Effect of Competitive Binding of Long Non-coding RNA CCDC26 with miR-340 on the Chemosensitivity of HCC Cells to Cisplatin

doi:10.21203/rs.3.rs-1433014/v1

Download PDF

Research Article

Effect of Competitive Binding of Long Non-coding RNA CCDC26 with miR-340 on the Chemosensitivity of HCC Cells to Cisplatin

https://doi.org/10.21203/rs.3.rs-1433014/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background We investigate the effect of long non-coding RNA (lncRNA) CCDC26 on the chemosensitivity of HCC cells to cisplatin and the underlying mechanisms. Methods Firstly, the expression of CCDC26 in HCC tissues was detected. After siRNA interference of CCDC26, the HCC cells QGY8105 and HCC9204 were selected as the objects of study to detect the changes in their chemosensitivity to cisplatin through the terminal-deoxynucleotidyl transferase mediated nick end labeling (TUNEL) and IC50 assays. Additionally, the RT-PCR assay, RNA hybrid software analysis, and luciferase reporter assay were performed to screen and verify the miRNAs that showed endogenous competitive relationship with CCDC26. Finally, miRNA was co-transfected with CCDC26, so as to explore whether the competitive binding of CCDC26 with miRNA changed the sensitivities of QGY8105 and HCC9204 cells to cisplatin. t-test or analysis of variance was adopted to compare data between groups based on the data property.. Results CCDC26 expression in HCC tissues was higher than that in normal tissues. Under the action of cisplatin, the IC50 value in si-CCDC26 group was lower than that in si-NC group, while the percentage of TUNEL-positive cells was higher than that in si-NC group, and the differences were statistically significant. RT-PCR results indicated that, miR-340 expression in si-CCDC26 group was up-regulated relative to that in si-NC group; meanwhile, RNA hybrid analysis and luciferase verification results demonstrated that there was base complementation between CCDC26 and the “seed” region of miR-340. Thereafter, miR-340 was co-transfected with CCDC26 into HCC9204 cells, and it was discovered that, the IC50 value in miR-340 + CCDC26-wild type group increased compared with those in miR-340 + NC and miR-340 + CCDC26-mutant groups. Meanwhile, the percentage of TUNEL-positive cells was reduced, and the differences were of statistical significance. Conclusions LncRNA CCDC26 can reduce the chemosensitivity of HCC cells to cisplatin through the endogenous competitive binding with miR-340.

Long non-coding RNA

HCC

Chemotherapy

miRNAs

Hepatocellular Carcinoma (HCC) is the fifth most common type of cancer in humans and is associated with hepatitis B or C virus infection. Even with surgery, chemotherapy and various biological therapies, the prognosis for HCC patients is still unsatisfactory, and surgical resection combined with cisplatin-based chemotherapy remains the ideal therapeutic scheme¹. However, at the late stage of chemotherapy, the cisplatin sensitivity in HCC patients is gradually reduced, which has remarkably shortened the overall survival (OS) ^{2, 3}. Therefore, it is significant to intensively investigate the chemoresistance in HCC.

LncRNA is a kind of RNA that is more than 200 bases in length with a lack of protein coding function. Studies have shown that lncRNA plays an important role in the occurrence and development of various tumors, and its abnormal expression in tumors often leads to imbalance in the expression between proto-oncogenes and anti-oncogenes^4–6. Meanwhile, LncRNA has certain clinical value in predicting tumor prognosis, which can be used as a molecular target for the diagnosis and prognosis of various tumors ⁷. However, it is still unclear whether and how lncRNAs can affect the efficacy of chemotherapy for HCC.

LncRNA CCDC26 is located on chromosome 8q24⁸. Few studies on LncRNA CCDC26 in tumors have been reported by referring to literature at home and abroad. Wang S et al⁹. showed that LncRNA CCDC26 might be used as a tumor marker for pancreatic cancers¹⁰. These results suggest that LncRNA CCDC26 may play an important role in the development of tumors^8–10. However, few studies at home and abroad have reported the effect of lncRNA CCDC26 on the chemotherapy sensitivity of HCC patients.

In this study, QGY8105 and HCC9204 cells were selected as the objects of study to observe the regulatory effect of CCDC26 on their resistance and to explore the underlying mechanism of action, so as to provide new experimental foundation for the chemoresistance of HCC .

