Cloning and expression of recombinant human superoxide dismutase 1 (hSOD1) in Bacillus subtilis 1012

doi:10.21203/rs.3.rs-1424372/v1

Download PDF

Research Article

Cloning and expression of recombinant human superoxide dismutase 1 (hSOD1) in Bacillus subtilis 1012

https://doi.org/10.21203/rs.3.rs-1424372/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

As an important member of the antioxidant defense system in vivo, human Cu, Zn superoxide dismutase (hSOD1) has become a potential therapeutic agent against host diseases, and new strategies were developed to achieve high-yield SOD1 by using efficient production systems, like E. coli, yeast, and other eukaryotic expression systems. However, the above systems have their own limitations, such as the formation of inclusion bodies, endotoxins production, and low secretion efficiency. In this study, the hSOD1 coding sequence gene was amplified from human HepG2 cells, cloned into a pHT43-His expression vector, and transformed into Bacillus subtilis system. After the optimization with different media, temperatures, and inducer (IPTG) concentrations, the recombinant hSOD1 was successfully expressed in Bacillus subtilis 1012. The results show that hSOD1 was produced as a soluble form in Super rich medium with 0.2 mM of IPTG at 37°C after the induction for 24 h. Besides, 20 g/L of lactose also displayed the same inductive effect on hSOD1 expression as that by 0.2 mM of IPTG. Finally, hSOD1 was efficiently purified by nickel affinity chromatography, and the specific activity of hSOD1 was determined to be 1625 U/mg in the presence of 800 µM of Cu²⁺ and 20 µM of Zn²⁺. Collectively, Bacillus subtilis 1012 can not only overcome the shortcomings of E. coli and yeast expression systems, but also be directly used for disease treatment as a healthy probiotic. These advantages provided a possibility for the application of oral engineering bacteria 1012-hSOD1 to the clinical treatment in the future.

human superoxide dismutase 1

Bacillus subtilis

Isopropylb-D-thiogalatopyranoside (IPTG)

recombinant expression

enzymatic activity.

Aerobic metabolism usually produces excessive reactive oxygen species (ROS). To maintain the physiological homeostasis, organisms will activate the antioxidant defense system to protect cells against ROS-induced damage in aerobic metabolism. In a previous report, superoxide dismutase (SOD) was proved to be the first line of in vivo defense against ROS(Yang et al., 2020). SOD catalyzes the dismutation of superoxide radicals to produce oxygen and hydrogen peroxide(Nguyen et al., 2020). If the organism has a low SOD level, ROS will accumulate in abundance, leading to DNA strand breakage, protein damage, or even membrane lipid peroxidation (Kim et al., 2017).

All mammals possess three members of SOD with tightly regulated localization patterns. Of these, there are two copper/zinc superoxide dismutases (Cu, Zn-SODs), i.e., SOD1 and SOD3. SOD1 exists in the cytosol, mitochondrial inter-membrane space, and nucleus, while SOD3 is an extracellular dismutase. Both SODs play a pivotal role in the antioxidant defense system. The manganese-containing superoxide dismutase (MnSOD, SOD2) localizes in the mitochondrial matrix. It is beneficial in the occurrence of many diseases like atherosclerosis (Eleutherio et al., 2021). Thus, SOD is a crucial contributor to alleviating the harmful effects of ROS. However, the physiological level of SOD is too low to meet the demand of clinical applications from living organisms.

For decades, researchers have developed new strategies have to achieve high-yield SOD by using efficient production systems like engineering bacterial systems. In previous years, heterologous expression systems of human SOD (hSOD) were constructed, and E coli was the most commonly used one. To date, the recombinant hSOD1 has been expressed in the cytosol of E. coli strain A1645 and E.coli BL21 (DE3) (Hartman et al., 1986; Lin et al., 2018; Yang et al., 2020). Also, hSOD1 was produced in eukaryotic cells, such as Pichia pastoris (Park et al., 2002; Wu et al., 2009), insect cells (Hayward et al., 2002), plant cells (Park et al. 2002), and mammary glands of transgenic animals (Lu et al., 2018). Besides, the full-length hSOD2 recombinant protein was obtained in E.coli Rosetta-gami, BL21 (DE3), and mammalian cells (Hosoki et al., 2012; Pan et al., 2017). Also, hSOD3 was expressed in E.coli (Bae et al., 2013), Pichia pastoris (Chen et al., 2006), insect cells (He et al., 2002), and Chinese hamster ovary cells (Tibell et al., 1987). However, the above systems have their limitations in protein production. For example, the inclusion bodies and endotoxins formed in E.coli expression system increased the production cost and thus limited its application to the large-scale expression of heterologous proteins (K. Zhang et al., 2017). Although the yeast is a perfect expression system for the post-translational protein modification and secretion compared to E.coli, it has a relatively low secretion efficiency for the lack of a strong and strictly regulated promoter.

