m6A demethylase Fto regulates TNF-α-induced inflammatory response in cementoblasts

doi:10.21203/rs.3.rs-1424325/v1

Download PDF

Research Article

m⁶A demethylase Fto regulates TNF-α-induced inflammatory response in cementoblasts

https://doi.org/10.21203/rs.3.rs-1424325/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Apical periodontitis is among the most frequently occurring pathological lesions around the root apex, which can cause alveolar bone defect and tooth loss, even leading to rheumatoid arthritis, cardiovascular diseases, and diabetes. The exactly underlying molecular mechanisms are still evolving. Fat mass and obesity-associated protein (Fto) is the first identified RNA m⁶A demethylase/eraser that plays key regulatory roles in multiple biological processes. However, it remains unclear whether Fto is involved in the inflammatory response in cementoblasts. In the current study, we investigated the effect of tumor necrosis factor-alpha (TNF-α)-induced Fto expression in mouse cementoblast cell line (OCCM-30 cells). Following apical periodontitis induction, mice showed downregulation in the expression of Fto, associated with a significant increase in the inflammatory cell infiltration around the root apex. Moreover, OCCM-30 cells exposed to TNF-α showed similar changes, which presented an upregulation in inflammatory-related genes, whereas a decrease of Fto. Furthermore, qRT-PCR and ELISA analysis showed knockdown of Fto promoted in the expression of Il-6, Mcp1, and Mmp9 in TNF-α-treated OCCM-30 cells as compared to NC cells, whereas did not affect the mRNA stability. Interestingly, Fto knockdown activated the p65, p38, and ERK1/2 but not JNK signaling pathways after TNF-α administration in OCCM-30 cells. Taken together, these data suggest that TNF-α decreasing expression of Fto might play a critical role in the inflammatory response, and modulation of Fto might change the inflammatory response.

Fto

inflammatory response

MAPK

NF-κB

mRNA stability

Apical periodontitis is among the most frequently occurring pathological lesions around the root apex[1], which is considered a failure of a dynamic encounter between root canal bacterial infection and host defenses[2]. It is proved that apical periodontitis is characterized by dense inflammatory infiltrates and increased osteoclast activities[1, 3]. The exposure of dental pulp to the mouth, which is caused by dental caries, dental fractures, or improper clinical procedures, results in pulp infection and necrosis, subsequently generating apical periodontitis without treatment in time[4]. Apical periodontitis can cause alveolar bone defect and tooth loss, it can even lead to systemic disorders, including rheumatoid arthritis[5, 6], cardiovascular diseases[7–9], and diabetes[10].

N6-methyladenosine (m⁶A) RNA methylation is the most prevalent and predominant chemical modification regulating gene expression in eukaryotic mRNAs at the post-transcription level[11], nearly 0.4% of all adenosine nucleotides in RNAs in mammals[12]. m⁶A modification is dynamically regulated by RNA methyltransferases (also known as writers, METTL3, METTL14, and WTAP), removed by demethylases (or called erasers, FTO, and ALKBH), and recognized by m⁶A-binding proteins (conventionally named readers, YTH domain family members)[13]. Fat mass and obesity-associated protein (FTO) is the first identified RNA m⁶A demethylase[14], which is a member of the non-heme dioxygenase[Fe(II) and 2-oxoglutarate-dependent dioxygenases] superfamily[15]. FTO is largely distributed in livers, the hypothalamus, islets, skeletal muscle, adipose tissue, and macrophages[16]. It has strong demethylase activity and involves in multiple mRNA-related processes, including transcriptional stability, alternative splicing, mRNA translocation, and protein translation[17–19]. Increasing studies have reported that FTO plays an important role in a variety of disorders and diseases, such as acute myeloid leukemia, heart failure, type 2 diabetes, and so on[16, 20–22]. More importantly, previous studies have shown that FTO involves in multiple inflammatory disorders. Dubey et al[23] and Yu et al[24] reported that loss-of-function of FTO upregulated LPS-induced rat cardiomyoblasts expression of inflammatory cytokine genes or inhibited palmitic acid-induced cardiac inflammation, respectively. Luo et al[25] found that ablation of FTO suppressed the NLRP3 inflammasome, on the contrary, Yu et al[26] exhibited that overexpression of FTO inhibited activation of the NLRP3 inflammasome. Furthermore, silencing FTO regulated the M1 pro-inflammatory macrophages polarization[27, 28]. However, it is unclear whether FTO is involved in apical periodontitis.

