracellular concentrations of ATO in AML cells. When AQP9 was overexpressed, it markedly enhanced the cytotoxic activity of ATO. On the other hand, when AQP9 was knocked down, it dramatically attenuated the combinational effect. Moreover, we found that the upregulation of AQP9 by G-CSF depends on the transcription factor CCAAT enhancer binding protein beta (CEBPB). We also demonstrated that ATO and G-CSF combination significantly inhibited the tumor growth in xenograft mouse model.

Conclusions: ATO and G-CSF combination may be a potential therapeutic strategy for AML patients.

acute myeloid leukemia

arsenic trioxide

G-CSF

AQP9

CEBPB

Acute myeloid leukemia is an aggressive malignancy characterized by uncontrolled proliferation and accumulation of immature myeloid precursor cells in the bone marrow [1]. AML is considered as a disease of older adults, with a median age of 68 years old at diagnosis [2]. For older unfit patients, the traditional induced remission regimen may bring high induction death and treatment-related mortality, and little benefit to overall survival time. New therapeutic options including demethylating agents and BCL-2 inhibitors lead to a slight increase in life expectancy, but the prognosis remains poor in older patients (5-year overall survival rates of < 20% and < 5% among patients aged 65–74 and > 75, respectively) [3]. Finding appropriate drugs for these frailer patients is a major challenge for the treatment of AML.

Arsenic trioxide can target and degrade PML/RARα proteins. It has been applied in acute promyelocytic leukemia treatment for decades, which has achieved satisfactory therapeutic effect [4, 5]. ATO was used on the basis of subcutaneous injection with low doses of cytarabine in AML patients. However, the results were dismal. It seemed that the addition of ATO did not bring more benefit for those patients [6]. It has been reported that the uptake of ATO into leukemia cells depends on AQP9, a transmembrane transporter belonging to the aquaporin family [7, 8]. Different from APL cells, most of AML cells express low levels of AQP9 proteins [7]. As a result, they show less sensitivity to ATO treatment. How to improve the expression of AQP9 is the key point to overcome ATO resistance in acute myeloid leukemia. The mechanisms of how AQP9 is regulated in leukemia cells still remain not very clear. It was reported that the expression of AQP9 can be regulated by HNF1 homeobox A (HNF1A) [9]. Demethylating the promoter region of HNF1A gene can increase the expression of HNF1A proteins, which can ultimately upregulate the protein level of AQP9 [9]. It has also been reported that the phosphorylation of p38 MAPK signaling pathways can promote the expression of AQP9 in rat brains or astrocytes [10, 11].

Granulocyte colony stimulating factor is important for the differentiation and proliferation of normal myeloid precursors [12]. G-CSF can bind with its receptor to form a dimer, resulting in the activation of the downstream signaling pathways including JAK/STAT, Src kinases, Lyn, Ras/ERK (MAPK signaling pathway) and PI3K [13]. G-CSF can also enhance the cytotoxic effect of chemotherapeutic drugs in the prime protocol of acute myeloid leukemia [14].

In this study, we suppose whether G-CSF can increase the sensitivity of leukemia cells to ATO by upregulating the protein expression of AQP9. On this basis, we will further elucidate the mechanisms of how AQP9 is regulated by G-CSF.

1. Cell culture and treatment of leukemia cells.

The acute myeloid leukemia cell lines, including HL-60, THP-1 and NB4, were purchased from the Cell Bank of Chinese Academy of Sciences. The cells were cultured in RPMI-1640 (coring, 10-040-CVRC) supplemented with 10% fetal bovine serum (GIBCO) in the cell incubator with 5% CO₂ at 37℃.

1×10⁶ cells of each group were pretreated with or without G-CSF (100ng/ml) for 24 hours, and after that cells were treated with ATO (2µM) for 48 hours. Then 100µl cells of each group with gradient concentrations (2×10⁵/ml, 1×10⁵/ml and 5×10⁴/ml) were centrifuged onto glass slides at 500rpm for 5 minutes. The slides were stained by Wright-Giemsa staining solution (Beyotime, C0135), and then were observed or photographed under microscope.