As a “generally Recognized as Safe” (GRAS) organism, Bacillus subtilis is nonpathogenic and has developed into an attractive host, with no apparent bias of codon usage, especially in the secretion of extracellular functional proteins into the culture medium. This can simplify the purification process of protein and provide a correctly folded and soluble heterologous protein (Gu et al., 2018; Huang et al., 2017; Niu et al., 2018). Collectively, Bacillus subtilis can effectively overcome the shortcomings of E.coli and yeast expression systems. Nowadays, about 60% of commercial enzymes are produced from Bacillus subtilis (Huang et al., 2017). Although hSODs have been expressed in Escherichia coli and Pichia pastoris, there is no report about their expression in Bacillus subtilis.

This study cloned the encoding human sod1 gene into pHT43-His and transformed it into Bacillus subtilis 1012. We investigated the expression level of recombinant hSOD1 with different media, temperatures, and inducers. Further, we examined the effect of Cu²⁺ and Zn²⁺ on the enzymatic activity of purified hSOD1.

2.1 Bacterial strains and plasmids

E.coli DH5α (Tsingke Biotechnology Co., Ltd., Beijing, China) was used for plasmid construction and molecular cloning, and the host strain Bacillus subtilis 1012 (Lab collection) was applied for hSOD1 expression. The E.coli-B.subtilis shuttle plasmid pHT43-His (Miaoling Biological Technology Co., Ltd., Wuhan, China) was constructed as a vector for extracellular expression of hSOD1. The cells were grown at 37°C for 12 h in LB, Super Rich, or 2× YT medium (100 µg/mL Ampicillin for E.coli; 5 µg/mL Chloramphenicol (Cm) for Bacillus subtilis).

2.2 Cloning of sod1 gene

The human RNA was extracted from HepG2 cells using Trizol (Summer Biotechnology Co., Ltd, Beijing, China). cDNAs were synthesized with a Transcriptor first-strand cDNA synthesis kit (Summer Biotechnology Co., Ltd, Beijing, China). The coding sequence of the hsod1 gene (GenBank accession number, CR541742.1) was amplified using a pair of SOD1 primers: 5′-ATGGCGACGAAGGCCGTGTG-3′ (F); 5′-TTGGGCGATCCCAATTACAC-3′ (R).

PCR reaction was performed in 50 µL reaction solution consisting of 2 µL of cDNA, 1 µL each of the forward or reverse primer, 5 µL of dNTP (2 mM), 5 µL of 10× PCR Buffer for KOD-Plus-Neo, 3 µL of MgSO₄ (25 mM), 1 µL of KOD-Plus-Neo Polymerase (Toyobo, Osaka, Japan), and 32 µL of ddH₂O. The PCR condition was as followed: 94°C for 2 min; 35 cycles of 94°C for 15 s, 55°C for 30 s, and 68°C for 25 s. The PCR product was purified using a Gel Extraction Kit (Omega Bio-tek, Guangzhou, China) according to the manufacturer’s instruction. After the fragment was cloned to the pClone007 Blunt Simple Vector (Tsingke Biotechnology Co., Ltd., Beijing, China) and transformed into E.coli DH5α, the positive colony was sequenced (Tsingke Biotechnology Co., Ltd., Beijing, China).

2.3 Construction of expression plasmid

The hsod1 gene (containing the vector sequence) was amplified with KOD-Plus-Neo (Toyobo, Osaka, Japan) using the following primer: SOD1-pHT43-His-F: ACATCAGCCGTAGGATCCATGGGATCCATGGCGACGAAGGCCGTGT; SOD1-pHT43-His-R: TAGCGGCCGCATGGATCCTTGGGCGATCCCAATTACAC. The pHT43-His plasmid was digested and linearized with BamHI and AP (Alkaline Phosphatase) by MonClone™ Fast AP (Monad Biotech Co., Ltd, Wuhan, China). The purified gene product was inserted into a restricted pHT43-His using the MonClone™ Hi-Fusion Cloning Mix V2 (Monad Biotech Co., Ltd, Wuhan, China). The constructed plasmid was transformed into E.coli DH5α competent cells, and the positive transformants were screened by colony PCR and sequenced.