Cementum is a thin layer and mineralized tissue attached to the tooth-root surface[29], but it is an important part of periodontium functionally, which regenerates in response to occlusal forces. It supports periodontal ligament fibers anchoring teeth to alveolar bone[30], and serves as a crucial microbial barrier against invasion and destruction[31] and maintaining tooth stability. Cellular cementum contains cementoblasts and their mineral deposits. Cementoblasts contribute to cementum formation by matrix deposition on the tooth root surface and subsequently mineralization, so they can protect the integrity of the root surface and regulate the resorption of cementum.

In the current study, we aim to explore whether Fto involves in TNF-α‐induced inflammatory response and explore the molecular mechanism in cementoblasts.

Chemicals and Antibodies

Recombinant murine TNF-α was purchased from PeproTech(Rocky Hill, NJ, USA). Actinomycin D was obtained from MedChem Express (Princeton, MA, USA). Antibodies for phospho-ERK1/2 (p-ERK1/2, Thr202/Tyr204), total ERK1/2, phospho-JNK (p-JNK, Thr183/Tyr185), total JNK, phospho-p38 MAP kinase (p-p38, Thr180/Tyr182), total p38 MAPK, phospho-nuclear factor-kappa B p65 (p-p65, Ser536) and total p65 were purchased from Cell Signaling Technology (Danvers, MA, USA).

Antibodies for Fto were purchased from Abcam (Cambridge, MA, USA) and Proteintech (Wuhan, Hubei, China).

Apical periodontitis induction

All procedures were in accordance with the Ethics Committee of School and Hospital of Stomatology, Wuhan University, China. As in previous studies[32, 33], 8-week-old mice(C57BL/6J) were used for induction of apical periodontitis. In brief, animals were fixed on the table after being anesthetized. The right mandibular first molar pulp was opened using a controlled rotation handpiece with a No.1/4 round bur. Control groups were no surgical interventions on the left mandibular first molar. Animals were euthanized with excessive CO₂ for following experiments after the pulp champers were exposed for 14 days.

Histological and immunohistochemical analysis

The mandibles and the periapical tissues were carefully extracted and fixed with 4% paraformaldehyde for 24 hours at room temperature. After decalcification with 10% ethylenediaminetetraacetic acid solution for 1.5 months, tissues were dehydrated, embedded in paraffin, and sectioned at 5μm thickness. Hematoxylin and eosin (HE, Servicebio, China) were performed according to the manufacturer’s instructions. Immunohistochemical analyses for Fto (1:100, Servicebio, China) were also performed. The expression of Fto in cementoblasts and ambient periodontal tissues were verified and photographed with a microscope.

Cell culture and treatment

An immortalized cementoblast cell line OCCM-30 was generously provided by Dr. Martha J. Somerman (National Institutes of Health, MD, USA), which was cultured in Dulbecco's modified Eagle's medium (DMEM, Hyclone, USA) supplemented with 10% fetal bovine serum(FBS, Gibco) in 5% CO₂ at 37°C as previously described[34]. The medium was changed to DMEM with 5% FBS when TNF-α (Peprotech) or actinomycin D (MCE) were applied. Actinomycin D was dissolved in dimethyl sulfoxide (DMSO) and the final concentration was less than 0.1%. HEK293T was cultured in DMEM (Hyclone), supplemented with 10% FBS(Gibco).