Materials and reagents

Cisplatin was purchased from Merck Pharmacy. HCC cell lines (Cali-1,HCC9204,HAK-3,PLC/PRF/5 and QGY8105) and Immortalized Human Hepatocytes (IHHA-1) were obtained from Shanghai Cell Bank of Chinese Academy of Sciences (Shanghai, China). Ten HCC tissues and matched normal tissues were provided from surgeries carried out at the General Surgery Department of the Xiangya Hospital and verified by the hospital Ethics Committee. DMEM culture solution and fetal bovine serum (FBS) were bought from Gibco (USA); si-CCDC26 and luciferase plasmid were synthesized by Shanghai Heyuan biological company; RT-PCR kit was purchased from TaKaRa reagent company; miR-340, miR-518a, miR-137, miR-195, miR-332, miR-218 and miR-196a primers were bought from Shanghai Heyuan biological company; and the CCK-8 and TUNEL kits were derived from Nanjing Keugen Biotech Co., Ltd.

Methods

Cell culture and si-CCDC26 interference

HCC cell lines and Normal liver cell line were subjected to conventional passage culture in DMEM containing 10% FBS and incubated in the incubator at 5% CO₂ and 37° C conditions. Then, cells at logarithmic phase were utilized for subsequent experiments. The synthesized si-CCDC26 (5’-GAACGGGAGUACAGAGAGA-3’) was transfected with lipofectamine 3000, and the medium was replaced at 48 h later for qRT-PCR detection.

IC50

Cells were treated with cisplatin and covered onto the 96-well plate at the concentration of 70%-80%. After cell achieved complete adherence, 10 µl CCK8 reagent was added into each well, then cells were incubated in the incubator for 3 h, and the absorbance values in the wells were measured at A450 using the microplate reader at 24, 48, 72h, respectively. At the same time, the cell proliferation curve was plotted. Each group was repeated for at least 3 times. In addition, the logarithmic curve was plotted based on the cell survival rates under various cisplatin drug concentrations, and the 50% inhibiting concentration (IC50) at 50% cell survival rate was calculated using the SPSS software.

TUNEL

Cells were treated with cisplatin, fixed with 4% paraformaldehyde, and washed with PBS for thrice, followed by transparentizing with 1% triton, reaction in the TdT enzyme reaction solution, treatment with Streptavidin-TRITC reagent, and DAPI staining. Afterwards, cells were observed under the fluorescence microscope, and the number of positive cells was counted in the 8 randomly selected fields of view (FOV).

Luciferase reporter assay

QGY8105 and HCC9204 cell lines were transfected according to the lipofectamine 3000 cationic liposome method, and later transfected with pisCHECK-CCDC26-3’UTR wild type (wt), CCDC26-3’UTR mutant (mut), and NC, respectively. Typically, the CCDC26-3’UTR wild type sequence (743–752) used in this study was 5’-UUGGUGUUC-3’; while the lncRNA-3’UTR mutant sequence (743–752) was 5’-GGGUCCCGG-3’. Then, cells were co-transfected with miR-340 mimics, antagomirs or miR-NC according to the luciferase activity detection instructions of the Dual-Luciferase Reporter Assay System E1910 (Promega) after appropriate adjustment; and the luciferase activity was detected after cell lysis. Subsequently, the firefly luciferase fluorescence value was normalized (renilla luciferase fluorescence value). Each experiment was repeated for thrice, and the average was calculated for subsequent statistical analysis.

Real-time quantitative PCR

Total RNA of tissue and cell specimens were extracted using Trizol reagent, and then reverse transcribed to cDNA using the PrimeScript RT Reagent Kit .The lncRNA CCDC26 and miR-340 levels were detected through qRT-PCR, with U6 as the internal reference. The primers used were shown below, for CCDC26: 5’-AGCCAGAGGAGGGAAGAGAG-3’ (forward), 5’-TCCCGTTCCCTAGATTTTCC-3’ (reverse). The miR-340 (UAGCUUAUCAGACUGAUGUUG) primer was synthesized by Shanghai Heyuan company. For U6: 5’-CTCGCTTCGGCAGCACA-3’ (forward), 5’-AACGCTTCACGAATTTGCGT-3’ (reverse). RT-PCR reagent was purchased from the TAKARA kit.

Statistical analysis

All data were analyzed using the SPSS 20.0 software. Measurement data were expressed as mean ± standard deviation (), and t-test or analysis of variance was adopted to compare data between groups based on the data property. A difference of P < 0.05 was deemed as statistically significant.