2.4 Preparation and transformation of competent Bacillus subtilis 1012

Bacillus subtilis 1012 was inoculated on LB plate and incubated at 37°C overnight. Then, the host strain was transferred with a loop into 2 mL of LB medium and cultured under 180 rpm of shaking at 28°C overnight. Next, 50 µL of the bacterial culture was inoculated in 5 mL of SP I medium under 180 rpm of shaking at 37°C. The growth curve was measured every 30 min until the plateau phase. After that, 0.5 mL of the culture was added to 4.5 mL of SP II medium and incubated under 100 rpm of shaking at 37°C for 90 min. And 50 µL of EGTA (100 mM) was added to the culture medium and incubated under 100 rpm of shaking at 37°C for 10 min. Finally, the culture was dispensed with 300 µL for each tube (Brockmeier et al., 2006; Murayama et al., 2004).

For the bacterial transformation, 1 µg of pHT43-His and pHT43-His-hSOD1 were mixed with Bacillus subtilis 1012 competent cells and cultured under 100 rpm of shaking at 30°C for 90 min. Then, the bacterial culture was inoculated on LB plates containing 5 µg/mL Chloramphenicol (Cm) at 37°C.

2.5 Expression, preparation, and separation of hSOD1 fusion protein in Bacillus subtilis 1012

The Bacillus subtilis 1012 containing pHT43-His-hsod1 was cultured in 10 mL of LB medium (5 µg/mL Cm) under 180 rpm of shaking at 37°C overnight. After the bacterial culture was inoculated to Super Rich (25 g/L of Tryptone, 20 g/L of Yeast extraction, 3 g/L of K₂HPO₄, and 30 g/L of Glucose) (1:100, v/v), different concentrations of IPTG (Isopropylb-D-thiogalatopyranoside) (0.2−1 mM) and 20 g/L lactose were added to induce protein expression at 37°C until a 0.6−0.8 of OD₆₀₀ was obtained. Next, different temperatures (16°C, 25°C, 30°C, 37°C, and 40°C) were used to optimize the induction conditions further. After the incubation for 12 h, 18 h, 24 h, 30 h, and 36 h, 1 mL of culture medium was withdrawn and centrifuged at 4°C, 13000 rpm for 10 min. And 20 µL of cellular supernatant was denatured in 5 µL of 5× denaturing buffer (60 mmol/L of Tris-HCl, 25% glycerol, 2% SDS, 0.1% bromophenol blue) at 95°C for 5 min.

For Western blot analysis, 20 µL of the denatured sample was separated on a 15% SDS-PAGE. After the electrophoresis, the gels were visualized by Coomassie brilliant blue R-250 staining and then transferred to polyvinylidene difluoride (PVDF) membranes. A mouse anti His-Tag mAb (1:2000, Cat #AE003) (ABclonal, Wuhan, China) was used to detect the FLAG-tagged recombinant hSOD1. The goat anti-mouse second antibody (1:5000) (Cell Signaling Technology, MA, USA) was used to detect the native form of hSOD1 with His-tag. The 15% Native PAGE was run at 100 V for 3 h at 4°C to avoid protein denaturation.

2.6 Enzyme activity assay of hSOD1 in Bacillus subtilis 1012

The activity of purified hSOD1 was detected in vitro using a Total Superoxide Dismutase Assay Kit with WST-8 (Beyotime Institute of Biotechnology, Shanghai, China), based on measuring the color of a water-soluble formazan dye. In brief, 20 µL of hSOD1, 160 µL of WST-8/enzyme working solution, and 20 µL of reaction starting solution were mixed and incubated at 37°C for 30 min. After the reaction was stopped, the absorbance was detected at 450 nm. One unit of SOD was defined as the enzyme amount in 20 µL of the sample that inhibited the reduction reaction between WST-8 and superoxide anion by 50%.

2.7 Effects of Cu²⁺ and Zn²⁺ on purified hSOD1

To determine the effects of Cu²⁺ and Zn²⁺ on hSOD1 activity, we added different concentrations of Cu²⁺/Zn²⁺ (0/0 µM、200/0 µM、0/5 µM、200/5 µM、800/20 µM) to purified hSOD1 solution. The activity of hSOD1 was measured using a Total Superoxide Dismutase Assay Kit with WST-8 as the above mentioned. The purified hSOD1 with Cu²⁺/Zn²⁺ (0/0 µM) was used as a control.

3.1 Growth of recombinant 1012-hSOD1 strain in different culture media

To explore the effects of media and bacterial inoculum on the growth of recombinant 1012-hSOD1 strain, we cultured the bacteria in three different media containing 1% or 2% inoculum at 37°C. The OD₆₀₀ was measured at other time points. As shown in Fig. 1, either 1% or 2% inoculum led to faster growth of 1012-hSOD1 strain in Super rich media than LB or 2× YT media (Fig. 1a and 1b). There was no difference in the bacterial growth between LB and 2× YT media with 1% and 2% inoculum (Fig. 1c and 1d). We observed a faster growth rate at 2% inoculum for the Super rich medium than 1% inoculum (Fig. 1e). Thus, the Super rich media with 2% inoculum was chosen for the recombinant hSOD1protein expression.

