Protection of insect neurons by erythropoietin/CRLF3-mediated regulation of pro-apoptotic acetylcholinesterase

doi:10.21203/rs.3.rs-1435358/v1

Download PDF

Research Article

Protection of insect neurons by erythropoietin/CRLF3-mediated regulation of pro-apoptotic acetylcholinesterase

https://doi.org/10.21203/rs.3.rs-1435358/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Cytokine receptor-like factor 3 (CRLF3) is a highly conserved but largely uncharacterized orphan cytokine receptor that shares structural similarity with vertebrate classical erythropoietin receptor. CRLF3-mediated neuroprotection in insects can be stimulated with human erythropoietin and involves partly similar anti-apoptotic mechanisms as erythropoietin-mediated neuroprotection in mammals. To identify potential mechanisms of CRLF3-mediated neuroprotection we studied the expression and function of acetylcholinesterase which promotes apoptosis in different cell types, including mammalian neurons. We exposed primary brain neurons from Locusta migratoria and Tribolium castaneum to apoptogenic stimuli and/or dsRNA to interfere with acetylcholinesterase gene expression and compared survival and/or acetylcholinesterase expression in the presence or absence of the CRLF3 ligand erythropoietin. Hypoxia increases both apoptotic cell death and expression of both acetylcholinesterase-coding genes ace-1 and ace-2. Both ace genes give rise to single transcripts in both normal and apoptogenic condictions. Pharmacological inhibition of both acetylcholinesterases and RNAi-mediated knockdown of either ace-1 or ace-2 expression prevent hypoxia-induced apoptosis of primary brain neurons. Activation of CRLF3 with protective concentrations of rhEpo prevents the increased expression of pro-apoptotic acetylcholinesterase with larger impact on ace-1 than on ace-2. In contrast, high concentrations of rhEpo that commonly (and seemingly paradoxically) cause death of insect and mammalian neurons induced ace-1 expression and hence promoted apoptosis in insect neurons. Our study confirms the cell-intrinsic role of acetylcholinesterase as a major regulator of apoptotic death, that was previously described in mammalian neurons only. Moreover, we identify a mechanism (prevention of upregulation of pro-apoptotic acetylcholinesterase), by which CRLF3 activation mediates neuroprotection under apoptogenic conditions. Since both apoptosis and CRLF3 are conserved throughout the animal kingdom, the direct link between cytokine/CRLF3 activation and suppression of increased acetylcholinesterase expression underlying neuroprotection in insects may also be present in other cell types and other non-insect species.

Neuroprotection

CRLF3

erythropoietin

cytokine

acetylcholinesterase

AChE

Acetylcholinesterase (AChE) hydrolyses acetylcholine and terminates synaptic transmission at cholinergic synapses in vertebrates and invertebrates (Zhang et al., 2002). AChE is expressed in tissues with and without cholinergic innervation and contributes to multiple processes including cellular adhesion, cell growth, cell differentiation, amyloid fiber assembly and apoptosis [2–5]. Altered presence and functions of AChE are associated with various degenerative diseases including Alzheimer’s disease, Parkinson’s disease and cancer in various tissues [6–9]. Mammalian species express three major AChE splice variants from a single gene locus, that differ in their carboxy-terminal domains which determine localisation and interactions with other proteins [3, 10–12]. Splice variants include the synaptic AChE (AChE-S), erythrocytic AChE (AChE-E) and the soluble read-through variant (AChE-R). Apoptogenic physiological stress enhances intracellular AChE levels in various mammalian tissues (including brain, retina, kidney, endothelial cells, bone, myoblasts) and cell lines (including PC12, neuroblastoma, HeLa cells) (reviewed by [3, 13]. Increased levels of AChE sensitize cells to induce apoptosis upon exposure to pathogenic or physiologically challenging conditions [14]. Absence or catalytic inactivation of AChE have been correlated with reduced sensitivity to apoptogenic stimuli and reduced cell death in various cell types including neurons [8, 15]. [8, 15]. In mammalian organisms AChE expression is elevated under apoptogenic conditions and cytoplasm-located AChE interacts with caveolin-1, APAF-1 and cytochrome c in order to facilitate apoptosome formation [3, 16, 17]. Silencing of AChE inhibited apoptosome formation and increased cell survival [16, 18]. Additionally, AChE can act as a DNase following nuclear translocation during apoptosis [19]. However, overexpression of the enzyme is not invariantly coupled with initiation of apoptosis, but rather sensitizes cells towards apoptotic stimuli [14].

In contrast to mammals, most insects possess two distinct genes (ace-1 and ace-2) coding for different AChE proteins [20–22]. Depending on the species, either AChE-1 or AChE-2 mediates the canonical, synaptic functions of the enzyme [20, 22–24], while functions of the other protein remain largely uncharacterised [20, 22, 23, 25, 26]. Our previous studies identified a pro-apoptotic function of AChE in neurons of the migratory locust Locusta migratoria [27] that parallels the role of AChE mammalian apoptosis. We demonstrated that Lm-ace-1 transcript levels increased under hypoxic conditions in vivo and that pharmacological inhibition of AChE prevented hypoxia-induced apoptotic death of locust primary neurons. This indicates a link between AChE-1 presence/activity and apoptotic cell death in insects [27]. Since genetic information in locusts is scarce, sequence information is only available for Lm-ace-1 but not for Lm-ace-2. This prevents the investigation of differential functions of ace-1 and ace-2 in apoptosis and other processes in locust species. The red flour beetle Tribolium castaneum expresses different ace transcripts and AChE proteins from two genes, with cholinergic functions accounted to Tc-ace-1 and other, incompletely identified functions in developmental processes of Tc-ace-2 [22, 25]. Given that sequences for both Tc-ace-1 and Tc-ace-2 are available and protocols for in vitro studies with primary neurons were previously established, we decided to analyse the differential involvement of the two ace genes and AChE proteins in T. castaneum apoptosis.

Erythropoietin (Epo) is a helical cytokine generally known for its functions in vertebrate erythropoiesis, where it protects erythrocyte progenitor cells from apoptosis [28–30]. Local production and cytoprotective functions of Epo have been discovered in arious vertebrate tissues [31–36]. Epo-mediated cell protection typically relies on upregulation of anti-apoptotic proteins following phosphorylation of JAK associated with Epo receptors (reviewed in [37]). Nonetheless, a clear picture of Epo-mediated anti-apoptotic effects remains elusive. Both L. migratoria and T. castaneum express the phylogenetically conserved orphan cytokine receptor CRLF3 (cytokine receptor-like factor 3). CRLF3 belongs to group 1 of the prototypic class one cytokine receptors which also includes the classical erythropoietin receptor EpoR [38, 39]. Both receptors are expressed in various mammalian tissues including the nervous system. Erythropoietin signalling initiates neuroprotective processes in the mammalian nervous system [32, 34, 40, 41] by activating homodimeric EpoR and/or alternative Epo receptors [42–44]. EPO and EPOR are widely but exclusively expressed in vertebrate species and therefor are absent in insects. Nonetheless, recombinant human Epo (rhEpo) protects locust and beetle neurons from toxin- and hypoxia-induced apoptosis by activating partially identical intracellular transduction pathways as in mammalian cells [45–47]. CRLF3 was identified as the insect neuroprotective receptor for rhEpo and EV-3, a splice variant of human Epo with neuroprotective properties that cannot activate homodimeric EpoR [46, 48, 49]. Signalling via an unknown Epo-like cytokine and CRLF3 seems to represent an ancient cell-protective system that secures neuron and other cells’ survival and maintenance of tissue functionality under unfavourable physiological conditions.

Cell-protective concentrations of Epo vary between cell types, species and types of insult [47, 50–52]. Optimum-type concentration-responses have been reported for mammalian and insect neurons, in which high Epo concentrations not only lack the protective effects but rather exert cytotoxic effects leading to increased cell death compared with untreated control cells [46, 53–57]. Reduced protective effects with Epo concentrations above the optimum have been explained by desensitization or downregulation of EpoR [58, 59] and prevention of EpoR homo-dimerisation due to saturation of high-affinity binding sites of EpoR monomers [60]. An explanation for toxic effects of very high concentrations of Epo is currently lacking for EpoR, CRLF3 or other potential alternative Epo receptors.

In the present study on primary neuron cultures from L. migratoria and T. castaneum and whole T. castaneum pupae, we explore the differential expression of Tc-ace-1 and Tc-ace-2 under apoptogenic conditions (hypoxia) and their contribution to the progress of apoptosis. We link the previously reported neuroprotective effect of rhEpo-mediated CRLF3 activation in both insect species to reduced expression of pro-apoptotic AChE. While neuroprotective concentrations of rhEpo prevented overexpression of ace-1 under apoptogenic conditions, toxic concentrations of rhEpo increased ace-1 expression. Given the known pro-apoptotic functions of AChE in mammalian neurons (and other cells), Epo-mediated neuroprotection via EpoR and/or alternative Epo receptors may also rely on negative regulation of ACHE expression.

