Short-hairpin RNA-mediated suppression of cortactin may inhibit the migration and invasion abilities of endometrial cancer cells by reducing lamellipodia

doi:10.21203/rs.3.rs-1438332/v1

Background

Endometrial cancer (EC) is one of the most common gynecological tumors. The prognosis of EC is seriously affected by the degree of tissue infiltration and distant metastasis by tumor cells. Approximately 15–20% of patients are at high risk of distant metastasis, which carries a poor prognosis. Lamellipodia are related to the invasion and migration of tumor cells, and cortactin (CTTN) can regulate the formation of lamellipodia.

Methods

Quantitative PCR (qPCR) and immunohistochemical staining (IHC) were used to detect the mRNA and protein of Ras-associated C3 botulinum toxin substrate 1 (Rac1) and CTTN in type I endometrial cancer tissues and normal endometrial tissues. The relationship between the expression of the two genes and the prognostic factors was analyzed. The expression of CTTN in four endometrial cancer cell lines (Ishikawa, AN3CA, HEC-1-A, and HEC-1-B) was detected by quantitative PCR, and the two cell lines with the highest expression levels (HEC-1-A and HEC-1-B) were selected for follow-up study. A CTTN-RNA interference lentiviral system was constructed and transfected into HEC-1-A and HEC-1-B cells. The migration and invasion abilities of the cells in each group were evaluated by scratch assay and transwell migration and invasion assays. Pseudopodia formation was observed using immunofluorescence staining. Western blot was used to detect Rac1 protein expression.

Results

The mRNA and protein expression of Rac1 and CTTN in EC group were significantly higher than those in normal endometrial group (P < 0.05). In EC group, there was correlation between the mRNA and protein expression of Rac1 and CTTN. The protein expression of Rac1 was related to lymph-vascular space invasion (LVSI), myometrial invasion and FIGO stage (P < 0.05), but was not related to pelvic lymph node invasion or histologic grade (P > 0.05). The protein expression of CTTN was related to myometrial invasion and FIGO stage (P < 0.05), but was not related to pelvic lymph node invasion, LVSI or histologic grade (P > 0.05). After CTTN knockdown, the migration rate, invasion ability, and migration ability of HEC-1-A and HEC-1-B cells decreased significantly. A decrease in the number of lamellipodia, accompanied by a compensatory increase in the number of blebs, was also observed. Rac1 protein expression also decreased after CTTN knockdown.

Conclusion

CTTN may promote the invasion and migration abilities of EC by increasing the number of lamellipodia. This effect may be related to the regulation of Rac1 by CTTN.

Endometrial cancer (EC)

cortactin (CTTN)

Ras-related C3 botulinum toxin substrate 1 (Rac1)

migration

lamellipodia.

Endometrial cancer (EC) is a malignant tumor which originates in the endometrium [1]. EC is already one of the most common gynecological tumors in developed countries [2]. Compared with other malignant tumors, and its incidence is increasing year by year.From 1987 to 2014 there has been a 75% increase in cases [3]. Although most patients with EC are diagnosed at an early stage and have a good prognosis, 15–20% of patients are at high risk of distant metastasis, which carries a poor prognosis [4]. The tissue infiltration ability of EC also seriously affects the prognosis of patients [5]. Therefore, exploring the invasion and migration mechanisms of EC cells is of great significance to improving the prognosis of patients with this disease.

The cortical actin-binding protein (cortactin) is encoded by the CTTN gene in chromosome region 11q13, with a full length of 45079 bp. CTTN is mainly located in the cell cortex [6]. The cell cortex is defined as a plasma membrane-associated part of the actin cytoskeleton, which is considered to be primarily responsible for cell mechanics [7]. CTTN binds to the Arp2/3 complex to regulate the F-actin network, which in turn regulates actin-based structures, such as lamellipodia. Cortactin accumulates in actin-rich lamellipodia and forms membrane folds at the front of cell migration [8], which is necessary for the formation of lamellipodia and other cellular structures. CTTN also participates in cell invasion and migration [9], and it is frequently amplified in cells with high invasiveness and metastatic potential, such as oral cancer [10], ovarian epithelial cancer [11], and thyroid cancer [12] cells. It has been found to be associated with late tumor stages and lymph node metastasis [10–12]. However, there have been few studies of CTTN in EC.