Expression levels of LncRNA CCDC26 in HCC tissues and cell lines

RT-PCR results suggested that, in the 10 intraoperatively resected HCC tissues and matched normal tissues, CCDC26 expression in HCC tissues was 4.7-fold higher than that in normal tissues (P = 0.042), and the difference was statistically significant (Fig. 1A). Consistent with HCC tissues, the expression of CCDC26 in 6 HCC cell lines were noticeably higher than that of normal human liver cell line (IHHA-1). QGY8105 and HCC9204 cell lines showed the highest CCDC26 levels, and thus were selected for next study (Fig. 1B).

(A) Relative CCDC26 expression in HCC cancer tissues and matched normal tissues were detected by qRT-PCR. (B) Relative CCDC26 expression in IHHA-1 cell line and HCC cell lines (PEO1, SKOV3, CAOV3, ES-2 and OVCAR3). *P < 0.05, **P < 0.01, ***P < 0.001.

Interfering effect of si-CCDC26 on QGY8105 and HCC9204 cells

QGY8105 and HCC9204 cell lines were transfected with si-NC or si-CCDC26, respectively. RT-PCR results indicated that, compared with si-NC group, the CCDC26 expression in si-CCDC26 group was down-regulated (P = 0.012 and 0.007), and the difference was statistically significant (Fig. 2).

Effect of CCDC26 on the chemosensitivity of HCC cells to cisplatin

QGY8105 and HCC9204 cell lines were transfected with si-NC or si-CCDC26, and treated with 20 µM cisplatin for 48 h, respectively. As suggested by the TUNEL results, (21.4 ± 4.3)% and (18.3 ± 2.7)% QGY8105 and HCC9204 cells suffered from DNA damage in si-CCDC26 group, respectively, which were higher than those (10.5 ± 1.6)% and (9.2 ± 1.5)% in si-NC group (P = 0.037 and 0.018), and the differences were statistically significant (Fig. 3A-C). Flow cytometry analysis showed the apoptosis rates of si-CCDC26 group cells were higher than that of si-NC after 20 µM cisplatin treatment for 48 h (Fig. 3D).

The IC50 values of cisplatin in si-CCDC26 group of Huh 7 and HCC9204 cells were (14.8 ± 2.6) and (12.9 ± 1.4) µM, separately, which were lower than those of (26.7 ± 2.4) and (23.1 ± 3.8) µM in si-NC group of Huh 7 and HCC9204 cells, and the differences were statistically significant(Fig. 3E). QGY8105 and HCC9204 cells survival following 20 µM cisplatin treatment were significantly suppressed in si-CCDC26 group cells than in si-NC group cells (Fig. 3F and G). Colony formation assay indicated that CCDC26 knockdown reduced the number of colonies in Huh 7 and HCC9204 cells after 20 µM cisplatin treatment for 48 h (Fig. 3H).

The subcutaneous tumor formation study showed that silencing CCDC26 expression enhanced the sensitivity of QGY8105 cells to cisplatin: at the termination of observation on xenograft tumor in nude mice (30d), the subcutaneous xenograft tumor volumes in transfection group, experiment group 1 and experiment group 2 were (1.738 ± 0.121), (1.573 ± 0.224) and (0.625 + 0.189) mm³, which were all significantly lower than that of (2.083 + 0.110) mm³ in control group (P < 0.05). In experiment group 2, the tumor volume in nude mice after 15 days was smaller than that in experiment group 2 at the same period (P < 0.01), revealing that silencing CCDC26 gene expression enhanced the sensitivity of tumor-bearing nude mice to cisplatin. Similar results were found in HCC9204 cells(Fig. 3I).

Interaction of CCDC26 with miR-340

MiRNAs (miR-199-5a¹¹, miR-130a¹², miR-193b¹³, miR-182¹⁴, miR-363¹⁵, miR-101¹⁶ and miR-340¹⁷) related to cisplatin for HCC were retrieved in literature. Then, HCC9204 cells were transfected with si-NC or si-CCDC26. RT-PCR results suggested that, compared with si-NC group, miR-340 expression in si-CCDC26 group was the highest (p = 0.008) (Fig. 4A). RNA hybrid analysis demonstrated that, there was base complementation between the 743–752 region in CCDC26 sequence and the “seed” region of miR-340 (Fig. 4B). Luciferase reporter assay revealed that, after 743–752 mutation of the CCDC26 sequence, miR-340 or inhibitor-miR-340 showed no influence on the luciferase activity. After co-transfection of the 743–752 wild type of CCDC26 sequence with miR-340 or inhibitor-miR-340, the luciferase activities were reduced and increased, respectively (P < 0.05), and the differences were statistically significant (Fig. 4C).