3.2 Secretory expression of hSOD1 in Bacillus subtilis 1012 using different IPTG concentrations and temperatures

The recombinant protein expression level is usually affected by IPTG concentration and induction temperature. IPTG is an efficient inducer for the expression system with lac promoter, which can’t be metabolized by bacteria and is stable. Therefore, the effect of different concentrations of IPTG on hSOD1 expression was investigated at 37°C to obtain a high yield of hSOD1. The 1012-hSOD1 strain samples were separately collected at 6, 12, 24, 36, 48 and 60 h after a series of concentrations of IPTG (0.2, 0.4, 0.6, 0.8 and 1 mM) were added. It was indicated that the highest yield of hSOD1 was obtained after the induction for 24 h (Fig. 2a-2e). Further, the expression yields of hSOD1 were compared after 24 h induction with different concentrations of IPTG, and the optimal concentration of IPTG was determined to be 0.2 mM (Fig. 2f). IPTG is an efficient inducer for the expression system with lac promoter, which can’t be metabolized by bacteria and is stable. Therefore, the effect of different concentrations of IPTG on hSOD1 expression was investigated at 37°C to obtain a high yield of hSOD1. The 1012-hSOD1 strain samples were separately collected at 6, 12, 24, 36, 48 and 60 h after a series of concentrations of IPTG (0.2, 0.4, 0.6, 0.8 and 1 mM) were added. It was indicated that the highest yield of hSOD1 was obtained after the induction for 24 h (Fig. 2a-2e). Further, the expression yields of hSOD1 were compared after 24 h induction with different concentrations of IPTG, and the optimal concentration of IPTG was determined to be 0.2 mM (Fig. 2f).

Since the induction temperature is vital to enhance recombinant protein expression, the engineered strain 1012-hSOD1 was induced by 0.2 mM IPTG for 24 h at 16, 25, 30, 37, and 40°C, respectively. As suggested in Fig. 3, the highest yield of hSOD1 was achieved at 37°C after the induction for 24 h.

3.3 Secretory expression of hSOD1 in Bacillus subtilis 1012 induced by lactose

Although IPTG is widely used to induce recombinant proteins, it is relatively expensive and toxic to humans. Hence, IPTG is not suitable for the large-scale preparation of drugs. To find a safe and low-cost production system for the expression of hSOD1, we chose lactose as an inducer to produce recombinant 1012-hSOD1. To explore the peak level of hSOD1 by lactose (20 g/L), we compared the product contents at 37°C for different induction times. As revealed in Fig. 4a, the yield of hSOD1 reached a maximal level after the induction for 24 h. Noticeably, 20 g/L of lactose almost displayed the same inductive effect on hSOD1 expression as that by 0.2 mM of IPTG (Fig. 4b). It was clear that lactose had a high potential to replace IPTG as an inducer for hSOD1 expression.

3.4 Purification and enzyme activity of recombinant hSOD1

Next, we purified hSOD1 using a Nickel column, which was performed by chromatography (chromatographic) system on the AKTA pure 25 (GE Healthcare Life Sciences, Uppsala, Sweden). After the elution and desalination, the recombinant protein was collected and detected by SDS-PAGE (Fig. 5).

As a metalloenzyme, hSOD1 needs Cu²⁺ and Zn²⁺ to maintain its structure and enzymatic activity. The lack of Cu²⁺ and Zn²⁺ will reduce its activity and increase the degradation. Therefore, we chose different concentrations of Cu²⁺ and Zn²⁺ to detect their effects on the enzymatic activity of purified hSOD1. As shown in Fig. 6, a 51.8-fold increase in the specific activity of hSOD1 was observed after the supplementation of Cu²⁺ (200 µM) alone, whereas 5 µM of Zn²⁺ alone slightly increased the SOD activity. Interestingly, the hSOD1 activity elevated about 160-fold after the supplementation with Cu²⁺ (200 µM) plus Zn²⁺ (5 µM) compared to that of the control. And the highest activity was obtained after the combined use of 800 µM of Cu²⁺ plus 20 µM of Zn²⁺, which induced a 1300-fold increase in enzymatic activity (Fig. 6).

Finally, 36 mg of hSOD1 was purified from 1 L of Super rich medium by nickel affinity chromatography. The specific activity of purified hSOD1 was determined to be 1625 U/mg in the presence of 800 µM of Cu²⁺ and 20 µM of Zn²⁺.