Plasmid construction, lentivirus production, and cell infection

pLKO.1-puro vector was used to knockdown Fto, and the shRNA against Fto and negative control(NC) was provided by MiaoLingBio. The shFto and shNC sequences were listed in Table 1. Lentiviruses were generated in HEK293T cells which were transfected by Lipofectamine 2000 Transfection Reagent (Thermo Fisher Scientific) with viral packaging constructs pMD2.G (Addgene) and pSPAX2 (Addgene). The lentiviral supernatant was collected every 24 hours and filtered through a 0.45 μm membrane (Millipore). The lentiviruses were used to infect OCCM-30 cells for 48 hours, then the cultured medium was changed by selective medium supplemented with blasticidin (20 µg/mL) or puromycin (6 µg/mL) in accordance with the plasmid instructions. The survived cells were used for in vitro experiments. Infection efficiency was measured by real-time quantitative polymerase chain reaction (qRT-PCR) and western blot.

Quantitative Real-time Polymerase Chain Reaction (qRT-PCR)

Total RNA was extracted by FastPure Cell/Tissue Total RNA Isolation Kit V2 (Vazyme), and cDNA was synthesized with a HiScript II Q RT SuperMix for qPCR (+gDNA wiper) (Vazyme). qRT-PCR was conducted on a PCR system (Bio-Rad, Hercules, CA) with ChamQ Universal SYBR qPCR Master Mix (Vazyme). The 2^-ΔΔCT method was used to normalize the expression of target genes to Gapdh or β-Actin. Primer sequences were shown in Table 2.

Western Blot

The protein samples were harvested using M-PER mammalian protein extraction reagent(Thermo Fisher Scientific) supplemented with protease inhibitors(Roche) and phosphatase inhibitors (Roche), and centrifugated with high speed at 4 °C. The supernatant was collected to examine the protein concentration using a BCA assay kit (Biosharp) and stored at -20 ℃. Cell lysates (20-30μg) were separated by 10% SDS-PAGE and transferred to polyvinylidene fluoride membranes (Millipore). After being blocked with 5% nonfat milk, the membrane was incubated with primary antibodies against Fto (Abcam or Proteintech), phospho-ERK1/2 (Thr202/Tyr204, CST), total ERK1/2, phospho-JNK (Thr183/Tyr185, CST), total JNK, phospho-p38 MAP kinase (Thr180/Tyr182, CST), total p38 MAPK, phospho-nuclear factor-kappa B p65 (Ser536, CST) and total p65 overnight at 4°C. β-Actin (Servicebio) or GAPDH (Servicebio) was used as the loading control. The membrane was incubated with the WesternBright® ECL kit (Advansta) and scanned by the Odyssey LI-COR scanner. ImageJ software was used to analyze the images.

Enzyme‐linked immune sorbent assay (ELISA)

OCCM-30 cells were stimulated with 20 ng/mL TNF-α for 12h, and the supernatants were collected, centrifugated, and stored at -80°C. The concentrations of mouse Il-6 were measured using an ELISA kit (Dakewe Bio-engineering, China) following the product instructions.

mRNA Stability Assay

OCCM-30 cells were treated with 20 ng/mL TNF-α for 6h following stimulated with 10µg/mL actinomycin D (MCE) for 0, 2, and 4 h. Total RNA was reverse-transcribed into cDNA, and qRT-PCR was conducted to measure the mRNA stability. The mRNA transcript levels were normalized to 0h.

Statistical Analysis

A two-tailed unpaired Student’s t-test was applied to statistical analysis. P values of less than 0.05 were considered statistically significant. All statistical analyses were performed using GraphPad Prism 7.0. In the figures, values were presented as mean ± SEM, ∗P < 0.05, and ∗∗P < 0.01.

Apical periodontitis inhibited expression of fat mass and obesity‑associated protein ( Fto )

Increasing studies have shown that Fto involves in multiple inflammatory disorders[23–28]. Here, we established apical periodontitis model to know whether Fto is also involved in it. After 14 days, inflammatory cells accumulation in apical periodontitis group were much more and clearly than that in control group, which meant that we succeeded in setting up the murine model(Fig. 1A). Immunohistochemistry staining showed that Fto were positive in cementoblasts and periodontal ligament cells. Interestingly, it showed a sharply reduced expression of Fto in cementoblasts between the control group and the apical periodontitis group (Fig. 1B).