Experiments were performed with Tribolium castaneum late pupae (San Bernadino wildtype strain) kindly provided by the lab of Prof. Dr. Gregor Bucher and Locusta migratoria fifth instar nymphs obtained from a commercial breeder (HW-Terra, Herzogenaurach, Germany). Beetles were reared in plastic boxes filled with whole grain flour and yeast at 27°C, 40% humidity and 12/12 h day/night cycle. Locusts were kept at 24°C, 55% at 12/12 h day/night cycle.

Insect primary brain cell culture

Primary neuron cultures were established as previously described [27, 45, 46, 48, 61]. In brief, 20 tribolium or 2 locust brains per culture were dissected and collected in Leibowitz 15 medium (Gibco; Life Technologies, Darmstadt, Germany) supplemented with 1% penicillin/streptomycin and 1% amphotericin B (both Sigma-Aldrich, Munich, Germany) (from now referred to as L15 medium). Subsequently, brains were enzymatically digested in collagenase/dispase (2mg/ml, Sigma-Aldrich, Munich, Germany) for 45 min (T. castaneum) or 30 min (L. migratoria) at 27°C. Enzymatic reaction was stopped by repeated washing in Hanks’ balanced salt solution and brains were mechanically dissociated by repeated pipetting in L15. The suspension of dissociated brain cells was seeded on Concanavalin A (Sigma-Aldrich, Munich, Germany) coated coverslips and let to rest for 2 h. Afterwards, culture dishes were filled with L15 supplemented with 5% fetal bovine serum gold (FBSG, PAA Laboratories GmbH, Pasching, Austria). Medium was replaced by L15 plus FBSG on day two and by L15 without serum on day four in vitro. Primary cell cultures were maintained at 27°C without CO₂ buffering.

Pharmacological treatment and hypoxia exposure of primary cell cultures

Cell cultures were treated with 10 µM neostigmine bromide (NSB; Sigma-Aldrich, Munich, Germany), 10 µM territrem B (TRB; initially dissolved in methanol, further diluted in L15; Abcam, Cambridge, United Kingdom) or recombinant human Epo (33,3 ng/ml or 333 ng/ml for locust cultures and 0,8 ng/ml or 8 ng/ml for beetle neurons; NeoRecormon; Roche, Welwyn Garden City, United Kingdom). AChE inhibitors NSB and TRB were applied throughout the entire culturing period and replaced with each medium change. rhEpo was added to the medium on day 5 in vitro. 12 h after the onset of rhEpo treatment, cultures were exposed to hypoxia (< 0,3% O₂, Hypoxia Chamber; Stemcell, Cologne, Germany) for 36 h. Untreated control culture were maintained at normoxic conditions. Subsequently cell cultures were fixed and stained as described below. To compare effects of protective and deleterious concentrations of rhEpo, cultures were exposed to different concentrations of rhEpo for 48 h starting on day five in vitro.

RNA interference with ace-1 and ace-2 expression in T.castaneum neurons

Double-stranded (ds) RNA fragments targeting Tc-ace-1 or Tc-ace-2 were designed and prepared as stated below. To reduce expression of respective protein, 10 ng/ml dsRNA targeting either Tc-ace-1 or Tc-ace-2 was added from the beginning of the experiment and renewed with each medium change. Successful interference with protein expression by “soaking RNAi” was previously demonstrated in primary cultured T. castaneum neurons (Hahn et al., 2017; Knorr et al., 2021). Cells were exposed to hypoxia on day 5 for 36 h (O₂ < 0,3%) before being fixed and analyzed for cell survival.

Dapi staining and analysis of cell survival

After treatments, cells were fixed in 4% paraformaldehyde (PFA) for 30 min. Cells were washed 3 times in phosphate-buffered saline (PBS) and twice in PBS/0,1% Triton-X-100 (PBST) for each 5 min. Subsequently nuclei were stained with Dapi (Sigma-Aldrich, Munich, Germany 1:1000 in PBST) for 30 min before being washed 5 times in PBS. Coverslips were transferred to microscopy slides, enclosed in DABCO (Roth, Karlsruhe, Germany) and sealed around the edges with nail polish.

Images of Dapi-stained nuclei were taken using an epifluorescence microscope (Zeiss Axioskop, Oberkochen, Germany) equipped with a spot CCD camera (Invisitron, Puchheim, Germany). From each cell culture, two rows of non-overlapping photographs were taken (for locust cultures ~ 80 images using 40x magnification; for tribolium cultures ~ 120 images using 63x magnification). Cell survival was assessed by the Dapi stained chromatin structure as described previously [27, 45, 46, 48, 61]. Intact and dead/dying neurons were identified and counted automatically by an object recognition AI based on the Faster R-CNN [63] net with Inception V2 [64]. We re-trained a neuronal net that was previously trained and configured for the Oxford-III Pets dataset [65]and is available as part of the tensor-flow model collection [66]. Experts categorized living and dead cells for Locusta (3480 cells in 92 images) and Tribolium (3469 cells in 75 images). All routines for the AI cell counting routines were written in Python 3.5 [67] utilizing numpy [68], pandas [69], and tensor flow [70] amongst others.

Cell survival in different treatment groups within one experiment was subsequently normalized towards the corresponding untreated control, set to 1.

dsRNA cloning and preparation

Two non-overlapping fragments targeting either Tc-ace-1 (HQ260968) or Tc-ace-2 (HQ260969) were designed and cloned into the pCRII vector by TA cloning (TA cloning Kit, Invitrogen, Life Technologies, Darmstadt, Germany) (Fragment sequences are listed in Supplements). Vectors were transformed into XL-1 blue competent cells and grown on ampicillin-supplemented agar plates. Multiple clones were analyzed by colony PCR and sequencing for the proper insertion of the target fragments. Clones with the appropriate vector were grown and DNA was extracted using NucleoSpin Plasmid Kit (Macherey-Nagel, Düren, Germany).

For dsRNA preparation, plasmids were amplified by PCR using M13 fwd and M13 rev primers with a T7 RNA promoter sequence attached to the reverse primer. The PCR program and primer sequences are listed in Tables 1 and 2. PCR products were separated on a 1% agarose gel and purified using the Macherey–Nagel NucleoSpin Gel and PCR Clean-up Kit (Macherey–Nagel, Düren, Germany) according to the manufacturer’s recommendations.

Purified DNA was subsequently in vitro transcribed by usage of the MEGAScript T7 transcription kit (Life Technologies, Darmstadt, Germany) following the manufacturer’s instructions. The single-stranded RNA was washed three times in 70% EtOH before resuspension in injection buffer (1.4 mM NaCl, 0.07 mM Na₂HPO₄, 0.03 mM KH₂PO₄, 4 mM KCl). Single-stranded RNA was annealed to double strands (dsRNA) at 94°C for 5 min and cooled down to 20°C at a rate of 0,1°C per second. dsRNA concentrations were measured with a spectrophotometer (Nanodrop 1000, Thermo Fisher Scientific, Schwerte, Germany). dsRNA quality was assessed by agarose gel electrophoresis.

Table 1

Oligonucleotides used in this study. Primers for M13, M13-T7, Lm *ace-1*, *18srRNA* and *gapdh* were previously used [27, 46]. Lm = *L. migratoria*; Tc = *T. castaneum*. Oligonucleotides used for splice variant analysis of *Tc-ace-2* may potentially generate two amplicons.
	Sequence 5'-3'	Amplicon [bp]
M13 fwd	GTAAAACGACGGCCAGT	300
M13-T7 rev	TAATACGACTCATAGGCAGGAAACAGCTATGAC	300
Tc ace-2-E1-E3 fwd	GCCAGAGACTTTCACAGCGA	1177 / 359
Tc ace-2-E1-E3 rev	CATCACGTTCCAACCGACTC	1177 / 359
Tc ace-2-E2-E4 fwd	CGGCTTCCTCTACTTGAGCA	731 / 588
Tc ace-2-E2-E4 rev	TCTGGTTCAAGTAGCCGTCG	731 / 588
Tc ace-2-E3-E5 fwd	GAGTCGGTTGGAACGTGATG	345 / 192
Tc ace-2-E3-E5 rev	GCTGCAAATCTGGCAAAGGC	345 / 192
Tc ace-2-E4-E6 fwd	CGACGGCTACTTGAACCAGA	424 / 266
Tc ace-2-E4-E6 rev	ATCGTTCCAAAACGCGCACG	424 / 266
Tc ace-2-E4-E7 rev	TGCTCAAGTAGAGGAAGCCG	534 / 376
Tc ace-1 fwd	AACTTCAGCAGCAAACGAGC	120
Tc ace-1 rev	CTGTCGACACCATCAGGAGG	120
Tc ace-2 fwd	ACAGCTGAGGTTCAGGAAGC	116
Tc ace-2 rev	GGGAAGTACTCGTAGCGCTC	116
Tc rps3 fwd	GGCGCTAAAGGGTGTGAAGT	150
Tc rps3 rev	TGTCTTAGCAAGACGTGGCG	150
Tc rps18 fwd	CCTCAACAGGCAGAAGGACA	130
Tc rps18 rev	CCTGTGGGCCCTGATTTTCT	130
Lm ace-1 fwd	TTTGAAATGGCGGTGGTAGC	120
Lm ace-1 rev	GTCGGAGGACTGCCTGTAC	120
Lm 18s rRna fwd	CATGTCTCAGTACAAGCCGC	106
Lm 18s rRna rev	TCGGGACTCTGTTTGCATGT	106
Lm gapdh fwd	GTCTGATGACAACAGTGCAT	110
Lm gapdh rev	GTCCATCACGCCACAACTTTC	110