Effect of CCDC26 competitively binding with miR-340 on the chemosensitivity of QGY8105 and HCC9204 cells to cisplatin

First of all, QGY8105 and HCC9204 cells were transfected with miR-340 + NC, miR-340 + CCDC26-wt (wild type) and miR-340 + CCDC26-mut (mutant), and treated with cisplatin (40 µM) for 48 h, respectively. In QGY8105 cells, the TUNEL results suggested that the cells with DNA damage in miR-340 + CCDC26-wt (wild type) group accounted for (4.9 ± 0.4)%, which was lower than that of (17.2 ± 2.6)% in miR-340 + CCDC26-mut (mutant) group. The IC50 value in miR-340 + CCDC26-wt (wild type) group was (33.3 ± 1.3) µM, which was higher than that of (18.0 ± 0.8) µM in miR-340 + CCDC26-mut (mutant) group, and the difference was statistically significant. In HCC9204 cells, the TUNEL results suggested that the cells with DNA damage in miR-340 + CCDC26-wt (wild type) group accounted for (7.3 ± 0.3)%, which was lower than that of (21.6 ± 0.5)% in miR-340 + CCDC26-mut (mutant) group. The IC50 value in miR-340 + CCDC26-wt (wild type) group was (37.0 ± 0.7) µM, which was higher than that of (18.2 ± 1.2) µM in miR-340 + CCDC26-mut (mutant) group, and the difference was statistically significant (Fig. 5A-D).

Previous study suggests that, LncRNAs exert important roles in the chemoresistance of tumor^{18, 19}. For instance, LncRNA ENST00000563280 can interact with ABCB1, HIF1A and FOXC2 proteins to enhance the tolerance of osteosarcoma cells to the chemotherapeutic doxorubicin²⁰. LncRNA PVT1 can regulate the apoptosis-related signaling pathway to reduce the sensitivity of ovarian cancer cells to cisplatin²¹. Similarly, lncRNA CCDC26 plays a vital role in the progression of Glioma²², pancreatic cancer²³ and gastrointestinal stromal tumor²⁴. For example, in glioma, CCDC26 promotes glioma cell proliferation and migration by epigenetically silencing miR-203⁹. Some scholars point out through investigating the large sample clinical data that, CCDC26 may be the potential therapeutic target of the imatinib resistant gastrointestinal stromal tumor²⁴. In this study, CCDC26 expression in all the collected HCC samples was higher than that in the matched normal tissues. Based on the research results at cell level, the expression of LncRNA CCDC26 in HCC-resistant cells might be higher than that in sensitive cell line, revealing that CCDC26 might play a suppressing role in the chemotherapy for HCC.

From the perspective of functional test, LncRNAs can exert the regulatory role at three levels, namely, transcriptional level, post-transcriptional level and chromatin remodeling, which also displays certain timeliness and spatiality⁶. LncRNAs can recruit specific chromatin or the ceRNA to induce the regulation on epigenetics⁴. For instance, LncRNAs Xist/RepA recruit PRC2 and interact with EZH2 to enhance its density on X chromosome and suppress the activity of X chromosome²⁵. In liver cancer cells, lncRNA-UCA1 can bind with miR-216b to further activate the FGFR1/ERK signaling pathway, thus resulting in the malignant proliferation of tumor cells²⁶. Typically, the important mechanism of CCDC26 in regulating transcription is molecular decoys. LncRNAs CCDC26, as the ceRNA, can bind with the core sequence of miRNA small molecules, which can compete with the coding gene to bind with miRNAS, thus reducing the suppression of the latter on the downstream target. For instance, in gloma cells, CCDC26 can absorb miR-203, and regulate glioma growth and metastasis ²².