Decreased Fto expression and associated upregulation of inflammatory-related genes in the TNF-α‑treated OCCM-30 cells

In our animal model of apical periodontitis, we found decreased Fto expression in the periapical area of model mice compared to the control group. To further validate our findings, mouse cementoblast cell line (OCCM-30 cells) were treated with or without TNF-α (20 ng/ml) for 0–24 h (or different TNF-α concentrations (0–40 ng/mL) for 24 h), and mRNA expression of Fto and inflammatory-related genes was evaluated by qRT-PCR. Western blot was also performed on the extracted total protein. Similar to the in vivo findings, we observed that TNF-α‑treated decreased Fto expression at both the mRNA and protein levels in a time-dependent (Fig. 2A, B) manner but not in a concentration-dependent manner (Fig. 2C) in OCCM-30 cells. Furthermore, we also observed a corresponding increase in the relative mRNA expression of inflammatory-related genes Il-6, Mcp1, and Mmp9 (Fig. 2D, E, F).

Fto knockdown upregulated expression of inflammatory-related genes in OCCM-30 cells

We found that the downregulation of Fto in the periapical area of apical periodontitis mice was accompanied by an increase of inflammatory cell infiltration. To further strengthen our findings, we performed short hairpin RNA (shRNA)-mediated knockdown experiments. NC and Fto knockdown OCCM-30 cells were stimulated with 20 ng/mL TNF-α for 6 h. Knockdown efficiency of Fto was confirmed by qRT-PCR (Fig. 3A) and western blot (Fig. 3B). The qRT-PCR and western blot analysis showed that Fto was downregulated in the Fto-knockdown cells both at the basal level and after TNF-α stimulation (Fig. 3C and D). Importantly, knockdown of Fto upregulated Il-6, Mcp1, and Mmp9 expression after TNF-α stimulation (Fig. 3E, G, H), confirming that Fto knockdown could lead to an inflammatory surge. Besides, we also noticed a rise in protein expression of Il-6 by ELISA (Fig. 3F).

Fto knockdown did not affect inflammatory-related genes mRNA stability

To further explore whether Fto promoted the degradation of inflammatory-related genes mRNA, we measured the mRNA stability of Il-6, Mcp1, and Mmp9 after Fto knockdown. NC and Fto knockdown OCCM-30 cells were stimulated with 20 ng/mL TNF-α for 6 h and then treated with 10 µg/mL actinomycin D for the indicated times (0 h, 2 h, and 4 h). As results, there was no significant difference in the mRNA stability of these inflammatory-related genes between the Fto-knockdown and NC groups (Fig. 4A, B, C).

Fto knockdown activated TNF-α-induced NF-κB, p38, and ERK1/2 signaling pathways in OCCM-30 cells.

In consideration of the positive correlation between expression of inflammatory cytokines and activation of NF-κB and MAPK signaling pathways[35, 36], we next identified whether Fto knockdown affected TNF-α-induced NF-kB and MAPK signaling pathways activation. Western blot was performed to evaluate the phosphorylation levels of p65, p38, ERK1/2, and JNK. The results indicated that Fto knockdown remarkably promoted the levels of p-p65, p-p38, and p-ERK1/2 compared with those in the control group (Fig. 5A-C), but there was no significant difference in p-JNK phosphorylation between Fto knockdown and NC OCCM-30 cells.

Apical periodontitis is considered a failure of a dynamic encounter between root canal bacterial infection and host defenses, which eventually causes inflammatory infiltrates and periapical bone resorption[2, 3]. Emerging studies have shown that Fto regulates inflammatory responses[24, 25, 27, 28, 37]. In our present study, we found that expression of Fto was decreased in the apical periodontitis mouse model accompanied by a prominently inflammatory response. More importantly, we also demonstrated that TNF-α‑treated decreased Fto expression and associated upregulation of inflammatory-related genes in OCCM-30 cells. Fto knockdown remarkably promoted the expression of Il-6, Mcp1, and Mmp9 compared with those in the NC group after TNF-α stimulation, whereas did not affect inflammatory-related genes mRNA stability. The mechanism behind the inflammatory-related genes increase may activate NF-κB, p38, and ERK1/2 but not JNK signaling pathways.