Table 2

PCR program for dsRNA template amplification
Step	Temperature [°C]	Time [s]	Cycle
Initial denaturation	98	180
Denaturation	98	30	x30
Annealing	60	30
Elongation	72	30
Final elongation	72	300

RNA isolation and cDNA synthesis

RNA of cell cultures and brains was isolated using Trizole (Thermo Fisher Scientific, Schwerte, Germany) as described previously [27, 61]. For tissue specimen 15 brains of late T. castaneum pupae were extracted and collected in RNALater (Sigma-Aldrich, Munich, Germany). In the case of cell culture specimen, 5 cultures of each treatment group were prepared as described above. Cells were scraped in medium and cell suspension was centrifuged at 21.000 x g for 5 min. Medium was discarded and the cell pellet was washed in PBS once before RNA isolation.

In brief, 1 ml Trizole was added per sample and samples were homogenized using a tissue lyser (Qiagen, Hilden, Germany) at 50 Hz for 3 min (stainless steel beads were used in case of tissue samples). Subsequently 200 µl chloroform (Labsolute, Th. Geyer, Renningen, Germany) was added and the mixture was returned into the tissue lyser for 20 s. Samples were centrifuged at 12.000 x g for 15 min at 4°C and the translucent, RNA-containing phase was carefully transferred to a fresh Eppendorf tube and mixed with 1 ml ice cold 70% EtOH. Tissue samples were incubated for at least 30 min at -20°C. Cell culture samples were incubated overnight. The precipitated RNA was centrifuged at 10.000 x g for 15 min at 4°C and the RNA pellet was washed three times in ice cold 70% EtOH. RNA pellets were air dried and resuspended in 6–30 µl ddH₂O. RNA concentrations were measured with a spectrophotometer (Nanodrop 1000, Thermo Fisher Scientific, Schwerte, Germany).

Complementary DNA (cDNA) was synthesized using the NEB LunaScript RT SuperMix Kit (New England BioLabs, Ipswich, MA, USA) according to the manufacturer’s instructions.

Ace splice variant analysis

In order to identify if Tribolium performed alternative splicing on ace-2, exon spanning primers, skipping one exon, were designed (see Table 1). Primers were set into the middle of each exon and reverse transcription PCR (RT-PCR) from brain cDNA was run. RNA and cDNA were prepared as described above. RT-PCR Program can be seen in Table 3. RT-PCRs were performed using GoTaq Green Master Mix (Promega, Madison, USA) according to the manufacturer’s instructions. Expected amplicon sizes in case of alternative splicing can be seen in Table 1.

Table 3

RT-PCR program for Tc *ace-2* splice variant analysis.
Step	Temperature [°C]	Time [s]	Cycle
Initial denaturation	98	180
Denaturation	98	30	x30
Annealing	61	30
Elongation	72	30
Final elongation	72	300

qPCR analysis for Tc-ace-1 and Tc-ace-2 expression in vitro and in vivo

In order to evaluate if either Tc-ace-1 or Tc-ace-2 are differentially expressed in neurons of T. castaneum pupae during physiological stress qPCR analyses were performed.

T. castaneum pupae were exposed to hypoxia for either 24 or 36 h. Control animals remained in normoxic conditions. 15 brains were extracted and collected in RNALater. RNA isolation and cDNA synthesis were performed as described above. For cell culture experiments cells of different treatment conditions (normoxia, hypoxia, rhEpo) were collected and prepared as described above.

qPCR analysis was run using primers for amplification of T. castaneum ace-1 and ace-2 and L. migratoria ace-1 (EU231603). Rps18 and rps3 (TC014405 and TC008261) were run as controls for beetle neurons, while 18s rRna and gapdh (AF370793 and JF915526) were used for qPCR analysis of locust neurons. Prior to experimental qPCR runs, all primers for housekeeping genes were tested for efficiency and stability in hypoxic conditions. Primer sequences are listed in Table 1.

qPCRs were run using the MyiQ™ Single-ColorReal-Time PCR Detection System (Bio-Rad, Munich, Germany) in a sealed 96-well plate. Final PCR reactions contained 5 µl Luna Universal qRT-PCR Master Mix (New England Bio- Labs, Ipswitch, MA, USA), 0,1 µM forward and reverse primers and 10 ng cDNA resulting in a final reaction volume of 10 µl. All samples were run as triplicates and (-) RT and water controls were always included. The PCR amplification protocol is displayed in Table 4.

Table 4

qPCR program employed for gene expression studies.
	Step	Temperature [°C]	Time [s]
	Initial denaturation	95	180
PCR reaction	Denaturation	95	10	x40
	Annealing	61	30
	Elongation	72	30
Melting curve	Denaturation	95	60
	Annealing	55	60
	Melting curve	55	10	0.5°C per cycle up to 95°C

Data was analyzed using the Pfaffl method [71] and geometric means of both housekeeping genes were calculated and normalized towards the control group for both species.

Statistical analysis and data plotting

All statistical calculations were performed with RStudio (Version 1.2.1335). Pairwise permutation tests contained in the R packages “coin” and “rcompanion” were employed and combined with Benjamini-Hochberg corrections for multiple comparisons [72, 73]. Normalized relative survival data are plotted as box plots, depicting the median cell survival, upper and lower quartile and whiskers representing 1,5x interquartile ranges. Dots represent data points from individual experiments. qPCR results are shown as bar plots of geometric mean calculations of single experimental data. Standard deviations were calculated with Excel (Microsoft).

Involvement of ace in T.castaneum apoptosis

Before studying the role of AChE in the neuronal apoptosis of T. castaneum we explored the possibility of multiple splice variants from the two ace genes. While ace-1 includes only two exons making alternative transcripts rather unlikely, ace-2 consists of seven exons carrying the potential for multiple different splice variants (Fig. 1A). We designed primers spanning central regions of various pairs of ace-2 exons (indicated in Fig. 1A) in order to detect potential splice variants in the present transcripts. Transcripts were analysed in brains of untreated pupae and brains of pupae after 24 h exposure to hypoxia (< 0,3% O₂). RT-PCR analysis revealed no alternative splicing products of ace-2, neither in normoxic control nor in hypoxia-treated pupae (Fig. 1B). All detected PCR products included the exon that was interspersed between the two exons targeted by the primers. Hence, all PCR products were clearly larger than expected if the sandwiched exon was spliced out (size of potential PCR product from alternate transcript indicated by yellow boxes in Fig. 1B). The results are in line with the existence of only one transcript that includes all seven exons in normal and hypoxia-challenged T. castaneum brains.

We previously demonstrated that pharmacological inhibition of AChE rescues primary cultured locust neurons from hypoxia-induced apoptosis [27]. Following a similar protocol, primary neuron cultures from T. castaneum were exposed to hypoxic conditions (< 0,3% O₂) for 36 h. Hypoxia-exposure reduced the median relative survival of cultured neurons (0,8) in comparison to normoxic control cultures (normalized to 1.0; Fig. 1C). Hypoxia-induced cell death was completely prevented in the presence of 10 µM of the two AChE inhibitors neostigmine bromide (NSB; median relative survival 0,98) and territrem B (TRB; median relative survival 1,1). Neuron survival in hypoxia was significantly increased by both AChE inhibitors compared to untreated hypoxic cultures reaching the same level as the normoxic control cultures.

Expression of Tc-ace-1 and Tc-ace-2 under apoptogenic conditions was studied by qPCR in brains of T. castaneum following hypoxia-exposure (< 0,3% oxygen) of pupae for 24 and 36 hours. 24 h hypoxia significantly increases transcript levels of both Tc-ace-1 (2,36 fold ± 0,8 Stdv) and ace-2 (1,47 fold ± 0,6 Stdv) compared to brains of control animals in normoxic atmosphere (Fig. 1D). Prolonging the hypoxic period to 36 h reduced high expression levels detected after 24 h. While Tc-ace-1 expression remained significantly elevated (1,37 fold ± 0,3 Stdv), Tc-ace-2 transcript levels were no longer different from controls kept under normoxic conditions (1,02 fold ± 0,4 Stdv). The results presented in Figs. 1C and 1D indicate a pro-apoptotic involvement of both T. castaneum ace genes in hypoxia-induced neuronal apoptosis.