In this study, luciferase assay verified that miR-340 bound with partial sequence of CCDC26 and reduced the relative activity of luciferase. At the same time, it was also discovered that, after mutation of corresponding binding sequence, the luciferase activity was not obviously changed. Based on the previous gene sequence analysis results, there was complementation between partial sequence of lncRNA and the miR-340 sequence. In HCC9204 cells, CCDC26 bound with miR-340 through the ceRNA mechanism, thus exerting corresponding function. Moreover, it was discovered after co-transfection of lncRNA CCDC26 with miR-340 in HCC9204 cells that, the mutant CCDC26 did not affect the apoptotic rate of HCC9204 cells under the stimulation of cisplatin, while the wild type CCDC26 bound with the “seed” region of miR-340, thus reducing the percentage of TUNEL-positive cells. These results revealed that CCDC26 regulated the miR-340 activity through the ceRNA mechanism, thus further reducing the sensitivity of HCC9204 cells to cisplatin.

In addition to the molecular induction mechanism, lncRNA CCDC26 can also act on a certain signal transduction pathway, directly act on the tumor apoptosis-related proteins, change the DNA damage repair or cell cycle, and alter the epithelial-mesenchymal transition (EMT) process to exert its role. For instance, CCDC26 controls growth of myeloid leukemia cells through regulating KIT expression²⁷. In this study, it was discovered after CCDC26 knockdown that, apart from miR-340, miR-137, miR-332 and miR-218 also showed similar changes, revealing that CCDC26 might have multiple regulatory genes, which should be further explored in the future. To sum up, LncRNA CCDC26 plays an important regulatory role in the chemoresistance of HCC cells to cisplatin, which is worthy of being intensively studied in the future.

LncRNA CCDC26 plays an important regulatory role in the chemoresistance of HCC cells to cisplatin, which is worthy of being intensively studied in the future.

Acknowledgements

None.

Authors’ contributions

Qi-Fa YE. conceived and designed research. . Cai LI performed experiments, interpreted results of experiments.,. analyzed data and prepared fgures and approved fnal version of manuscript.

Funding

No.

Availability of data and materials

All data generated or analyzed during this study are included in this published article.

Ethics approval and consent to participate

All experimental protocols in this study were approved by the Ethics Committee of Central South University (No.CSU20200121).