2. Flow cytometry analysis of cell apoptosis.

To analyze the apoptosis levels of cells, THP-1 or HL-60 cells were pretreated with or without G-CSF (100ng/ml) for 24 hours, followed by the treatment with ATO (2µM) for 48 hours. 2×10⁶ cells were collected and washed with PBS buffer once and with binding buffer (ThermoFisher) once again. Then the cells were resuspended by 100µl binding buffer. Each sample was stained by 5µl Annexin V (ThermoFisher) for 15 minutes at room temperature in the dark. Then the cell samples were washed with 2ml binding buffer and resuspended by 200µl binding buffer. The cell suspension was added with 5µl propidium iodide (Invitrogen) to stain for 10 minutes before analysis by flow cytometry (BD).

3. Western blotting.

To prepare protein samples, 2×10⁶ cells of each sample were collected and washed by PBS once. Each sample was lysed by 1×SDS loading buffer (Beyotime, P0015) and boiled at 100℃. Then protein samples were separated by SDS-polyacrylamide gel electrophoresis and transferred onto nitrocellulose membrane (0.22µm). The antibodies and the usage concentrations are as follows: anti-AQP9 antibody (Alpha Diagnostic International, 1:1000), anti-CEBPB antibody (Santa Cruz, 1:1000), anti-GAPDH antibody (Proteintech, 1:2000), HRP-linked anti-Rabbit IgG antibody (Santa Cruz, 1:2000).

4. RT-qPCR.

For RT-qPCR analysis, 4×10⁶ cells of each sample were collected and washed by PBS once. Each sample were lysed by TRIZOL (Sigma). RNA was extracted and reversely transcribed as protocol. The transcriptional levels of each gene were analyzed on 7500 Fast Real-Time PCR System. The primers of the target genes and the reference gene (GAPDH) are as follows:

GAPDH-F, AGAAGGCTGGGGCTCATT,

GAPDH-R, TGCTAAGCAGTTGGTGG;

AQP9-F, TGCTGGTGGAAAACTGCTGA,

AQP9-R, TTCCAGCTTTGATCTGCAAATGCG;

CEBPB-F, CTTCAGCCCGTACCTGGAG,

CEBPB-R, GGAGAGGAAGTCGTGGTGC;

FOS-F, GGGGCAAGGTGGAACAGTTAT,

FOS-R, CCGCTTGGAGTGTATCAGTCA;

NFKB1-F, GAAGCACGAATGACAGAGGC,

NFKB1-R, GCTTGGCGGATTAGCTCTTTT;

STAT3-F, ACCAGCAGTATAGCCGCTTC,

STAT3-R, GCCACAATCCGGGCAATCT;

SP1-F, TGGCAGCAGTACCAATGGC,

SP1-R, CCAGGTAGTCCTGTCAGAACTT.

5. Cell transfection.

The THP-1 or HL-60 cells in logarithmic growth phase were transfected with siRNAs or plasmids. The siRNA targets of AQP9 gene and CEBPB gene are as follows:

si-AQP9-92, GUCAAAACGUCCAUUUUCA;

si-AQP9-142, GUAGGUAUUGGUAGAAACA;

si-AQP9-480, GUUCAAAUUGCCAUUUUAU;

si-CEBPB-992, CCAAGAAGACCGUGGACAA;

si-CEBPB-1010, AGCACAGCGACGAGUACAA;

si-CEBPB-1030, AGAACGAGCGGCUGCAGAA;

negative control, UUCUCCGAACGUGUCACGU.

6. The atomic fluorescence spectrometry.

THP-1 or HL-60 cells were pretreated with or without G-CSF (100ng/ml) for 24 hours, and then were treated with ATO (2µM) for 48 hours. After that, 5×10⁶ cells were collected and broken up by ultrasonication. The cell debris was dissolve by test solution (66.7% HNO₃ + 33.3% H₂O₂) and was analyzed for the concentrations of atomic arsenic by Agilent 7800 ICP-MS.