In order to assess the individual contributions of Tc-ace-1 and Tc-ace-2 to hypoxia-induced apoptosis in T. castaneum we inhibited the production of the respective AChE proteins by RNA interference in primary cultured brain neurons before subjecting them to hypoxia (< 0,3% O₂; 36 h). Neuron survival was compared between normoxic control cultures, hypoxia-exposed cultures and hypoxia-exposed cultures after dsRNA-mediated knockdown of either Tc-ace-1 or Tc-ace-2 expression. For each ace gene two dsRNA fragments that target non-overlapping regions of the respective transcript, were designed and knockdown was induced by soaking RNAi as described previously (Hahn et al., 2017; Knorr et al., 2020). Figure 2 depicts data from experiments with the respective fragment 1 to knock down Tc-ace-1 and Tc-ace-2 expression (Data from experiments with fragment 2 are provided in the supplement (Fig. 5 supporting information).

Hypoxia significantly reduced relative neuron survival compared with normoxic control cultures in both experimental series (Fig. 2A: median relative survival 0,80; Fig. 2B: median relative survival 0,78). Knock down of Tc-ace-1 with fragment 1 significantly increased relative neuron survival in hypoxia-exposed cultures (median relative survival 0.97), however without reaching survival levels in normoxic control cultures (Fig. 2A). Knock down of Tc-ace-1 expression with fragment 2 elevated median relative neuron survival in hypoxia-exposed cultures from 0,77 to 0,82 (not significant, Fig. 5A supporting information). RNAi-mediated suppression of Tc-ace-2 expression with fragment 1 significantly increased neuron survival in hypoxia-exposed cultures (median relative survival 0.89) (Fig. 2B). Similar results were obtained after knock down of Tc-ace-2 expression with fragment 2 which increased median neuron survival in hypoxia from 0,84 to 0,94 (Fig. 5B; supporting information). However, interference with Tc-ace-2 expression with either fragment was not sufficient to increase cell survival in hypoxia to the levels of normoxic cultures. In summary, dsRNA-mediated interference with Tc-ace-1 and Tc-ace-2 expression for five days prior to hypoxia-exposure partially rescues T. castaneum primary neurons from hypoxia-induced apoptosis.

rhEpo prevents hypoxia-induced apoptosis and elevated ace expression

Previous studies reported anti-apoptotic effects of rhEpo on locust and beetle neurons [45, 46] whereas AChE was associated with pro-apoptotic activity ([27]; this study). In order to evaluate a potential convergence of these pro- and anti-apoptotic pathways we combined rhEpo and AChE-inhibitor treatment of hypoxia-exposed neurons and studied potential regulatory effects of rhEpo on ace expression in both L. migratoria and T. castaneum primary neuron cultures.

Hypoxia-induced apoptosis of locust neurons was completely prevented by 33,3 ng/ml rhEpo, 10 µM NSB and combined treatment with rhEpo and NSB (Fig. 3A). Relative neuron survival was statistically similar in rhEpo-, NSB- and rhEpo/NSB-treated cultures indicating no additive effects of the beneficial compounds following combined application. The same hypoxic treatment (< 0,3% O₂; 36 h) that caused apoptotic death of primary cultured locust neurons elevated the expression of ace-1 transcript (1,47 fold ± 0,3 Stdv) compared to normoxic control cultures (Fig. 3B). Lm-ace-1 expression was normalized to 18s rRNA and gapdh which were not affected by hypoxia-exposure. Elevated ace-1 expression was prevented by neuroprotective concentration of rhEpo, indicating a link of Epo-mediated neuroprotection with the suppression of pro-apoptotic AChE expression during apoptogenic stress (Fig. 3B). Since sequence information about L. migratoria ace-2 is not available, expression of Lm-ace-2 could not be analysed.

In primary neuron cultures of T. castaneum hypoxia-induced apoptosis was prevented by 0,8 ng/ml rhEpo and by 10 µM NSB (Fig. 3C). Combined treatment with the same concentrations of rhEpo and NSB also increased relative neuron survival in hypoxia-exposed cultures (from 0,81 to 0,96 median relative survival) to the level of normoxic control cultures, but this increase did not reach significance level. Hypoxia (< 0,3% O₂; 36 h) increased the expression of Tc-ace-1 (1,2 fold ± 0,2 Stdv) and ace-2 (1,33 fold ± 0,3 Stdv) transcripts in T. castaneum neurons (Fig. 3D). Tc-ace gene expression was normalized to rps3 and rps18 whose abundance remained stable during the hypoxic period. Treatment of hypoxia-exposed cultures with neuroprotective concentration of rhEpo prevented the increase of Tc-ace-1 expression (1,05 fold ± 0,2 Stdv compared with normoxic control cultures) but not the increase of Tc-ace-2 expression (1,2 ± 0,1 Stdv) (Fig. 3D). Thus, while hypoxia induces apoptosis and elevated expression of Tc-ace-1 and Tc-ace-2 in T. castaneum neurons, Epo-mediated neuroprotection correlates with suppressed ace-1 expression, suggesting that elevated Tc-ace-2 transcript levels alone are not sufficient to drive apoptosis.

Previous studies reported optimum-type dose-response curves for Epo-mediated protection of mammalian and insect neurons [46, 53, 55–57]. So far, no mechanistic explanation for toxic effects of high Epo concentrations mediated via homodimeric EpoR or alternative Epo receptors has been provided. In this context, we compared ace expression in L. migratoria and T. castaneum primary neuron cultures following exposure to previously established neuroprotective and toxic concentrations of rhEpo. Serum was removed from culture media after three days in vitro as a mild apoptogenic stimulus before neurons were stimulated with rhEpo for 48 h starting on day five in vitro. Stimulation of locust neurons with neuroprotective concentrations of rhEpo (33,3 ng/ml) had no impact on Lm-ace-1 expression while toxic concentrations of rhEpo (333 ng/ml) significantly increased ace-1 transcript levels (2,3 fold ± 0,8 Stdv) compared to untreated controls (Fig. 4A). Lm-ace-1 expression was normalized to 18s rRNA and gapdh that were not affected by rhEpo. In T. castaneum neurons neuroprotective concentrations of rhEpo (0,8 ng/ml) reduced the expression of both Tc-ace-1 (0,72 fold ± 0,1 Stdv) and Tc-ace-2 (0,69 fold ± 0,1 Stdv) compared with untreated control cultures (Fig. 4B). Toxic concentrations of rhEpo (8 ng/ml) affected the expression of the two ace genes differentially, leading to increased Tc-ace-1 (1,33 fold ± 0,3 Stdv) and decreased Tc-ace-2 (0,71 fold ± 0,2 Stdv) transcript levels compared with untreated controls (Fig. 4B). Tc-ace gene expression was normalized to rps3 and rps18 whose abundance was not altered by rhEpo stimulation. Thus, toxic concentrations of rhEpo elevate the expression of pro-apoptotic ace-1 in both locust and beetle neurons.

AChE is an important regulator and executor of apoptosis in mammalian cells and altered presence of AChE is associated with various degenerative diseases and cancer [6, 8, 9, 74, 75]. A pro-apoptotic function of AChE, that parallels its role in mammals, was recently reported in the migratory locust L. migratoria [27]. Due to incomplete genomic information in this species only one (ace-1) of typically two genes coding for AChE in insects has so far been identified. Hence, we extended our studies to the beetle T. castaneum in which expression and function of both Tc-ace-1 and Tc-ace-2 could be differentially studied. Previous studies suggested that Tc-AChE-1 is predominantly responsible for ACh hydrolysis at cholinergic synapses while Tc-ace-2 is involved in developmental processes [22].

In regard to AChE isoforms by alternative splicing and alternative promotor selection in vertebrates [5, 76] and reports about multiple and partly stress-induced AChE-2 splice variants in Drosophila melanogaster [20, 77] we explored the possibility of alternatively spliced T. castaneum ace-1 and ace-2. Tc-ace-1 includes two exons. Since exon 2 contains no start codon, only one gene product is expected from this locus. Tc-ace-2 contains seven exons providing the possibility for multiple alternatively spliced transcripts. qPCR-based analysis of pupal brains with various pairs of exon-spanning primers detected single transcripts of respective sizes that were expected in the absence of splicing. Detected transcripts were identical in brains of untreated pupae and pupae that were exposed to hypoxia for 24 h. These results suggest a single transcript from the Tc-ace-2 locus under both normal and physiologically challenging conditions. Since cyclorrhaphan flies possess only one gene for AChE (a paralogue to ace-2 of other insects) the previously reported alternative splicing of ace-2 in D. melanogaster may be required to generate different types of AChE that perform both synaptic and extrasynaptic functions [20].