The occurrence and development of many diseases are related to the deficiency or false folding of SOD1, such as amyotrophic lateral sclerosis, inflammatory bowel diseases, and lung cancer (Dziabowska-Grabias et al., 2021; Proctor et al., 2016; Wang et al., 2021). In addition to diminishing oxidative stress and ROS generation, SOD1 can inhibit the activation of endothelial cells and regulate the expression of adhesion molecules (Carroll et al., 2007; Segui et al., 2004). Recently, SOD1 was also reported to facilitate cytoprotective pathways by activating gene transcription and plays a physiological role in regulating signal transductions involving ROS, indicating a high potential in disease treatment (Trist et al., 2021). These biological activities make SOD1 become a potential therapeutic agent against host diseases. In this study, we successfully constructed the Bacillus subtilis expression system which the recombinant human SOD1 was produced with good enzymatic activity.

The Bacillus subtilis has been broadly applied to the expression of agricultural, medical, and industrial products. To gain an endotoxin-free hSOD1, we produced a gram-positive expression system based on the host Bacillus subtilis 1012 and the E.coli-B.subtilis shuttle vector pHT43-His, which had a strong IPTG-inducible Pgrac promoter with lac operator. Therefore, the recombinant hSOD1 could be expressed by IPTG or lactose as inducers. (Tran et al., 2020). In this study, lactose had similar inductive activity to that of IPTG in the expression of hSOD1 (Fig. 4b). Lactose is a safer and cheaper inducer than IPTG, and the heterogeneous hSOD1 can be directly obtained from the supernatant of culture medium. Thus, our detection system not only saves the purification cost but avoids the possible activity loss in the purification. These advantages may lay a foundation for the industrial production of hSOD1 in the future.

The sod1 gene is located on chromosome 21q22.11 and encodes Cu/Zn superoxide dismutase (Abati et al., 2020). Human SOD1 protein forms a homodimer, and each monomer binds Cu²⁺ and Zn²⁺ to harbor a disulfide. Both metal cofactors are necessary for catalyzing one-electron oxidation followed by one-electron reduction of two O₂^•− anions to affect disproportionation (Griess et al., 2017). SOD1 exerts its catalytic function only when it binds a Cu²⁺ and a Zn²⁺ per molecule to form an intramolecular disulfide bridge (Banci et al., 2011). In this study, we purified the hSOD1 and detected the highest activity when the 800 µM of Cu²⁺ and 20 µM of Zn²⁺ were used for catalytic reaction (Fig. 5 and Fig. 6). By comparing the optimal catalytic concentrations between Cu²⁺ and Zn²⁺, we observed that Cu²⁺ played a predominant role in hSOD1 activity, and a minor contribution was made by Zn²⁺ in the hSOD1-mediated catalysis, in consistence with a previous report (Li et al., 2010). On the other hand, the synergistic effect of Cu²⁺ and Zn²⁺ is essential for the exertion of hSOD1 activity (Fig. 6).

Since E.coli is a conditional pathogen, the products from E.coli expression systems must be extracted and purified before applying to human health. Different from E.coli, Bacillus subtilis is a safe probiotic in mammals. Both the bacterium itself and its expression products can be directly used for disease treatment. When we apply genetically engineered Bacillus subtilis with protein expression ability to the host, it will play the role of drug therapy and have the function of prebiotic. For instance, it was suggested that SOD1 produced from genetically engineered lactic acid bacteria could be applied to treat ROS-induced gastrointestinal pathologies (J. Zhang et al., 2013). In another study, a catalase- or SOD-producing lactic acid bacteria increased the degradation of H₂O₂ and reduced the severity of colitis (LeBlanc et al., 2011). In our experiment, the highest yield of hSOD1 was achieved when the induction temperature was set at 37°C, which is close to body temperature. Besides, the hSOD1 expression in Bacillus subtilis can be easily induced by lactose. These advantages provided a possibility for the application of oral engineering bacteria 1012-hSOD1 and lactose to the clinical treatment of gastrointestinal diseases.

In summary, we established a Bacillus subtilis system with hSOD1 activity for the first time. In this study, 36 mg of hSOD1 was purified from 1 L of Super rich medium, and the activity of purified hSOD1 was determined to be 1625 U/mg with 800 µM of Cu²⁺ and 20 µM of Zn²⁺. In addition, we found that lactose can replace IPTG as an inducer to produce hSOD1 in our expression system. Our studies shed light on the industrial production and clinical application of hSD1 in the future.

Funding

This work was supported by Educational Program of Hubei Province (NO. Q20212012), Department of Science and Technology of Hubei Province (No.2021CFB253), Key Research and Development Plan of Ningxia Autonomous Region (NO. 2021ZDYF0552), and Project of Excellent Young and Middle-aged Scientific and Technological Innovation Team in Colleges and Universities of Hubei Province (NO. T2020013).

Competing Interests

All the authors declare that they have no conflict of interest in the manuscript.