7. The cell line derived xenograft mouse model and drug administration.

All the animal experiments were permitted and supervised by the Medical Ethics Committee of Ren Ji Hospital affiliated to Shanghai Jiao Tong University School of Medicine. To establish the xenograft mouse model of AML cells, THP-1 cells (1×10⁷ cells per mouse) were subcutaneously injected into nude mice under brief anesthesia. And then those mice bearing THP-1 cells were administered with ATO alone (2mg/kg) or ATO/G-CSF (G-CSF 300µg/kg, ATO 2mg/kg) by peritoneal injection when the tumor volumes reached 100mm³. The tumor volumes were recorded every 3 days. All the mice were sacrificed at Day 17 after treatment and the indicated groups of tumors were photographed and weighted.

8. Immunohistochemistry and HE staining.

The procedures of immunohistochemistry are as follows. The tumor tissues were carefully separated, fixed in 4% paraformaldehyde and embedded in paraffin. The embedded tissues were sliced into sections. The sections went through deparaffinization, rehydration and antigen retrieval. Then the sections were blotted with the primary antibodies against AQP9 (Alpha Diagnostic International) or CEBPB (Santa Cruz). After wash steps by PBS, the sections were blotted by biotin-associated secondary antibody. The sections were developed with substrate mixture.

As for the analysis of mouse livers, the liver tissues were carefully separated from the nude mice receiving ATO or G-CSF/ATO treatment. The tissue sections were prepared as the immunohistochemistry procedures. The sections were stained by hematoxylin and eosin (HE) using the HE Staining Kit (Beyotime, C0105S). All the procedures were performed as protocol. All the finished sections were observed and photographed under microscope.

9. Statistical analysis.

The data in this study were all analyzed and presented using Graphpad Prism software (version 8) or Excel software. The apoptosis levels of cells, the concentrations of ATO or the weights of tumors from different groups were statistically analyzed by unpaired student t test. P < 0.05 represents significant difference between the different groups. NS represents no significant difference.

G-CSF significantly promotes the sensitivity of AML cells to ATO.

To compare the effects of ATO alone and ATO/G-CSF combination on AML cells, we treated THP-1 and HL-60 cells with or without G-CSF for 24 hours, followed by the treatment with ATO for 48 hours. We found that the cells treated with G-CSF didn’t show remarkable morphological change compared with the control cells (Figure.1A, lane 1–2), while a small portion of cells underwent apoptosis when treated with ATO alone (Figure.1A, lane 3). In contrast, the numbers of apoptotic cells significantly increased in the combination group (Figure.1A, lane 4). We further used the flow cytometry to analyze the apoptosis levels. As the observations above, the treatment with ATO alone slightly induced cell apoptosis, while the combination of G-CSF and ATO greatly increased the apoptosis levels (Fig. 1B-1D). These results indicate that G-CSF can promote the cytotoxic effect of ATO.

2. G-CSF upregulates the expression of AQP9 and enhances the intracellular concentration of ATO in AML cells.

Since AQP9 was reported to be the key membrane channel for ATO uptake[15, 16], we hypothesized that G-CSF enhanced the cytotoxic effect of ATO through upregulating the expression of AQP9. We treated the cells (THP-1, HL-60 and NB4) with G-CSF and collected the cells for RT-qPCR and western blotting analysis. Firstly, we found that the expression of AQP9 was significantly higher in NB4 cells than in HL-60 and THP-1 cells (Fig. 2A and 2B). Moreover, we found that the expression of AQP9 were upregulated after treatment with G-CSF (Fig. 2A and 2B). We also examined the intracellular concentrations of ATO by atomic fluorescence spectrometry, and found that the ATO concentrations increased after treatment with G-CSF (Fig. 2C).