Ras-associated C3 botulinum toxin substrate 1 (Rac1), which is located on human chromosome 7p22, has a total length of 29 kb and contains seven exons. As a key member of the Rho family, Rac1 is an important signaling molecule that regulates cell adhesion and motility. It is highly expressed in gastric cancer, colon cancer, breast cancer, and other malignant tumors [13–15]. Under the stimulation of platelet-derived growth factor (PDGF), Rac1 initiates lamellipodia formation [16–17]. By participating in the regulation of Rac1, CTTN induces epithelial–mesenchymal transition (EMT) [18]. Further, Rac1 activation can activate CTTN tyrosine phosphorylation and participate in cytoskeleton remodeling [19]. We therefore speculate that Rac1 combined with CTTN may affect the invasion and migration abilities of tumor cells by altering the cytoskeleton. To our knowledge, there have been no studies on CTTN in EC to date, and the mechanism of how Rac1 regulates the effects of CTTN on the invasion and migration of EC is unclear.

In this study, the mRNA and protein expression of Rac1 and CTTN in tissues were firstly detected. Next, quantitative PCR (qPCR) was used to detect the mRNA content of CTTN in four endometrial cancer cell lines: Ishikawa, AN3CA, HEC-1-A, and HEC-1-B. The HEC-1A and HEC-1B cell lines, which had the highest expression of the CTTN gene, were selected for further study. After knocdown of CTTN expression by CTTN RNA interference (RNAi), changes in tumor cell invasion and migration abilities, pseudopodia, and Rac1 protein expression were observed, and the invasion and migration mechanisms of EC cells were considered.

Materials

Human EC cell lines (Ishikawa, AN3CA, HEC-1-A, and HEC-1-B) were obtained from the National Collection of Authenticated Cell Cultures (Shanghai, China). CTTN-RNAi, HitransG A, and short-hairpin RNAi (shRNAi) were purchased from Genechem Biotech Co. Ltd (Shanghai, China). TRIzol reagent (3101-100) was bought from Pufei Biotechnology Co. Ltd (Shanghai, China). M-MLV Reverse Transcriptase (M 1705) was bought from Promega (Madison, USA). Mouse monoclonal anti-Rac1 antibody (ab33186), rabbit monoclonal anti-Cortactin antibody (ab81208) and primary antibody-like anti-F-actin (ab130935) were obtained from Abcam (Cambridge, MA, USA) and primary antibody anti-Rac1 (bs-4186R) was purchased from Biosynthesis Biotechnology Co. Ltd (Beijing, China). Secondary antibody goat anti-mouse (A-21424) and McCoy’s 5A medium (16600-082) were purchased from ThermoFisher Scientific (Massachusetts, USA), and secondary antibody HRP-goat anti-rabbit (AS1107) was purchased from ASPEN Biotechnology Co. Ltd (Wuhan, China). Transwell Permeable supports(353097), Corning BioCoat cell culture inserts (354480), Dulbecco’s Modified Eagle Medium (DMEM) (10-013-CVa), and Minimal Essential Medium (MEM) (10-010-CV) were purchased from Corning (NY, USA). Fetal bovine serum (FBS) (VS500T) was bought from Bovogen (Victoria, Australia). A real-time PCR instrument (LightCycler 480 II) (Roche, Basel, Switzerland) and a confocal quantitative image cytometer (CQ1) (Yokogawa, Tokyo, Japan) were used. Tris-EDTA antigen retrieval solution (PR30002) was bought from Proteintech (Rosemont, USA). Polymer Detection system for immuohistological stainning (PV-9000) and DAB kit (ZLI-901) were bought from ZSGB-Bio (Beijing, China).

Patient samples

Endometrial tissues were obtained from The First Affiliated Hospital of Guangxi Medical University (Nanning, China) between June 2019 and December 2020 containing 47 patients of EC (EC group) and 45 patients of normal endometrium (NE group). All of the patients didn’t receive any hormone therapy, chemotherapy or radiotherapy before surgery. All tissues were taken from hysterectomy specimens. The surgical indications of patients in NE group were leiomyoma and uterine prolapse. EC staging was assessed based on the International Federation of Gynecology and Obstetrics (FIGO) system [20]. All patients signed informed consent, and the study was approved by the Ethics Committee of First Affiliated Hospital of Guangxi Medical University. The ethics number is 2021 (KY-E-309).