Author Contributions

Hongtao Liu and Zhigang Zhang designed the study. Mingzhu Yin, Nian Wang, Qiqi Wang, Hui Xia, Xue Cheng, and Haiming Hu were responsible for the acquisition of data. Mingzhu Yin and Nian Wang interpreted the experimental data. Mingzhu Yin and Hongtao Liu were the major contributors in drafting and revising the manuscript. All authors have read and approved the final manuscript.

Abati E, Bresolin N, Comi G, Corti S (2020) Silence superoxide dismutase 1 (SOD1): a promising therapeutic target for amyotrophic lateral sclerosis (ALS). Expert Opin Ther Targets 24(4):295–310c. doi: 10.1080/14728222.2020.1738390
Bae JY, Koo BK, Ryu HB, Song JA, Nguyen MT, Vu TT, Son YJ, Lee HK, Choe H (2013) Cu/Zn incorporation during purification of soluble human EC-SOD from E. coli stabilizes proper disulfide bond formation. Appl Biochem Biotechnol 169(5):1633–1647c. doi: 10.1007/s12010-012-0025-x
Banci L, Barbieri L, Bertini I, Cantini F, Luchinat E (2011) In-cell NMR in E. coli to monitor maturation steps of hSOD1. PLoS One, 6 (8), e23561c. doi: 10.1371/journal.pone.0023561
Brockmeier U, Caspers M, Freudl R, Jockwer A, Noll T, Eggert T (2006) Systematic screening of all signal peptides from Bacillus subtilis: a powerful strategy in optimizing heterologous protein secretion in Gram-positive bacteria. J Mol Biol 362(3):393–402c. doi: 10.1016/j.jmb.2006.07.034
Carroll IM, Andrus JM, Bruno-Barcena JM, Klaenhammer TR, Hassan HM, Threadgill DS (2007) Anti-inflammatory properties of Lactobacillus gasseri expressing manganese superoxide dismutase using the interleukin 10-deficient mouse model of colitis. Am J Physiol Gastrointest Liver Physiol 293(4):G729–738c. doi: 10.1152/ajpgi.00132.2007
Chen HL, Yen CC, Tsai TC, Yu CH, Liou YJ, Lai YW, Wang ML, Chen CM (2006) Production and characterization of human extracellular superoxide dismutase in the methylotrophic yeast Pichia pastoris. J Agric Food Chem, 54 (21), 8041-8047c. doi: 10.1021/jf061379x
Dziabowska-Grabias K, Sztanke M, Zajac P, Celejewski M, Kurek K, Szkutnicki S, Korga P, Bulikowski W, Sztanke K (2021) Antioxidant Therapy in Inflammatory Bowel Diseases. Antioxid (Basel) 10(3). doi: 10.3390/antiox10030412
Eleutherio ECA, Silva Magalhaes RS, de Araujo Brasil A, Monteiro Neto JR, de Holanda Paranhos L (2021) SOD1, more than just an antioxidant. Arch Biochem Biophys, 697, 108701c. doi: 10.1016/j.abb.2020.108701
Griess B, Tom E, Domann F, Teoh-Fitzgerald M (2017) Extracellular superoxide dismutase and its role in cancer. Free Radic Biol Med, 112, 464-479c. doi: 10.1016/j.freeradbiomed.2017.08.013
Gu Y, Xu X, Wu Y, Niu T, Liu Y, Li J, Du G, Liu L (2018) Advances and prospects of Bacillus subtilis cellular factories: From rational design to industrial applications. Metab Eng 50:109–121c. doi: 10.1016/j.ymben.2018.05.006
Hartman JR, Geller T, Yavin Z, Bartfeld D, Kanner D, Aviv H, Gorecki M (1986) High-level expression of enzymatically active human Cu/Zn superoxide dismutase in Escherichia coli. Proc Natl Acad Sci U S A 83(19):7142–7146c. doi: 10.1073/pnas.83.19.7142
Hayward LJ, Rodriguez JA, Kim JW, Tiwari A, Goto JJ, Cabelli DE, Valentine JS, Brown RH Jr (2002) Decreased metallation and activity in subsets of mutant superoxide dismutases associated with familial amyotrophic lateral sclerosis. J Biol Chem 277(18):15923–15931c. doi: 10.1074/jbc.M112087200
He HJ, Yuan QS, Yang GZ, Wu XF (2002) High-level expression of human extracellular superoxide dismutase in Escherichia coli and insect cells. Protein Expr Purif 24(1):13–17c. doi: 10.1006/prep.2001.1529
Hosoki A, Yonekura S, Zhao QL, Wei ZL, Takasaki I, Tabuchi Y, Wang LL, Hasuike S, Nomura T, Tachibana A, Hashiguchi K, Yonei S, Kondo T, Zhang-Akiyama QM (2012) Mitochondria-targeted superoxide dismutase (SOD2) regulates radiation resistance and radiation stress response in HeLa cells. J Radiat Res, 53 (1), 58-71c. doi: 10.1269/jrr.11034
Huang K, Zhang T, Jiang B, Yan X, Mu W, Miao M (2017) Overproduction of Rummeliibacillus pycnus arginase with multi-copy insertion of the arg (R.pyc) cassette into the Bacillus subtilis chromosome. Appl Microbiol Biotechnol 101(15):6039–6048c. doi: 10.1007/s00253-017-8355-9
Kim Y, Jeon YJ, Ryu K, Kim TY (2017) Zinc(II) ion promotes anti-inflammatory effects of rhSOD3 by increasing cellular association. BMB Rep 50(2):85–90c. doi: 10.5483/bmbrep.2017.50.2.150
LeBlanc JG, del Carmen S, Miyoshi A, Azevedo V, Sesma F, Langella P, Bermudez-Humaran LG, Watterlot L, Perdigon G, de Moreno A (2011) Use of superoxide dismutase and catalase producing lactic acid bacteria in TNBS induced Crohn's disease in mice. J Biotechnol, 151 (3), 287-293c. doi: 10.1016/j.jbiotec.2010.11.008