3. AQP9 is required for the transportation of ATO in AML cells.

To further confirm whether AQP9 is required for the transportation of ATO in AML cells, we firstly overexpressed AQP9 in THP-1 cells (Fig. 3A and 3B). After treatment with ATO alone or G-CSF/ATO, the intracellular concentrations of ATO were examined. It was found that the ATO concentrations accumulated much more in the overexpression group than in the vector group (Fig. 3C). We also interfered the expression of AQP9 by siRNA (Fig. 3D and 3E). In contrast to the results of the overexpression experiments, AQP9 knockdown remarkably reduced the ATO concentrations (Fig. 3F). These results suggest that AQP9 is required for the transportation of ATO in AML cells.

4. AQP9 is essential for the combinational effect of G-CSF and ATO.

To investigate the role of AQP9 in the combinational effect of G-CSF and ATO on AML cells, we interfered the expression of AQP9 by siRNA in THP-1 cells (mock siRNA as negative control), and then treated with the cells with ATO alone or G-CSF/ATO in combination (the vehicles as control). And then the apoptosis levels were analyzed. We found that the apoptosis induction ability of ATO was significantly inhibited after AQP9 knockdown (p = 0.0028, Fig. 4A and 4B), while the combinational effect of G-CSF and ATO was also dramatically suppressed after knockdown of AQP9 (p = 0.0047, Fig. 4A and 4B), suggesting that AQP9 is essential for the combinational effect of G-CSF and ATO.

5. The upregulation of AQP9 by G-CSF depends on CEBPB.

To explore the mechanisms of how G-CSF upregulated the expression of AQP9, we examined the transcriptional expression of several potential transcription factors including CEBPB, FOS, NFKB1, STAT3 and SP1 by RT-qPCR. We found that the mRNA levels of CEBPB gene was upregulated most significantly (p = 0.0034, Fig. 5A). We further examined the expression of CEBPB by western blotting, and found that G-CSF indeed remarkably promoted the protein levels of CEBPB in THP-1 and HL-60 cells (Fig. 5B). We also knocked down CEBPB and then examined the expression of AQP9. It was found that the inhibition of CEBPB could markedly suppress the expression of AQP9 (Fig. 5C), suggesting that CEBPB is necessary for the upregulation of AQP9 in response to G-CSF.

6. The combination of G-CSF and ATO suppressed the growth of AML cells in xenograft mouse model.

To determine the effect of ATO/G-CSF in vivo, THP-1 cells were subcutaneously injected into nude mice to establish the xenograft mouse model. And then those mice bearing THP-1 cells were administered with ATO alone or ATO/G-CSF. The tumor volumes were recorded every 3 days (Fig. 6A). We found that the growth of the tumors was significantly slower in the ATO/G-CSF group, compared with the ATO group (p < 0.01, Fig. 6B). All the mice were sacrificed at Day 17 after treatment and the indicated groups of tumors were photographed and weighted. It was shown that the tumors of the G-CSF/ATO group were significantly smaller than the ATO group (p < 0.01, Fig. 6C and 6D). We also examined the expression of CEBPB and AQP9 of the tumor tissues by immunohistochemistry. It was found that the expression of CEBPB and AQP9 was much stronger in the ATO/G-CSF group than in the ATO group (Fig. 6E), consistent with the observations in the previous in vitro experiments.

7. G-CSF didn’t enhance the liver toxicity of ATO in the xenograft mouse model.

Since ATO may exhibit liver toxicity in clinical practice [17], we then tested whether G-CSF would aggravate liver dysfunction through promoting the uptake of ATO. We separated the livers from the mice treated with ATO alone or G-CSF/ATO in combination, and analyzed the liver morphology after HE staining. We didn’t observe severe liver toxicity in the ATO group or the G-CSF/ATO group of mice, and there was no significant difference between the two groups of livers (Fig. 6F).