Our study demonstrates that apical periodontitis inhibited Fto around the root apex, where cementoblasts are located. Besides, we also investigated that TNF-α‑treated decreased Fto expression at both the mRNA and protein levels in a time-dependent manner with a robust increase of Il-6, Mcp1, and Mmp9 in OCCM-30 cells. The change in expression of Fto was associated with increased inflammatory cell infiltration. Thus, we speculated that expression of Fto is downregulated in cementoblasts in an inflammatory environment. Dubey reported that LPS-induced endotoxemia significantly downregulated FTO[23], thus they observed an increase in global m⁶A-RNA methylation in the cardiac tissues of LPS-induced endotoxemic mice and in LPS-induced H9c2 cardiomyoblasts. Consistently, previous research[37] also claimed that LPS suppressed FTO in RAW264.7 macrophages, which explained the upregulating Socs1 m⁶A methylation in LPS-treated macrophages activation.

m⁶A modification is dynamically regulated by RNA methyltransferases/writers(METTL3, METTL14, and WTAP), demethylases/erasers (FTO, and ALKBH), and m⁶A-binding proteins/ readers (YTH domain family members)[37], which is involved in the various physiological and pathological processes, including inflammatory disorders. Here, we found m⁶A demethylase Fto knockdown upregulated inflammatory-related genes (Il-6, Mcp1, and Mmp9) after TNF-α stimulation in OCCM-30 cells. Consistently, Dubey[23] and McFadden[38] revealed that knockdown or depletion of FTO generally led to a strong upregulation of proinflammatory cytokines TNF-α and IL-6, respectively. In the contrast, some articles claimed that FTO overexpression significantly enhanced inflammatory responses in human cardiomyocyte AC16 cell line[24] or RAW264.7 cells and bone marrow-derived macrophages[37]. The discrepancy between our study and these studies may be attributed to the differences in cell types, cell species, or administration conditions. Interestingly, knockdown of Fto did not affect the mRNA stability of Il-6, Mcp1, and Mmp9, which is in accordance with earlier research about YTHDF2[39]. Our findings indicated that Fto is involved in the regulation of the TNF-α-stimulated inflammatory reactions but not via regulating the stability of Il-6, Mcp1, and Mmp9 mRNAs in OCCM-30 cells.

The expression of inflammatory cytokines is tightly linked with the activation of NF-κB and MAPK signaling pathways[35, 36]. Furthermore, accumulating evidence has indicated that m⁶A mRNA modification contributes to different functions via MAPK and NF-κB signaling pathways[23, 39–42]. We found that Fto knockdown upregulated Il-6, Mcp1, and Mmp9 in TNF-α-induced OCCM-30 cells. To explore whether Fto knockdown activated NF-κB and MAPK signaling pathways to promote inflammatory response, the current study measured the phosphorylation of several key molecules in those signaling pathways. The results indicated that Fto knockdown upregulated the phosphorylation levels of p65, p38, and ERK1/2 in OCCM-30 cells after TNF-α stimulation, but did not affect the phosphorylation level of JNK, which demonstrated that Fto regulated inflammatory-related genes expression via p65, p38, and ERK1/2 but not JNK signaling pathways in OCCM-30 cells. Theoretically, there may be three possible molecular mechanisms for the increased expression of inflammation-related genes in Fto knockdown cells after TNF-α stimulation: 1) depletion of Fto directly activated the signaling pathways of inflammation-related genes expression, 2) depletion of Fto promoted the response triggered by TNF-α, or 3) both. The specific mechanism remains to be elucidated, and the gain of the Fto function experiment should also be further researched.

Taken together, we conclude that Fto expression was suppressed in an inflammatory environment in mouse cementoblasts. Fto knockdown upregulated inflammatory response by activating p65, p38, and ERK1/2 but not JNK, but did not affect the mRNA stability of inflammation-related genes. These data suggest that TNF-α decreasing expression of Fto might play a critical role in the inflammatory response, and modulation of Fto might change the inflammatory response.