Li HT, Jiao M, Chen J, Liang Y (2010) Roles of zinc and copper in modulating the oxidative refolding of bovine copper, zinc superoxide dismutase. Acta Biochim Biophys Sin (Shanghai) 42(3):183–194c. doi: 10.1093/abbs/gmq005
Lin F, Yan D, Chen Y, Shi EFE, Han H, Zhou B, Y (2018) Cloning, purification and enzymatic characterization of recombinant human superoxide dismutase 1 (hSOD1) expressed in Escherichia coli. Acta Biochim Pol 65(2):235–240c. doi: 10.18388/abp.2017_2350
Lu R, Zhang T, Wu D, He Z, Jiang L, Zhou M, Cheng Y (2018) Production of functional human CuZn-SOD and EC-SOD in bitransgenic cloned goat milk. Transgenic Res 27(4):343–354c. doi: 10.1007/s11248-018-0080-3
Murayama R, Akanuma G, Makino Y, Nanamiya H, Kawamura F (2004) Spontaneous transformation and its use for genetic mapping in Bacillus subtilis. Biosci Biotechnol Biochem 68(8):1672–1680c. doi: 10.1271/bbb.68.1672
Nguyen NH, Tran GB, Nguyen CT (2020) Anti-oxidative effects of superoxide dismutase 3 on inflammatory diseases. J Mol Med (Berl) 98(1):59–69c. doi: 10.1007/s00109-019-01845-2
Niu C, Liu C, Li Y, Zheng F, Wang J, Li Q (2018) Production of a thermostable 1,3 – 1,4-beta-glucanase mutant in Bacillus subtilis WB600 at a high fermentation capacity and its potential application in the brewing industry. Int J Biol Macromol 107(Pt A):28–34c. doi: 10.1016/j.ijbiomac.2017.08.139
Pan J, Chen L, He H, Su Y, Liu S (2017) Expression, purification, stability and transduction efficiency of full-length SOD2 recombinant proteins. Chin J Biotechnol 33(7):1168–1177c. doi: 10.13345/j.cjb.170007
Park DH, Yoon S-YH, Nam HG, Park JM (2002) Expression of functional human-cytosolic Cu/Zn superoxide dismutase in transgenic tobacco. Biotechnol Lett 24(9):681–686c. doi: 10.1023/a:1015273714571
Proctor EA, Fee L, Tao Y, Redler RL, Fay JM, Zhang Y, Lv Z, Mercer IP, Deshmukh M, Lyubchenko YL, Dokholyan NV (2016) Nonnative SOD1 trimer is toxic to motor neurons in a model of amyotrophic lateral sclerosis. Proc Natl Acad Sci U S A, 113 (3), 614-619c. doi: 10.1073/pnas.1516725113
Segui J, Gironella M, Sans M, Granell S, Gil F, Gimeno M, Coronel P, Pique JM, Panes J (2004) Superoxide dismutase ameliorates TNBS-induced colitis by reducing oxidative stress, adhesion molecule expression, and leukocyte recruitment into the inflamed intestine. J Leukoc Biol, 76 (3), 537-544c. doi: 10.1189/jlb.0304196
Tibell L, Hjalmarsson K, Edlund T, Skogman G, Engstrom A, Marklund SL (1987) Expression of human extracellular superoxide dismutase in Chinese hamster ovary cells and characterization of the product. Proc Natl Acad Sci U S A 84(19):6634–6638c. doi: 10.1073/pnas.84.19.6634
Tran DTM, Phan TTP, Doan TTN, Tran TL, Schumann W, Nguyen HD (2020) Integrative expression vectors with Pgrac promoters for inducer-free overproduction of recombinant proteins in Bacillus subtilis. Biotechnol Rep (Amst), 28, e00540c. doi: 10.1016/j.btre.2020.e00540
Trist BG, Hilton JB, Hare DJ, Crouch PJ, Double KL (2021) Superoxide Dismutase 1 in Health and Disease: How a Frontline Antioxidant Becomes Neurotoxic. Angew Chem Int Ed Engl 60(17):9215–9246c. doi: 10.1002/anie.202000451
Wang X, Zhang H, Sapio R, Yang J, Wong J, Zhang X, Guo JY, Pine S, Van Remmen H, Li H, White E, Liu C, Kiledjian M, Pestov DG, Steven Zheng XF (2021) SOD1 regulates ribosome biogenesis in KRAS mutant non-small cell lung cancer. Nat Commun, 12 (1), 2259c. doi: 10.1038/s41467-021-22480-x
Wu CY, Steffen J, Eide DJ (2009) Cytosolic superoxide dismutase (SOD1) is critical for tolerating the oxidative stress of zinc deficiency in yeast. PLoS One, 4 (9), e7061c. doi: 10.1371/journal.pone.0007061
Yang JL, Li XL, Jiang FL, Gong T, Chen JJ, Chen TJ, Zhu P (2020) High-level soluble expression of human Cu,Zn superoxide dismutase with high activity in Escherichia coli. World J Microbiol Biotechnol, 36 (7), 106c. doi: 10.1007/s11274-020-02883-6
Zhang J, Liu H, Wang Q, Hou C, Thacker P, Qiao S (2013) Expression of catalase in Lactobacillus fermentum and evaluation of its anti-oxidative properties in a dextran sodium sulfate induced mouse colitis model. World J Microbiol Biotechnol 29(12):2293–2301c. doi: 10.1007/s11274-013-1395-0
Zhang K, Zhang Y, Zi J, Xue X, Wan Y (2017) Production of Human Cu,Zn SOD with Higher Activity and Lower Toxicity in E. coli via Mutation of Free Cysteine Residues. Biomed Res Int, 4817376c. doi: 10.1155/2017/4817376