Arsenic trioxide is highly effective in recurrent and newly diagnosed acute promyelocytic leukemia. In AML patients of non-APL subtypes, some researchers tried to add ATO to the subcutaneous injection of low-dose cytarabine, hoping to improve the clinical treatment effect. Unfortunately, the addition of ATO didn’t show benefit for these AML patients [18]. Arsenic trioxide has anti-proliferative and pro-apoptotic effects on a variety of AML cell lines in vitro [19]. ATO affects the biological behavior of leukemia cells through a series of mechanisms in AML, including induction of cell cycle arrest, apoptosis and autophagy; generation of reactive oxygen species and accumulation of intracellular hydrogen peroxide; release of cytochrome c and activation of caspases; inhibition of glutathione peroxidase; and promotion of differentiation and anti-angiogenesis [20–22]. Considering the antitumor potential of ATO and its manageable toxicities, it’s necessary to investigate other strategies to improve the treatment efficiency of ATO in AML patients.

G-CSF is an important cytokine that regulates cell growth, differentiation and migration. It has been widely used in the patients with neutropenia after chemotherapy. In this study, we demonstrated that the priming treatment of G-CSF can significantly promote the cytotoxic effect of ATO on AML cell lines. The combination of ATO and G-CSF can induce cell apoptosis dramatically. We also found that the combination of G-CSF with ATO could also increase the intracellular concentration of ATO in AML cells which can further inhibit cell proliferation and induce cell apoptosis. To evaluate the combinational effect of G-CSF and ATO more precisely, more experiments using the primary cells from AML patients or using the patient-derived xenograft models would be expected.

As a member of AQP families, AQP9 is the only channel that has been reported to be responsible for arsenic uptake [15, 16]. We and other researchers all found that the expression of AQP9 was higher in NB4 cells than in HL-60 and THP-1 cells [7, 16]. This may partly explain the reason why ATO is more sensitive in APL than non-M3 AML. Moreover, when we treated HL-60 or THP-1 cells with G-CSF, we found that the expression of AQP9 was significantly upregulated, and that the upregulation was abolished when AQP9 was knocked down by siRNA, suggesting that G-CSF indeed enhances the transportation of ATO through the regulation of AQP9. Liver dysfunction is the major side effect during ATO treatment in clinical practice [17]. We compared the liver morphology between the two groups of mice treated with ATO alone and G-CSF/ATO in combination. We found that the addition of G-CSF didn’t increase obvious hepatic impairment rate. This finding is consistent with the results of a previous Phase I clinical trial that treated AML patients with the combination of ATO and decitabine [23], a demethylating agent that may also upregulate the expression of AQP9 [9].

Several potential transcription factors including CEBPB, FOS, NFKB1, STAT3 and SP1 may response to G-CSF treatment. CEBPB plays an important role in hematopoiesis. It has been predicted that CEBPB is a potential transcript factor of AQP9 [24]. When CEBPB was knocked down, the expression of AQP9 was also dramatically inhibited. This suggests that the expression of AQP9 may be regulated by the transcription factor CEBPB. It was reported that JAK-STAT3 signal pathway is the upper regulator of CEBPB [25]. We propose that when G-CSF binds its receptor G-CSFR, the JAK-STAT3 signal pathway can be activated, resulting in the upregulation of CEBPB. More studies will be performed to reveal the mechanism of how CEBPB regulates the transcription of AQP9 in the future. In addition, since it has been reported that p38 can regulate the expression of AQP9 [10], and that p38α can regulate the transcription of CEBPB [25], the role of p38 in the G-CSF-CEBPB-AQP9 axis also remains to be characterized.

In conclusion, we suggest that the priming treatment with G-CSF can significantly enhance the cytotoxic activity of ATO through upregulating the expression of AQP9 in vitro and in vivo (as shown in Fig. 6G). The combination of G-CSF and ATO would be a potential therapeutic strategy for AML patients.

G-CSF: granulocyte colony stimulating factor; ATO: arsenic trioxide; AML: acute myeloid leukemia; APL: acute promyelocytic leukemia; AQP9: aquaporin-9; CEBPB: CCAAT enhancer binding protein beta; RT-qPCR: quantitative reverse transcription PCR; siRNA: small interfering RNA; HNF1A: HNF1 homeobox A; MAPK: mitogen-activated protein kinase; NC: negative control; HE: hematoxylin and eosin.