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests

Qian X, Yan X, Zhai X, Li N, Qu C, Lu F. Hepatocellular Carcinoma Surveillance and Treatment: A Way to Reduce Cancer-related Mortality in Cirrhotic Patients. J Clin Transl Hepatol. 2019. 7(1): 1-2.
Shen J, Hui L, Li G, Jin R, Cai X. TR4 nuclear receptor enhances the cisplatin chemo-sensitivity via altering the ATF3 expression to better suppress HCC cell growth. Oncotarget. 2014;7(22):32088-32099.
Bao Y, Zhang Y, Lu Y, et al. Overexpression of microRNA-9 enhances cisplatin sensitivity in hepatocellular carcinoma by regulating EIF5A2-mediated epithelial-mesenchymal transition. Int J Biol Sci. 2020;16(5):827-837.
Nie L, Wu HJ, Hsu JM, et al. Long non-coding RNAs: versatile master regulators of gene expression and crucial players in cancer. Am J Transl Res. 2012;4(2):127.
Chen LL, Carmichael GG. Decoding the function of nuclear long non-coding RNAs. Curr Opin Cell Biol. 2010;22(3):357-364.
Nan L. Review of long non-coding RNAs in development and function of the immune system. 2014.
Jiang MC, Ni JJ, Cui WY, Wang BY, Zhuo W. Emerging roles of lncRNA in cancer and therapeutic opportunities. Am J Cancer Res. 2019;9(7):1354-1366.
Chen C, Wang P, Mo W, et al. lncRNA-CCDC26, as a novel biomarker, predicts prognosis in acute myeloid leukemia. Oncol Lett. 2019;18(3):2203-2211.
Wang S, Hui Y, Li X, Jia Q. Silencing of lncRNA CCDC26 Restrains the Growth and Migration of Glioma Cells In Vitro and In Vivo via Targeting miR-203. Oncol Res. 2018;26(8):1143-1154.
Peng W, Jiang A. Long noncoding RNA CCDC26 as a potential predictor biomarker contributes to tumorigenesis in pancreatic cancer. Biomed Pharmacother. 2016;83:712-717.
Xu N, Zhang J, Shen C, et al. Cisplatin-induced downregulation of miR-199a-5p increases drug resistance by activating autophagy in HCC cell. Biochem Biophys Res Commun. 2012;423(4):826-31.
Xu N, Shen C, Luo Y, et al. Upregulated miR-130a increases drug resistance by regulating RUNX3 and Wnt signaling in cisplatin-treated HCC cell. Biochem Biophys Res Commun. 2012;425(2):468-72.
Yin W, Nie Y, Zhang Z, Xie L, He X. miR-193b acts as a cisplatin sensitizer via the caspase-3-dependent pathway in HCC chemotherapy. Oncol Rep. 2015;34(1):368-74.
Qin J, Luo M, Qian H, Chen W. Upregulated miR-182 increases drug resistance in cisplatin-treated HCC cell by regulating TP53INP1. Gene. 2014;538(2):342-7.
Ou Y, Zhai D, Wu N, Li X. Downregulation of miR-363 increases drug resistance in cisplatin-treated Cali-1 by dysregulating Mcl-1. Gene. 2015;572(1):116-122.
Xu Y, An Y, Wang Y, et al. miR-101 inhibits autophagy and enhances cisplatin-induced apoptosis in hepatocellular carcinoma cells. Oncol Rep. 2013;29(5):2019-24.
Shi L, Chen ZG, Wu LL, et al. miR-340 reverses cisplatin resistance of hepatocellular carcinoma cell lines by targeting Nrf2-dependent antioxidant pathway. Asian Pac J Cancer Prev. 2014;15(23):10439-44.
Bermúdez M, Aguilar-Medina M, Lizárraga-Verdugo E, et al. LncRNAs as Regulators of Autophagy and Drug Resistance in Colorectal Cancer. Front Oncol. 2019;9:1008.
Wu Z, Wang Y. Studies of lncRNAs in DNA double strand break repair: what is new. Oncotarget. 2017;8(60):102690-102704.
Zhu ZS. Long noncoding RNA expression profiles of the doxorubicin-resistant human osteosarcoma cell line MG63/DXR and its parental cell line MG63 as ascertained by microarray analysis. International Journal of Clinical & Experimental Pathology. 2015;8(8):8754.
Wang D. Overexpression of long non-coding RNA PVT1 in ovarian cancer cells promotes cisplatin resistance by regulating apoptotic pathways. International Journal of Clinical & Experimental Medicine. 2015;8(11):20565-20572.
Jia Q, Li X, Hui Y, Wang S. Silencing of lncRNA CCDC26 Restrains the Growth and Migration of Glioma Cells In Vitro and In Vivo via Targeting miR-203. Oncol Res. 2018;26(8):1143-1154.
Peng W, Jiang A. Long noncoding RNA CCDC26 as a potential predictor biomarker contributes to tumorigenesis in pancreatic cancer. Biomedecine & pharmacotherapie. 2016;83:712-717.
Cao K, Li M, Miao J, et al. CCDC26 knockdown enhances resistance of gastrointestinal stromal tumor cells to imatinib by interacting with c-KIT . Am J Transl Res. 2018;15;10(1):274-282.
Cerase A, Smeets D, Tang YA, et al. Spatial separation of Xist RNA and polycomb proteins revealed by superresolution microscopy. Proc Natl Acad Sci U S A. 2014;111(6):2235-2240.
Deng QW. Upregulated lncRNA-UCA1 contributes to progression of hepatocellular carcinoma through inhibition of miR-216b and activation of FGFR1/ERK signaling pathway .Oncotarget.2015;6(10):7899-7917.
Tetsuo H, Ryoko Y, Hironori H, Yuka H, Atsuhiko I, Takeshi Y.Long noncoding RNA, CCDC26, controls myeloid leukemia cell growth through regulation of KIT expression. Mol Cancer. 2015;14:90.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Effect of Competitive Binding of Long Non-coding RNA CCDC26 with miR-340 on the Chemosensitivity of HCC Cells to Cisplatin

Status:

Version 1

Abstract

Figures

Backgroud

Materials And Methods

Materials and reagents

Methods

Cell culture and si-CCDC26 interference

IC50

TUNEL

Luciferase reporter assay

Real-time quantitative PCR

Statistical analysis

Results

Expression levels of LncRNA CCDC26 in HCC tissues and cell lines

Interfering effect of si-CCDC26 on QGY8105 and HCC9204 cells

Effect of CCDC26 on the chemosensitivity of HCC cells to cisplatin

Interaction of CCDC26 with miR-340

Discussion

Conclusions

Declarations

References

Additional Declarations

Status:

Version 1