Survival of unchallenged and hypoxia-exposed primary neurons from L. migratoria increased with pharmacological inhibition of AChE [27]. This indicated a pro-apoptotic role for AChE in this species that parallels AChE functions in vertebrates. Hypoxia-challenged neurons of T. castaneum were also rescued from apoptotic cell death by AChE inhibition (this study), suggesting the general presence of AChE-mediated pro-apoptotic functions in insect neurons and probably other cell types. In contrast to unselective pharmacological inhibition of both AChE-1 and AChE-2 by two different inhibitors (NSB and TRB), which completely prevented hypoxia-induced cell death, RNAi-mediated knockdown of either Tc-ace-1 or Tc-ace-2 expression rescued hypoxia-exposed neurons only partially (Fig. 2; Fig. 5 supporting information). Incapability of full rescue may be related to incomplete clearance of AChE proteins, partial functional compensation by the other AChE type or direct contribution of AChE types to some but not all apoptotic mechanisms. Double knockdown of both Tc-ace-1 and Tc-ace-2 expression had no apparent effect on the survival of primary brain neurons in normal cultures and (unexpectedly) did not rescue neurons from hypoxia-induced apoptosis (see Fig. 6 supporting information). Both AChE types contain conserved sequence motifs for functional esterase catalytic domains but Tc-AChE-2 may be catalytically less efficient than Tc-AChE-1 because of a narrowed entry region to the esterase region [25]. Nevertheless, reduced levels of either Tc-AChE-1 or Tc-AChE-2 significantly interfered with hypoxia-induced cell death, indicating their involvement in cellular mechanisms that promote apoptosis.

Previous studies detected enhanced expression of Lm-ace-1 transcript in brains of hypoxia-exposed locusts [27] and in vitro experiments with primary brain neurons (this study) confirmed upregulation of Lm-ace-1 transcripts under apoptogenic conditions. In contrast to L. migratoria, sequences of both ace genes are available for T. castaneum, allowing studies of the differential expression of Tc-ace-1 and Tc-ace-2 in this species. Transcript levels of both ace genes were elevated in the brains of hypoxia-exposed T. castaneum pupae, with more pronounced and more persistently enhanced expression of Tc-ace-1 compared to Tc-ace-2 (Fig. 1D). Similarly, enhanced expression of both Tc-ace-1 and Tc-ace-2 was also detected in primary brain neurons exposed to 36 h of hypoxia, representing a strong apoptogenic stimulus (Fig. 3C, D). Upregulation of ACHE expression under apoptogenic conditions has frequently been reported in mammalian cells and tissues. Here, AChE-S, predominantly involved in synaptic ACh hydrolysis, was typically involved [8, 19, 78]. Tc-ace-1 is the predominant AChE associated with synaptic functions in T. castaneum while Tc-ace-2 participates in rather diffusely characterized developmental processes [22, 25]. Our results suggest that synaptic Tc-ace-1 seems to play a more important role for the induction and execution of apoptosis than Tc-ace-2, since its expression is induced by hypoxia and toxic concentrations of rhEpo (discussed below). Locust and beetle brains and primary brain neurons express basal levels of AChE that may largely differ between cholinergic neurons and neurons that signal via the release of other transmitters. While the presence of these basal AChE levels does not invariantly induce apoptosis, increased ACHE expression stimulated by hypoxia or some other apoptogenic stimuli increases the vulnerability of the cells towards physiological insults. Similar to mammalian cells [14], above-normal levels of AChE seem to determine the sensitivity of an insect neuron to initiate apoptosis under unfavourable conditions.

Having demonstrated an important regulatory function of AChE in apoptosis of locust and beetle neurons ([27]; this study) we explored the possibility that CRLF3-mediated neuroprotection relies on interference with pro-apoptotic functions of AChE. CRLF3 is a phylogenetically (from Cnidaria to humans) conserved cytokine receptor, whose endogenous ligand could not be identified in any species. Based on sequence comparison, CRLF3 is a class I cytokine receptor that shares similarities (e.g. initiates transduction via Janus kinase and STAT signalling) with vertebrate receptors for prolactin, growth hormone, thrombopoietin, and Epo [38, 39]. Epo/CRLF3 interaction initiates antiapoptotic mechanisms in locust and beetle neurons [46, 48] that share a number of similar characteristics with Epo-mediated protection of mammalian neurons and other non-hematopoietic cell types (reviews: [41, 43]. Remarkably, insect CRLF3 is activated by both rhEpo and Epo-like ligands that elicit protection of mammalian neurons without activation of EpoR. One of these ligands is the human Epo splice variant EV-3, that neither activates homodimeric EpoR nor the heteromeric EpoR/β-common receptor, which have been implicated in mammalian cell protection [49, 79]. Since insects do not express Epo, EV-3, EpoR, β common receptor or any other identified mammalian Epo receptor, we can apply rhEpo to selectively activate CRLF3 on insect neurons in our experiments. The endogenous insect CRLF3 ligand is an unidentified cytokine that, like Epo in vertebrates, serves as hormonal signal in circulation and as a local paracrine signal in the nervous system and other tissues [62]. Cytokines regulate responses to exogenous and endogenous insults, repair and restoration of tissue homeostasis in both invertebrates and vertebrates [39, 80].

A recent study demonstrated that cell-free locust hemolymph mediates CRLF3-dependent protection of both locust and beetle neurons, indicating the presence of a conserved ligand for CRLF3 in the circulating fluid [62]. Protective concentrations of rhEpo prevented both hypoxia-induced apoptosis and hypoxia-induced upregulation of pro-apoptotic ace-1 expression in L. migratoria and T. castaneum primary neurons (Fig. 3). The neuroprotective effects of rhEpo and pharmacological inhibition of AChE with NSB were similar and combined treatment with both substances had no detectable synergistic additive effect on neuron survival in hypoxia. Together with the previous observation that the inhibitor of translation anisomycin prevented Epo-mediated neuroprotection of primary locust neurons [47], these results indicate that activation of CRLF3 by Epo or another unknown cytokine prevents the elevated expression of AChE-1 under apoptogenic conditions and hence suppresses the induction and/or execution of apoptotic cell death. Our experiments with neuroprotective and toxic concentrations of rhEpo (for detailed discussion see below) confirm that apoptogenic stimuli induce elevated ace-1 expression and initiation of protective pathways keep ace-1 expression on basal or even lower levels. A direct regulation of AChE expression by Epo signalling has been demonstrated in mammalian erythrocyte progenitor cells that express classical EpoR [81]. Epo-stimulated transduction pathways included activation of the transcription factor GATA-1 which induced ACHE transcription and production of erythrocytic AChE-E. In erythrocyte progenitor cells, expression of AChE-E was essential for survival and maturation [81]. Epo has previously been described to activate GATA-binding transcription factors that regulate transcription of target genes in various cell types [82–86]. GATA transcription factors are evolutionary conserved and have been associated with innate immune responses [87]. Whether they provide the link between CRLF3 activation and apoptosis-suppressing restriction of ace transcription in insect neurons has to be demonstrated in future studies.

Cell-protective concentrations of Epo and EV-3 depend on cell type, species, physiological condition of the cell and the type of insult in both mammals and insects [46, 47, 50–52]. Maximal Epo-mediated protection of primary brain neurons is achieved with 33,3 ng/ml (compares to ~ 4U/ml) in L. migratoria and 0,8 ng/ml (compares to ~ 0,1 U/ml) in T. castaneum [47]. Instead of reaching a state of saturation, higher than optimum concentrations of Epo elicit toxic effects (in particular: Epo concentrations that protect locust neurons will kill beetle neurons). Optimum-type concentration dependence of protection including toxic effects of high concentrations has been reported in mammalian and insect neurons [46, 53–57]. While saturation of neuroprotective effects with increasing concentration of Epo has been associated with desensitization or downregulation of Epo receptors or prevention of ligand-induced receptor dimerization [58–60], the switch from protective via less protective to toxic effects of further elevated concentrations of Epo could not be explained. Previous studies identified 333 ng/ml (L. migratoria) and 8 ng/ml (T. castaneum) as toxic Epo concentrations that reduced the survival of primary brain neurons to ~ 80% compared to untreated control cultures, while species-specific optimal neuroprotective concentrations of Epo increased survival to ^~110–120% [47]. In the present study, toxic concentrations of Epo increased ace-1 transcripts in both species while respective neuroprotective concentrations caused no alteration (L. migratoria) or even reduced (T. castaneum) ace expression (Fig. 4). In contrast to Tc-ace-1, expression of Tc-ace-2 in beetle neurons is not stimulated by toxic Epo concentrations, indicating a specific regulatory effect on the expression of only one of the two ace genes. The data from both species studied suggest that proapoptotic ace-1 is differentially regulated by low to optimal neuroprotective concentrations and higher toxic concentrations of Epo. How insect neurons distinguish neuroprotective from toxic concentrations of CRLF3 ligand is currently unknown. Moreover, protective concentrations seem to depend on the physiological state and other signals converging on a locust brain neuron since identical dilutions of hemolymph (which contains the endogenous CRLF3 ligand) switched from toxic to protective effects if pre-treatment with serum was omitted [62].