Ethics approval and consent to participate:

This study was approved by the Medical Ethics Committee of Ren Ji Hospital affiliated to Shanghai Jiao Tong University School of Medicine.

Consent for publication:

Not applicable.

Availability of data and materials:

Not applicable.

Competing interests:

The authors declare that they have no competing interests.

Funding:

This work is supported by Shanghai Natural Science Foundation Project (19ZR1431400).

Authors' contributions:

Hua Zhong conceived and supervised the project. Hua Zhong, Huanbin Zhao and Wanbin Fu designed most of the experiments, analyzed the data and drafted the manuscript. Wanbin Fu and Gelan Zhu performed most of the in vivo and in vitro experiments. Lan Xu, Jia Liu, Xiaofeng Han and Jian Hou participated in project discussion and assisted in data analysis. Junying Wang and Xinpeng Wang assisted in animal experiments.

Acknowledgements:

We acknowledge all members of the department of hematology of Ren Ji Hospital for the kindly help and inspiring discussion in this study.

Dohner H, Weisdorf DJ, Bloomfield CD. Acute Myeloid Leukemia. N Engl J Med. 2015;373(12):1136–1152.
Shallis RM, Wang R, Davidoff A, Ma X, Zeidan AM. Epidemiology of acute myeloid leukemia: Recent progress and enduring challenges. Blood Rev. 2019;36:70–87.
Walter RB, Estey EH. Management of older or unfit patients with acute myeloid leukemia. Leukemia. 2015;29(4):770–775.
Dos Santos GA, Kats L, Pandolfi PP. Synergy against PML-RARa: targeting transcription, proteolysis, differentiation, and self-renewal in acute promyelocytic leukemia. J Exp Med. 2013;210(13):2793–2802.
Wang ZY, Chen Z. Acute promyelocytic leukemia: from highly fatal to highly curable. Blood. 2008;111(5):2505–2515.
Falchi L, Verstovsek S, Ravandi-Kashani F, Kantarjian HM. The evolution of arsenic in the treatment of acute promyelocytic leukemia and other myeloid neoplasms: Moving toward an effective oral, outpatient therapy. Cancer. 2016;122(8):1160–1168.
Leung J, Pang A, Yuen WH, Kwong YL, Tse EW. Relationship of expression of aquaglyceroporin 9 with arsenic uptake and sensitivity in leukemia cells. Blood. 2007;109(2):740–746.
Hu J, Liu YF, Wu CF, Xu F, Shen ZX, Zhu YM, Li JM, Tang W, Zhao WL, Wu W, Sun HP, Chen QS, Chen B, Zhou GB, Zelent A, Waxman S, Wang ZY, Chen SJ, Chen Z. Long-term efficacy and safety of all-trans retinoic acid/arsenic trioxide-based therapy in newly diagnosed acute promyelocytic leukemia. Proc Natl Acad Sci U S A. 2009;106(9):3342–3347.
Chau D, Ng K, Chan TS, Cheng YY, Fong B, Tam S, Kwong YL, Tse E. Azacytidine sensitizes acute myeloid leukemia cells to arsenic trioxide by up-regulating the arsenic transporter aquaglyceroporin 9. J Hematol Oncol. 2015;8:46.
Wei X, Ren X, Jiang R, Li H, Gao F, Chen Y, Hou J, Liu X, Sun S, Yang M. Phosphorylation of p38 MAPK mediates aquaporin 9 expression in rat brains during permanent focal cerebral ischaemia. J Mol Histol. 2015;46(3):273–281.
Arima H, Yamamoto N, Sobue K, Umenishi F, Tada T, Katsuya H, Asai K. Hyperosmolar mannitol simulates expression of aquaporins 4 and 9 through a p38 mitogen-activated protein kinase-dependent pathway in rat astrocytes. J Biol Chem. 2003;278(45):44525–44534.
Semerad CL, Liu F, Gregory AD, Stumpf K, Link DC. G-CSF is an essential regulator of neutrophil trafficking from the bone marrow to the blood. Immunity. 2002;17(4):413–423.