Acknowledgments

This work was supported by the National Natural Science Foundation of China (Grants 81970970, 82001089, and 81671020).

Conflict of interests

The authors declare that they have no known or potential conflict of interest.

Author Contributions

The study was designed by H H, MY D, B L, and Q S. B L conducted the experiments. Other researchers (MY D, Q S, and ZG C) helped with experiments. B L collected and analyzed the data. H H, MY D, and B L drafted the manuscript. All authors revised and approved the final version of the manuscript and agreed to be accountable for all aspects of the work.

Data Availability

The data presented in the study are included in the article or Supplementary Materials. Further inquiries can be directed to the corresponding author.

Belibasakis, G.N., D.K. Rechenberg and M. Zehnder, The receptor activator of NF-κB ligand‐osteoprotegerin system in pulpal and periapical disease. International Endodontic Journal, 2013. 46(2): p. 99–111. doi:10.1111/j.1365-2591.2012.02105.x
Nair, P.N., Apical periodontitis: a dynamic encounter between root canal infection and host response. Periodontol 2000, 1997. 13(1): p. 121 – 48. doi: 10.1111/j.1600-0757.1997.tb00098.x
Da Silva, R.A.B., et al., Toll-like Receptor 2 Knockout Mice Showed Increased Periapical Lesion Size and Osteoclast Number. Journal of Endodontics, 2012. 38(6): p. 803–813. doi: 10.1016/j.joen.2012.03.017
Nair, P.N.R., Pathogenesis of Apical Periodontitis and the Causes of Endodontic Failures. Critical Reviews in Oral Biology & Medicine, 2004. 15(6): p. 348–381. doi: 10.1177/154411130401500604
Pischon, N., et al., Association Among Rheumatoid Arthritis, Oral Hygiene, and Periodontitis. Journal of periodontology (1970), 2008. 79(6): p. 979–986. doi: 10.1902/jop.2008.070501
de Pablo, P., et al., Periodontitis in systemic rheumatic diseases. Nature reviews. Rheumatology, 2009. 5(4): p. 218–224. doi: 10.1038/nrrheum.2009.28
Emingil, G., et al., Association Between Periodontal Disease and Acute Myocardial Infarction. Journal of periodontology (1970), 2000. 71(12): p. 1882–1886. doi: 10.1902/jop.2000.71.12.1882
Elter, J.R., et al., Relationship of Periodontal Disease and Tooth Loss to Prevalence of Coronary Heart Disease. Journal of periodontology (1970), 2004. 75(6): p. 782–790. doi: 10.1902/jop.2004.75.6.782
Renvert, S., et al., Analysis of periodontal risk profiles in adults with or without a history of myocardial infarction. Journal of clinical periodontology, 2004. 31(1): p. 19–24. doi: 10.1111/j.0303-6979.2004.00431.x
Rodrigues, D.C., et al., Effect of Non-Surgical Periodontal Therapy on Glycemic Control in Patients with Type 2 Diabetes Mellitus. Journal of periodontology (1970), 2003. 74(9): p. 1361–1367. doi: 10.1902/jop.2003.74.9.1361
Zhao, B.S., I.A. Roundtree and C. He, Post-transcriptional gene regulation by mRNA modifications. Nature Reviews Molecular Cell Biology, 2017. 18(1): p. 31–42. doi: 10.1038/nrm.2016.132
Wei, C.M.G.A., Methylated nucleotides block 50 terminus of HeLa cell messenger RNA. Cell, 1975. 4: p. 379–386. doi: 10.1016/0092-8674(75)90158-0
Zhang, C., J. Fu and Y. Zhou, A Review in Research Progress Concerning m6A Methylation and Immunoregulation. Frontiers in Immunology, 2019. 10. doi: 10.3389/fimmu.2019.00922
Jia, G., et al., N6-Methyladenosine in nuclear RNA is a major substrate of the obesity-associated FTO. Nature Chemical Biology, 2011. 7(12): p. 885–887. doi: 10.1038/nchembio.687
Gerken, T., et al., The Obesity-Associated FTO Gene Encodes a 2-Oxoglutarate-Dependent Nucleic Acid Demethylase. Science, 2007. 318(5855): p. 1469–1472. doi: 10.1126/science.1151710
Frayling, T.M., et al., A Common Variant in the FTO Gene Is Associated with Body Mass Index and Predisposes to Childhood and Adult Obesity. Science, 2007. 316(5826): p. 889–894. doi: 10.1126/science.1141634
Meyer KD, S.Y.Z.P., Comprehensive Analysis of mRNA Methylation Reveals Enrichment in 30 UTRs and near Stop Codons. Cell, 2012. 149(7): p. 1635–46. doi: 10.1016/j.cell.2012.05.003
Wang, X., et al., N6-methyladenosine-dependent regulation of messenger RNA stability. Nature, 2014. 505(7481): p. 117–120. doi: 10.1038/nature12730
Dominissini, D., et al., Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq. Nature, 2012. 485(7397): p. 201–206. doi: 10.1038/nature11112