The data presented in this manuscript clearly identify AChE as a major driver of apoptosis in insect neurons. Apoptogenic stimuli (hypoxia, toxic concentrations of CRLF3 ligand) increase ace expression and induce cell death. Activation of CRLF3 (either by Epo or endogenous cytokine ligand) mediates neuroprotection by preventing the increased expression of pro-apoptotic AChE with larger impact on ace-1 than on ace-2. Studies on primary brain neurons from two insect species (L. migratoria and T. castaneum) belonging to different taxonomic groups (Orthoptera and Coleoptera) led to similar results, suggesting that the observed mechanisms may be representative for insects. Since both apoptosis and CRLF3 are conserved throughout the animal kingdom, the processes observed in insect neurons may also be present in other cell types and other non-insect species. Altogether, this manuscript allows the connection between vertebrate and insect Epo-mediated mechanisms and is, to our knowledge, the first report of a connection between AChE and Epo in apoptotic mechanisms. Given that most of the results collected in insects on Epo functions could be replicated in mammalian cells and vice versa, it is likely that a similar mechanism is involved in mammalian Epo-mediated cell protection.

Funding

The project was funded by Deutsche Forschungsgemeinschaft (DFG; Project number: 398214842).

Competing Interests

All authors declare no conflicts concerning financial or commercial interests.

Author contributions

D.Y. Knorr, K. Schneider, L. Büschgens, J. Förster and N.S. Georges performed and analysed the experiments. B.R.H. Geurten generated and trained artificial intelligence for cell survival analysis. D.Y. Knorr and R. Heinrich designed and supervised the study. D.Y. Knorr and R. Heinrich wrote and edited the manuscript. All authors read and approved of the final version.

Data availability

All raw data published in this manuscript can be accessed on request.

Ethics approval

Experiments conducted in this study exclusively used insects, which do not require a special ethics approval according to the German laws for animal welfare.