Download PDF

Reviewers agreed at journal
02 Jun, 2022
Reviews received at journal
13 Apr, 2022
Reviewers invited by journal
10 Apr, 2022
Editor assigned by journal
07 Mar, 2022
First submitted to journal
06 Mar, 2022

You are reading this latest preprint version

Cloning and expression of recombinant human superoxide dismutase 1 (hSOD1) in Bacillus subtilis 1012

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials And Methods

2.1 Bacterial strains and plasmids

2.2 Cloning of sod1 gene

2.3 Construction of expression plasmid

2.4 Preparation and transformation of competent Bacillus subtilis 1012

2.5 Expression, preparation, and separation of hSOD1 fusion protein in Bacillus subtilis 1012

2.6 Enzyme activity assay of hSOD1 in Bacillus subtilis 1012

2.7 Effects of Cu²⁺ and Zn²⁺ on purified hSOD1

3. Results

3.1 Growth of recombinant 1012-hSOD1 strain in different culture media

3.2 Secretory expression of hSOD1 in Bacillus subtilis 1012 using different IPTG concentrations and temperatures

3.3 Secretory expression of hSOD1 in Bacillus subtilis 1012 induced by lactose

3.4 Purification and enzyme activity of recombinant hSOD1

4. Discussion

Declarations

References

Status:

Version 1

Cloning and expression of recombinant human superoxide dismutase 1 (hSOD1) in Bacillus subtilis 1012

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials And Methods

2.1 Bacterial strains and plasmids

2.2 Cloning of sod1 gene

2.3 Construction of expression plasmid

2.4 Preparation and transformation of competent Bacillus subtilis 1012

2.5 Expression, preparation, and separation of hSOD1 fusion protein in Bacillus subtilis 1012

2.6 Enzyme activity assay of hSOD1 in Bacillus subtilis 1012

2.7 Effects of Cu2+ and Zn2+ on purified hSOD1

3. Results

3.1 Growth of recombinant 1012-hSOD1 strain in different culture media

3.2 Secretory expression of hSOD1 in Bacillus subtilis 1012 using different IPTG concentrations and temperatures

3.3 Secretory expression of hSOD1 in Bacillus subtilis 1012 induced by lactose

3.4 Purification and enzyme activity of recombinant hSOD1

4. Discussion

Declarations

References

Status:

Version 1

2.7 Effects of Cu²⁺ and Zn²⁺ on purified hSOD1