Li, Y., et al., N6-Methyladenosine Demethylase FTO Contributes to Neuropathic Pain by Stabilizing G9a Expression in Primary Sensory Neurons. Advanced Science, 2020. 7(13): p. 1902402. doi: 10.1002/advs.201902402
Mathiyalagan, P., et al., FTO-Dependent N6-Methyladenosine Regulates Cardiac Function During Remodeling and Repair. Circulation, 2019. 139(4): p. 518–532. doi: 10.1161/CIRCULATIONAHA.118.033794
Li, Z., et al., FTO Plays an Oncogenic Role in Acute Myeloid Leukemia as a N 6 -Methyladenosine RNA Demethylase. Cancer Cell, 2017. 31(1): p. 127–141. doi: 10.1016/j.ccell.2016.11.017
Dubey, P.K., et al., Increased m6A-RNA methylation and FTO suppression is associated with myocardial inflammation and dysfunction during endotoxemia in mice. Molecular and Cellular Biochemistry, 2021. doi: 10.1007/s11010-021-04267-2
Yu, Y., et al., LuHui Derivative, A Novel Compound That Inhibits the Fat Mass and Obesity-Associated (FTO), Alleviates the Inflammatory Response and Injury in Hyperlipidemia-Induced Cardiomyopathy. Frontiers in Cell and Developmental Biology, 2021. 9. doi: 10.3389/fcell.2021.731365
Luo, J., et al., Targeted Inhibition of FTO Demethylase Protects Mice Against LPS-Induced Septic Shock by Suppressing NLRP3 Inflammasome. Frontiers in Immunology, 2021. 12. doi: 10.3389/fimmu.2021.663295
Yu, J., et al., DNA methylation of FTO promotes renal inflammation by enhancing m6A of PPAR-α in alcohol-induced kidney injury. Pharmacological Research, 2021. 163: p. 105286. doi: 10.1016/j.phrs.2020.105286
Hu, F., et al., MiR-495 regulates macrophage M1/M2 polarization and insulin resistance in high-fat diet-fed mice via targeting FTO. Pflügers Archiv - European Journal of Physiology, 2019. 471(11–12): p. 1529–1537. doi: 10.1007/s00424-019-02316-w
Gu, X., et al., N6-methyladenosine demethylase FTO promotes M1 and M2 macrophage activation. Cellular Signalling, 2020. 69: p. 109553. doi: 10.1016/j.cellsig.2020.109553
Grzesik WJ, N.A., Cementum and periodontal wound healing and regeneration. Crit Rev Oral Biol Med, 2002. 13(6): p. 474–484. doi: 10.1177/154411130201300605
Arzate, H., M. Zeichner-David and G. Mercado-Celis, Cementum proteins: role in cementogenesis, biomineralization, periodontium formation and regeneration. Periodontol 2000, 2015. 67(1): p. 211–33. doi: 10.1111/prd.12062
Foster, B.L., Methods for studying tooth root cementum by light microscopy. Int J Oral Sci, 2012. 4(3): p. 119–28. doi: 10.1038/ijos.2012.57
Silva, M.J.B., et al., The Role of iNOS and PHOX in Periapical Bone Resorption. Journal of Dental Research, 2011. 90(4): p. 495–500. doi: 10.1177/0022034510391792
Wu, Y., et al., 5-Lipoxygenase Knockout Aggravated Apical Periodontitis in a Murine Model. Journal of Dental Research, 2018. 97(4): p. 442–450. doi: 10.1177/0022034517741261
D'Errico, J.A., et al., Employing a transgenic animal model to obtain cementoblasts in vitro. J Periodontol, 2000. 71(1): p. 63–72. doi: 10.1902/jop.2000.71.1.63
Natoli, G., S. Saccani and S. Pantano, p38-dependent marking of inflammatory genes for increased NF-κB recruitment. Nature immunology, 2002. 3(1): p. 69–75. doi: 10.1038/ni748
Chen, L. and W.C. Greene, Shaping the nuclear action of NF-κB. Nature Reviews Molecular Cell Biology, 2004. 5(5): p. 392–401. doi: 10.1038/nrm1368
Du, J., et al., N6-Adenosine Methylation of Socs1 mRNA Is Required to Sustain the Negative Feedback Control of Macrophage Activation. Developmental Cell, 2020. 55(6): p. 737–753.e7. doi: 10.1016/j.devcel.2020.10.023
McFadden, M.J., et al., FTO Suppresses STAT3 Activation and Modulates Proinflammatory Interferon-Stimulated Gene Expression. Journal of molecular biology, 2021: p. 167247–167247. doi: 10.1016/j.jmb.2021.167247
Yu, R., et al., m6A Reader YTHDF2 Regulates LPS-Induced Inflammatory Response. International Journal of Molecular Sciences, 2019. 20(6): p. 1323. doi: 10.3390 / ijms20061323
Li, T., et al., Transcriptome Profiling of m6A mRNA Modification in Bovine Mammary Epithelial Cells Treated with Escherichia coli. International Journal of Molecular Sciences, 2021. 22(12): p. 6254. doi: 10.3390/ijms22126254
Li, R., et al., ATXN2-mediated translation of TNFR1 promotes esophageal squamous cell carcinoma via m6A-dependent manner. Molecular therapy, 2022. doi: 10.1016/j.ymthe.2022.01.006
Zong, X., et al., Mettl3 Deficiency Sustains Long-Chain Fatty Acid Absorption through Suppressing Traf6-Dependent Inflammation Response. The Journal of Immunology, 2019. 202(2): p. 567–578. doi: 10.4049/jimmunol.1801151