Consent to participate

N/A

Consent to publish

N/A

Zhang XJ, Yang L, Zhao Q, Caen JP, He HY, Jin QH, Guo LH, Alemany M, Zhang LY, Shi YF (2002) Induction of acetylcholinesterase expression during apoptosis in various cell types. Cell Death Differ 9:790–800 . https://doi.org/10.1038/sj.cdd.4401034
Small DH, Michaelson S, Sberna G (1996) non-classical actions of cholinesterases: Role in cellular differentiation, tumorigenesis and Alzheimer’s Disease. Neurochem Int 28:453–483
Zhang X-J, Greenberg DS (2012) Acetylcholinesterase Involvement in Apoptosis. Front. Mol. Neurosci. 5:40
Karczmar AG (2010) Cholinesterases (ChEs) and the cholinergic system in ontogenesis and phylogenesis, and non-classical roles of cholinesterases-A review. Chem Biol Interact 187:34–43 . https://doi.org/10.1016/j.cbi.2010.03.009
Rotundo RL (2017) Biogenesis, assembly and trafficking of acetylcholinesterase. J Neurochem 142:52–58 . https://doi.org/10.1111/jnc.13982
Hu W, Gray NW, Brimijoin S (2003) Amyloid-beta increases acetylcholinesterase expression in neuroblastoma cells by reducing enzyme degradation. 470–478 . https://doi.org/10.1046/j.1471-4159.2003.01855.x
Walczak-Nowicka ŁJ, Herbet M (2021) Acetylcholinesterase inhibitors in the treatment of neurodegenerative diseases and the role of acetylcholinesterase in their pathogenesis. Int J Mol Sci 22: . https://doi.org/10.3390/ijms22179290
Toiber D, Berson A, Greenberg D, Melamed-Book N, Diamant S, Soreq H (2008) N-acetylcholinesterase-induced apoptosis in alzheimer’s disease. PLoS One 3: . https://doi.org/10.1371/journal.pone.0003108
Perry C, Sklan EH, Birikh K, Shapira M, Trejo L, Eldor A, Soreq H (2002) Complex regulation of acetylcholinesterase gene expression in human brain tumors. Oncogene 21:8428–8441 . https://doi.org/10.1038/sj.onc.1205945
Grisaru D, Sternfeld M, Eldor A, Glick D, Soreq H (1999) Structural roles of acetylcholinesterase variants in biology and pathology. Eur. J. Biochem. 264:672–686
Hicks D, John D, Makova NZ, Henderson Z, Nalivaeva NN, Turner AJ (2011) Membrane targeting, shedding and protein interactions of brain acetylcholinesterase. J Neurochem 116:742–746 . https://doi.org/10.1111/j.1471-4159.2010.07032.x
Ye W, Gong X, Xie J, Wu J, Zhang X, Ouyang Q, Zhao X, Shi Y (2010) AChE deficiency or inhibition decreases apoptosis and p53 expression and protects renal function after ischemia/reperfusion. Apoptosis 15:474–487 . https://doi.org/10.1007/s10495-009-0438-3
Campoy FJ, Vidal CJ, Muñoz-Delgado E, Montenegro MF, Cabezas-Herrera J, Nieto-Cerón S (2016) Cholinergic system and cell proliferation. Chem Biol Interact 259:257–265 . https://doi.org/10.1016/j.cbi.2016.04.014
Jin QH, He HY, Shi YF, Lu H, Zhang XJ (2004) Overexpression of acetylcholinesterase inhibited cell proliferation and promoted apoptosis in NRK cells. Acta Pharmacol Sin 25:1013–1021
Zhang J, Li D, Ge P, Yang M, Guo Y, Zhu KY, Ma E, Zhang J (2013) RNA interference revealed the roles of two carboxylesterase genes in insecticide detoxification in Locusta migratoria. Chemosphere 93:1207–1215 . https://doi.org/10.1016/j.chemosphere.2013.06.081
Park SE, Kim ND, Yoo YH (2004) Advances in Brief Acetylcholinesterase Plays a Pivotal Role in Apoptosome Formation. Cancer Res 64:2652–2655
Park SE, Jeong SH, Yee S, Kim H, Soung YH, Ha NC, Kim D, Park J, Bae HR, Soo B, Lee HJ, Yoo YH (2008) Interactions of acetylcholinesterase with caveolin-1 and subsequently with cytochrome c are required for apoptosome formation. 29:729–737 . https://doi.org/10.1093/carcin/bgn036
Zhang XJ, Yang L, Zhao Q, Caen JP, He HY, Jin QH, Guo LH, Alemany M, Zhang LY, Shi YF (2002) Induction of acetylcholinesterase expression during apoptosis in various cell types. Cell Death Differ 9:790–800 . https://doi.org/10.1038/sj.cdd.4401034
Du A, Xie J, Guo K, Yang L, Wan Y, OuYang Q, Zhang X, Niu X, Lu L, Wu J, Zhang X (2015) A novel role for synaptic acetylcholinesterase as an apoptotic deoxyribonuclease. Cell Discov 1: . https://doi.org/10.1038/celldisc.2015.2
Kim YH, Lee SH (2013) Which acetylcholinesterase functions as the main catalytic enzyme in the Class Insecta? Insect Biochem Mol Biol 43:47–53 . https://doi.org/10.1016/j.ibmb.2012.11.004
Hall LM, Spierer P (1986) The Ace locus of Drosophila melanogaster: structural gene for acetylcholinesterase with an unusual 5′ leader. EMBO J 5:2949–2954 . https://doi.org/10.1002/j.1460-2075.1986.tb04591.x
Lu Y, Park Y, Gao X, Zhang X, Yao J, Pang YP, Jiang H, Zhu KY (2012) Cholinergic and non-cholinergic functions of two acetylcholinesterase genes revealed by gene-silencing in Tribolium castaneum. Sci Rep 2:1–7 . https://doi.org/10.1038/srep00288
Revuelta L, Piulachs MD, Bellés X, Castañera P, Ortego F, Díaz-Ruíz JR, Hernández-Crespo P, Tenllado F (2009) RNAi of ace1 and ace2 in Blattella germanica reveals their differential contribution to acetylcholinesterase activity and sensitivity to insecticides. Insect Biochem Mol Biol 39:913–919 . https://doi.org/10.1016/j.ibmb.2009.11.001
Zhou X, Xia Y (2009) Cloning of an acetylcholinesterase gene in Locusta migratoria manilensis related to organophosphate insecticide resistance. Pestic. Biochem. Physiol. 93:77–84
Lu Y, Pang Y-P, Park Y, Gao X, Yao J, Zhang X, Zhu KY (2012) Genome organization, phylogenies, expression patterns, and three-dimensional protein models of two acetylcholinesterase genes from the red flour beetle. PLoS One 7:e32288 . https://doi.org/10.1371/journal.pone.0032288
He G, Sun Y, Li F (2012) Rna interference of two acetylcholinesterase genes in plutella xylostella reveals their different functions. Arch Insect Biochem Physiol 79:75–86 . https://doi.org/10.1002/arch.21007
Knorr DY, Georges NS, Pauls S, Heinrich R (2020) Acetylcholinesterase promotes apoptosis in insect neurons. Apoptosis 25:730–746 . https://doi.org/10.1007/s10495-020-01630-4
Ma R, Hu J, Huang C, Wang M, Xiang J, Li G (2014) JAK2/STAT5/Bcl-xL signalling is essential for erythropoietin-mediated protection against apoptosis induced in PC12 cells by the amyloid β-peptide Aβ25-35. Br J Pharmacol 171:3234–3245 . https://doi.org/10.1111/bph.12672
Samson FP, He W, Sripathi SR, Patrick AT, Madu J, Chung H, Frost MC, Jee D, Gutsaeva DR, Jahng WJ (2020) Dual Switch Mechanism of Erythropoietin as an Antiapoptotic and Pro-Angiogenic Determinant in the Retina. ACS Omega 5:21113–21126 . https://doi.org/10.1021/acsomega.0c02763
Thompson AM, Farmer K, Rowe EM, Hayley S (2020) Erythropoietin modulates striatal antioxidant signalling to reduce neurodegeneration in a toxicant model of Parkinson’s disease. Mol Cell Neurosci 109:103554 . https://doi.org/10.1016/j.mcn.2020.103554
Noguchi CT (2008) Where the Epo cells are. Blood 111:4836–4837 . https://doi.org/10.1182/blood-2008-02-135988
Brines M, Cerami A (2005) Emerging biological roles for erythropoietin in the nervous system. Nat. Rev. Neurosci. 6:484–494
Arcasoy MO (2008) The non-haematopoietic biological effects of erythropoietin. Br J Haematol 141:14–31 . https://doi.org/10.1111/j.1365-2141.2008.07014.x
Ghezzi P, Conklin D (2013) Tissue-protective cytokines: Structure and evolution. Methods Mol Biol 982:43–58 . https://doi.org/10.1007/978-1-62703-308-4_3
Yilmaz S, Ates E, Tokyol C, Pehlivan T, Erkasap S, Koken T (2004) The protective effect of erythropoietin on ischaemia/reperfusion injury of liver. HPB 6:169–173 . https://doi.org/10.1080/13651820410026077
Sepodes B, Maio R, Pinto R, Sharples E, Oliveira P, McDonald M, Yaqoob M, Thiemermann C, Mota-Filipe H (2006) Recombinant human erythropoietin protects the liver from hepatic ischemia-reperfusion injury in the rat. Transpl Int 19:919–926 . https://doi.org/10.1111/J.1432-2277.2006.00366.X
Vittori DC, Chamorro ME, Hernández Y V., Maltaneri RE, Nesse AB (2021) Erythropoietin and derivatives: Potential beneficial effects on the brain. J. Neurochem. 158:1032–1057
Boulay JL, O’Shea JJ, Paul WE (2003) Molecular phylogeny within type I cytokines and their cognate receptors. Immunity 19:159–163
Liongue C, Ward AC (2007) Evolution of Class I cytokine receptors. BMC Evol Biol 7: . https://doi.org/10.1186/1471-2148-7-120
Sirén AL, Ehrenreich H (2001) Erythropoietin - A novel concept for neuroprotection. Eur Arch Psychiatry Clin Neurosci 251:179–184 . https://doi.org/10.1007/s004060170038
Genc S, Koroglu TF, Genc K (2004) Erythropoietin and the nervous system. Brain Res 1000:19–31 . https://doi.org/10.1016/j.brainres.2003.12.037
Brines M, Grasso G, Fiordaliso F, Sfacteria A, Ghezzi P, Fratelli M, Latini R, Xie Q, Smart J, Pobre E, Diaz D, Gomez D, Hand C, Coleman T, Cerami A (2004) Erythropoietin mediates tissue protection through an erythropoietin and common b -subunit heteroreceptor. PNAS 101:
Leist M, Ghezzi P, Grasso G, Bianchi R, Villa P, Fratelli M, Savino C, Bianchi M, Nielsen J, Gerwien J, Kallunki P, Larsen AK, Helboe L, Christensen S, Pedersen LO, Sfacteria A, Erbayraktar S (2004) Derivatives of Erythropoietin That Are Tissue Protective But Not Erythropoietic. 305:239–243
Ostrowski D, Heinrich R (2018) Alternative Erythropoietin Receptors in the Nervous System. https://doi.org/10.3390/jcm7020024
Miljus N, Heibeck S, Jarrar M, Micke M, Ostrowski D, Ehrenreich H, Heinrich R (2014) Erythropoietin-mediated protection of insect brain neurons involves JAK and STAT but not PI3K transduction pathways. Neuroscience 258:218–227 . https://doi.org/10.1016/j.neuroscience.2013.11.020
Hahn N, Knorr DY, Liebig J, Wüstefeld L, Peters K, Büscher M, Bucher G, Ehrenreich H, Heinrich R (2017) The Insect Ortholog of the Human Orphan Cytokine Receptor CRLF3 Is a Neuroprotective Erythropoietin Receptor. Front Mol Neurosci 10:1–11 . https://doi.org/10.3389/fnmol.2017.00223
Heinrich R, Günther V, Miljus N (2017) Erythropoietin-Mediated Neuroprotection in Insects Suggests a Prevertebrate Evolution of Erythropoietin-Like Signaling. In: Vitamins and Hormones. Academic Press Inc., pp 181–196