Mehta HM, Malandra M, Corey SJ. G-CSF and GM-CSF in Neutropenia. J Immunol. 2015;195(4):1341–1349.
te Boekhorst PA, Lowenberg B, Vlastuin M, Sonneveld P. Enhanced chemosensitivity of clonogenic blasts from patients with acute myeloid leukemia by G-CSF, IL-3 or GM-CSF stimulation. Leukemia. 1993;7(8):1191–1198.
Bhattacharjee H, Rosen BP, Mukhopadhyay R. Aquaglyceroporins and metalloid transport: implications in human diseases. Handb Exp Pharmacol. 2009(190):309–325.
Iriyama N, Yuan B, Yoshino Y, Hatta Y, Horikoshi A, Aizawa S, Takeuchi J, Toyoda H. Aquaporin 9, a promising predictor for the cytocidal effects of arsenic trioxide in acute promyelocytic leukemia cell lines and primary blasts. Oncol Rep. 2013;29(6):2362–2368.
Zhou GB, Zhang J, Wang ZY, Chen SJ, Chen Z. Treatment of acute promyelocytic leukaemia with all-trans retinoic acid and arsenic trioxide: a paradigm of synergistic molecular targeting therapy. Philos Trans R Soc Lond B Biol Sci. 2007;362(1482):959–971.
Burnett AK, Hills RK, Hunter A, Milligan D, Kell J, Wheatley K, Yin J, McMullin MF, Cahalin P, Craig J, Bowen D, Russell N. The addition of arsenic trioxide to low-dose Ara-C in older patients with AML does not improve outcome. Leukemia. 2011;25(7):1122–1127.
Rojewski MT, Baldus C, Knauf W, Thiel E, Schrezenmeier H. Dual effects of arsenic trioxide (As2O3) on non-acute promyelocytic leukaemia myeloid cell lines: induction of apoptosis and inhibition of proliferation. Br J Haematol. 2002;116(3):555–563.
Rojewski MT, Korper S, Schrezenmeier H. Arsenic trioxide therapy in acute promyelocytic leukemia and beyond: from bench to bedside. Leuk Lymphoma. 2004;45(12):2387–2401.
Roboz GJ, Dias S, Lam G, Lane WJ, Soignet SL, Warrell RP, Jr., Rafii S. Arsenic trioxide induces dose- and time-dependent apoptosis of endothelium and may exert an antileukemic effect via inhibition of angiogenesis. Blood. 2000;96(4):1525–1530.
Miller WH, Jr., Schipper HM, Lee JS, Singer J, Waxman S. Mechanisms of action of arsenic trioxide. Cancer Res. 2002;62(14):3893–3903.
Welch JS, Klco JM, Gao F, Procknow E, Uy GL, Stockerl-Goldstein KE, Abboud CN, Westervelt P, DiPersio JF, Hassan A, Cashen AF, Vij R. Combination decitabine, arsenic trioxide, and ascorbic acid for the treatment of myelodysplastic syndrome and acute myeloid leukemia: a phase I study. Am J Hematol. 2011;86(9):796–800.
Rouillard AD, Gundersen GW, Fernandez NF, Wang Z, Monteiro CD, McDermott MG, Ma'ayan A. The harmonizome: a collection of processed datasets gathered to serve and mine knowledge about genes and proteins. Database (Oxford). 2016;2016. pii: baw100.
Wang W, Xia X, Mao L, Wang S. The CCAAT/Enhancer-Binding Protein Family: Its Roles in MDSC Expansion and Function. Front Immunol. 2019;10:1804.

No competing interests reported.

Supplementarymaterialsoriginalimagesofwesternblotting.ppt

Download PDF

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

G-CSF Upregulates the Expression of Aquaporin-9 through CEBPB to Enhance the Cytotoxic Activity of Arsenic Trioxide to Acute Myeloid Leukemia Cells

Archived Versions:

Version 1

Abstract

Figures

Background

Methods

Results

Discussion

Conclusions

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Archived Versions:

Version 1