Table 1. The shFto and shNC sequences were listed in Table.

	Forward Primer (5′→3′)
NC	AACAAGATGAAGAGCACCAAT
shFto	ATCAAAGGATTTCAACGAGAC

Table 2. Primer sequences were shown in Table.

	Primer (5′→3′)
m-Actb-F	CTCTTTTCCAGCCTTCCTTCTT
m-Actb-R	GAGGTCTTTACGGATGTCAACG
m-Gapdh-F	AGGTCGGTGTGAACGGATTTG
m-Gapdh-R	TGTAGACCATGTAGTTGAGGTCA
m-Fto-F	GACTCGTCCTCACTTTCATCC
m-Fto-R	AAGAGCAGAGCAGCCTACAAC
m-Il-6-F	CCACGGCCTTCCCTACTTC
m-Il-6-R	TTGGGAGTGGTATCCTCTGTGA
m-Mcp1-F	CCCAATGAGTAGGCTGGAGA
m-Mcp1-R	TCTGGACCCATTCCTTCTTG
m-Mmp9-F	TCTTCTGGCGTGTGAGTTTCCA
m-Mmp9-R	TGCACTGCACGGTTGAAGCAAA

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

m⁶A demethylase Fto regulates TNF-α-induced inflammatory response in cementoblasts

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

Declarations

References

Tables

Additional Declarations

Status:

Version 1