Hahn N, Büschgens L, Schwedhelm-Domeyer N, Bank S, Geurten BRH, Neugebauer P, Massih B, Göpfert MC, Heinrich R (2019) The Orphan Cytokine Receptor CRLF3 Emerged With the Origin of the Nervous System and Is a Neuroprotective Erythropoietin Receptor in Locusts. Front Mol Neurosci 12: . https://doi.org/10.3389/fnmol.2019.00251
Bonnas C, Wüstefeld L, Winkler D, Kronstein-wiedemann R, Dere E, Specht K, Boxberg M, Tonn T, Ehrenreich H (2017) EV-3 , an endogenous human erythropoietin isoform with distinct functional relevance. Sci Rep 7:1–15 . https://doi.org/10.1038/s41598-017-03167-0
Sinor AD, Greenberg DA (2000) Erythropoietin protects cultured cortical neurons, but not astroglia, from hypoxia and AMPA toxicity. Neurosci Lett 290:213–215 . https://doi.org/10.1016/S0304-3940(00)01361-6
Ruscher K, Freyer D, Karsch M, Isaev N, Megow D, Sawitzki B, Priller J, Dirnagl U, Meisel A (2002) Erythropoietin is a paracrine mediator of ischemic tolerance in the brain: Evidence from an in vitro model. J Neurosci 22:10291–10301 . https://doi.org/10.1523/jneurosci.22-23-10291.2002
Weber A, Dzietko M, Berns M, Felderhoff-Mueser U, Heinemann U, Maier RF, Obladen M, Ikonomidou C, Bührer C (2005) Neuronal damage after moderate hypoxia and erythropoietin. Neurobiol Dis 20:594–600 . https://doi.org/10.1016/j.nbd.2005.04.016
Siren A-L, Fratelli M, Brines M, Goemans C, Casagrande S, Lewczuk P, Keenan S, Gleiter C, Pasquali C, Capobianco A, Mennini T, Heumann R, Cerami A, Ehrenreich H, Ghezzi P (2001) Erythropoietin prevents neuronal apoptosis after cerebral ischemia and metabolic stress. Proc Natl Acad Sci 98:4044–4049 . https://doi.org/10.1073/pnas.051606598
Chong ZZ, Kang JQ, Maiese K (2003) Erythropoietin fosters both intrinsic and extrinsic neuronal protection through modulation of microglia, Akt1, Bad, and caspase-mediated pathways. Br J Pharmacol 138:1107–1118 . https://doi.org/10.1038/sj.bjp.0705161
Weishaupt JH, Rohde G, Pölking E, Siren AL, Ehrenreich H, Bähr M (2004) Effect of erythropoietin axotomy-induced apoptosis in rat retinal ganglion cells. Investig Ophthalmol Vis Sci 45:1514–1522 . https://doi.org/10.1167/iovs.03-1039
Miller JL, Church TJ, Leonoudakis D, Lariosa-Willingham K, Frigon NL, Tettenborn CS, Spencer JR, Punnonen J (2015) Discovery and characterization of nonpeptidyl agonists of the tissue-protective erythropoietin receptors. Mol Pharmacol 88:357–367 . https://doi.org/10.1124/mol.115.098400
Ostrowski D, Ehrenreich H, Heinrich R (2011) Erythropoietin promotes survival and regeneration of insect neurons in vivo and in vitro. Neuroscience 188:95–108
Verdier F, Walrafen P, Hubert N, Chrétien S, Gisselbrecht S, Lacombe C, Mayeux P (2000) Proteasomes regulate the duration of erythropoietin receptor activation by controlling down-regulation of cell surface receptors. J Biol Chem 275:18375–18381 . https://doi.org/10.1074/jbc.275.24.18375
Cohen J, Oren-Young L, Klingmuller U, Neumann D (2004) Protein tyrosine phosphatase 1B participates in the down-regulation of erythropoietin receptor signalling. Biochem J 377:517–524 . https://doi.org/10.1042/BJ20031420
Kim A, Ulirsch J, Wilmes S, Unal E, Moraga I, Karakukuc M, Yuan D, Kazerounian S, Abdulhay N, King D, Gupta N, Gabriel S, Lander E, Patiroglu T, Ozcan A, Ozdemir M, Gracia K, Piehler J, Gazda H, Klein D, Sankaran V (2017) Functional Selectivity in Cytokine Signaling Revealed Through a Pathogenic EPO Mutation. Cell 168:1053–1064 . https://doi.org/10.1016/j.cell.2017.02.026.Functional
Knorr DY, Hartung D, Schneider K, Hintz L, Pies HS, Heinrich R (2021) Locust Hemolymph Conveys Erythropoietin-Like Cytoprotection via Activation of the Cytokine Receptor CRLF3. Front Physiol 12: . https://doi.org/10.3389/fphys.2021.648245
Knorr DY, Hartung D, Schneider K, Hintz L, Pies HS, Heinrich R (2021) Locust Hemolymph Conveys Erythropoietin-Like Cytoprotection via Activation of the Cytokine Receptor CRLF3. Front Physiol 12: . https://doi.org/10.3389/fphys.2021.648245
Ren S, H K, Girshick R, Sun J (2015) Faster R-CNN: Towards Real-Time Object Detection with Region Proposal Networks. Adv Neural Inf Process Syst. https://doi.org/10.4324/9780080519340-12
Ioffe S, Szegedy C (2015) Batch Normalization: Accelerating Deep Network Training by Reducing Internal Covariate Shift. PMLR 448–456 . https://doi.org/10.1080/17512786.2015.1058180
Visual Geometry Group - University of Oxford. https://www.robots.ox.ac.uk/~vgg/data/pets/. Accessed 1 Mar 2022
https://github.com/tensorflow/models/blob/master/research/object_detection/samples/configs/faster_rcnn_inception_v2_pets.config
Van Rossum, GDrake F (2009) Python 3 Reference Manual. In: Scotts Val. CA Creat. http://citebay.com/how-to-cite/python/. Accessed 1 Mar 2022
Harris CR, Millman KJ, van der Walt SJ, Gommers R, Virtanen P, Cournapeau D, Wieser E, Taylor J, Berg S, Smith NJ, Kern R, Picus M, Hoyer S, van Kerkwijk MH, Brett M, Haldane A, del Río JF, Wiebe M, Peterson P, Gérard-Marchant P, Sheppard K, Reddy T, Weckesser W, Abbasi H, Gohlke C, Oliphant TE (2020) Array programming with NumPy. Nature 585:357–362 . https://doi.org/10.1038/s41586-020-2649-2
McKinney W (2011) pandas: a Foundational Python Library for Data Analysis. Python high Perform Sci Comput 14:1–9 . https://doi.org/10.1002/mmce.20381
Abadi M, Agarwal A, Barham P, Brevdo E, Chen Z, Citro C, Corrado GS, Davis A, Dean J, Devin M, Ghemawat S, Goodfellow I, Harp A, Irving G, Isard M, Jia Y, Jozefowicz R, Kaiser L, Kudlur M, Levenberg J, Mane D, Monga R, Moore S, Murray D, Olah C, Schuster M, Shlens J, Steiner B, Sutskever I, Talwar K, Tucker P, Vanhoucke V, Vasudevan V, Viegas F, Vinyals O, Warden P, Wattenberg M, Wicke M, Yu Y, Zheng X (2016) TensorFlow: Large-Scale Machine Learning on Heterogeneous Distributed Systems
Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Res 2001 29:2003–2007 . https://doi.org/10.1111/j.1365-2966.2012.21196.x
Mangiafico SS (2019) Package ‘ rcompanion ’
Zeileis A, Hornik K, Wiel MA, Hothorn T (2008) Implementing a class of permutation tests: The coin package. J Stat Softw 28:
Gilboa-Geffen A, Lacoste PP, Soreq L, Cizeron-clairac G, Panse R Le, Truffault F, Shaked I, Soreq H, Berrih-aknin S (2007) The thymic theme of acetylcholinesterase splice variants in myasthenia gravis. Blood 109:4383–4392 . https://doi.org/10.1182/blood-2006-07-033373.The
Abdel-Aal R, Hussein O, Elsaady R, Abdelzaher L (2021) Celecoxib effect on rivastigmine anti-Alzheimer activity against aluminum chloride-induced neurobehavioral deficits as a rat model of Alzheimer’s disease; novel perspectives for an old drug. J Med Life Sci 0:44–82 . https://doi.org/10.21608/jmals.2021.210630
Meshorer E, Toiber D, Zurel D, Sahly I, Dori A, Cagnano E, Schreiber L, Grisaru D, Tronche F, Soreq H (2004) Combinatorial complexity of 5′ alternative acetylcholinesterase transcripts and protein products. J Biol Chem 279:29740–29751 . https://doi.org/10.1074/jbc.M402752200
Kim YH, Kwon DH, Ahn HM, Koh YH, Lee SH (2014) Induction of soluble AChE expression via alternative splicing by chemical stress in Drosophila melanogaster. Insect Biochem Mol Biol 48:75–82 . https://doi.org/10.1016/j.ibmb.2014.03.001
Xie J, Jiang H, Wan YH, Du AY, Guo KJ, Liu T, Ye WY, Niu X, Wu J, Dong XQ, Zhang XJ (2011) Induction of a 55 kDa acetylcholinesterase protein during apoptosis and its negative regulation by the Akt pathway. J Mol Cell Biol 3:250–259 . https://doi.org/10.1093/jmcb/mjq047
Miljus N, Massih B, Weis M, Rison V, Bonnas C, Sillaber I, Ehrenreich H, Geurten B, Heinrich R (2017) Neuroprotection and endocytosis: erythropoietin receptors in insect nervous systems. J Neurochem 141:63–74 . https://doi.org/10.1111/jnc.13967
Beschin A, Bilej M, Torreele E, De Baetselier P (2001) On the existence of cytokines in invertebrates. Cell Mol Life Sci 58:801–814 . https://doi.org/10.1007/PL00000901
Xu ML, Luk WKW, Bi CWC, Liu EYL, Wu KQY, Yao P, Dong TTX, Tsim KWK (2018) Erythropoietin regulates the expression of dimeric form of acetylcholinesterase during differentiation of erythroblast. J Neurochem 146:390–402 . https://doi.org/10.1111/jnc.14448
Rogers HM, Yu X, Wen J, Smith R, Fibach E, Noguchi CT (2008) Hypoxia alters progression of the erythroid program. Exp Hematol 36: . https://doi.org/10.1016/j.exphem.2007.08.014
Ogilvie M, Yu X, Nicolas-Metral V, Pulido SM, Liu C, Ruegg UT, Noguchi CT (2000) Erythropoietin stimulates proliferation and interferes with differentiation of myoblasts. J Biol Chem 275:39754–39761 . https://doi.org/10.1074/jbc.M004999200
Jun JH, Shin EJ, Kim JH, Kim SO, Shim JK, Kwak YL (2013) Erythropoietin prevents hypoxia-induced GATA-4 ubiquitination via phosphorylation of serine 105 of GATA-4. Biol Pharm Bull 36:1126–1133 . https://doi.org/10.1248/bpb.b13-00100
Obara N, Suzuki N, Kim K, Nagasawa T, Imagawa S, Yamamoto M (2008) Repression via the GATA box is essential for tissue-specific erythropoietin gene expression. Blood 111:5223–5232 . https://doi.org/10.1182/blood-2007-10-115857
Zhao W, Kitidis C, Fleming MD, Lodish HF, Ghaffari S (2006) Erythropoietin stimulates phosphorylation and activation of GATA-1 via the PI3-kinase/AKT signaling pathway. Blood 107:907–915 . https://doi.org/10.1182/blood-2005-06-2516
Uvell H, Engström Y (2007) A multilayered defense against infection: combinatorial control of insect immune genes. Trends Genet 23:342–349 . https://doi.org/10.1016/j.tig.2007.05.003

Dataavailability.xlsx

Download PDF

Version 1

posted

You are reading this latest preprint version

Protection of insect neurons by erythropoietin/CRLF3-mediated regulation of pro-apoptotic acetylcholinesterase

Status:

Version 1

Abstract

Figures

Introduction

Methods

Insect primary brain cell culture

Pharmacological treatment and hypoxia exposure of primary cell cultures

Dapi staining and analysis of cell survival

dsRNA cloning and preparation

RNA isolation and cDNA synthesis

Ace splice variant analysis

Statistical analysis and data plotting

Results

Discussion

Declarations

References

Supplementary Files

Status:

Version 1