Methods

Quantitative PCR

Total RNA was extracted using Trizol Reagent. A Moloney murine leukemia virus (M-MLV) kit was used for reverse transcription to obtain single-stranded complementary DNA (cDNA). PCR was then performed with the cDNA serving as the template. The primer sequences of CTTN-1 and CTTN-2 were both designed according to the gene CTTN (NM_005231). The CTTN-1 was applied to the experiment in vitro and CTTN-2 was used in clinical tissues (Table 1). For the two-step real-time PCR, PCR conditions used were 95 ℃ for 30 seconds, followed by 40 cycles of 95 ℃ for 5 seconds, and 60 ℃ for 30 seconds, and a dissociation program of 95 ℃ for 15 seconds, 60 ℃ for 30 seconds and 95 ℃ for 15 seconds. The gene expression levels were calculated using the 2−ΔΔCT method. The experiment was performed three times.

Table 1. PCR primers and sequences

Gene

Primer sequence (5’à 3’)

f-hRac1

r-hRac1

f-hCTTN-1

r-hCTTN-1

f-hCTTN-2

r-hCTTN-2

f-hACTB

r-hACTB

ATGTCCGTGCAAAGTGGTATC

CTCGGATCGCTTCGTCAAACA

CTACGATGAGTACGAGAACG

ATGATGTCATCAGGGTCAA

AGACCGACCCTGATTTTGTGA

GTGCTTGGAAAGTTTCGACTGA

GCGTGACATTAAGGAGAAGC

CCACGTCACACTTCATGATGG

CTTN (cortactin), ACTB (actin beta). The ACTB gene was selected as the internal reference gene.

Immunohistochemical staining (IHC)

The specimens were fixed with 10% formalin and embedded in paraffin. The experiments were performed using Polymer Detection system for IHC according to the manufacturer’s instructions. The mouse monoclonal anti-Rac1 antibody (1:200, ab33186) and rabbit monoclonal anti-Cortactin antibody (1:200) were added to the sections. Positive staining percentage was graded as follows: 0, no positive cells, 1, 25% or fewer positive cells, 2, 26% to 50% positive cells, 3, 51% to 75% positive cells, and 4, 76% or more positive cells. Intensity of staining was graded as follows: 0, no intensity, 1, weak intensity, 2, moderate intensity, and 3, strong intensity [21]. The total score was equal to the product of two scores. The total score less than 6 was low expression, and the total score greater than or equal to 6 was regarded as high expression.

Construction of a lentiviral system

The complete CTTN gene sequence (NM_005231) was obtained from the GeneBank database. Then, using the Invitrogen BLOCK-iT RNAi Designer (Invitrogen, Carlsbad, CA, USA), shRNA interference target sequences were identified. Using the basic local alignment search tool (BLAST) for comparison with the genome database, homologous coding sequences were ruled out to eventually determine three shRNA interference target sequences, as follows:

CTTN-KD1 (5'-cgGCAAATACGGTATCGACAA-3'),

CTTN-KD2 (5'-gaAAGACTACTCCAGTGGTTT-3'), and

CTTN-KD3 (5'-caCGAATATCAGTCGAAACTT-3').

The plasmids were synthesized by Shanghai Genechem Biotech Co. Ltd (Shanghai, China).

Cell transfection and grouping

HEC-1-A and HEC-1-B cells were passaged, inoculated into 6-well plates at 2 × 10⁵ cells/well, and cultured for 2 days. Each cell line was divided into experimental groups (the KD1, KD2, and KD3 groups) and a control group (the CON group). The KD1, KD2, and KD3 groups were transduced with CTTN-KD1, CTTN-KD2, and CTTN-KD3 lentiviral vector plasmids, respectively, and the CON groups were transduced with an empty vector (lentiviral vector without siRNA), for 24 hours in 40 uL 1X HitransG A. The cells were then incubated with McCoy’s 5A medium (HEC-1-A) or MEM (HEC-1-B), both containing 10% FBS, for 72 hours. The relative mRNA expression of CTTN was assessed by Quantitative PCR to determine the transfection efficiency in EC cells, and cells were subjected to cell migration, invasion, scratch assays，immunofluorescence staining and Western blot analysis.

Transwell migration and invasion assay

For the cell migration assay, serum-starved transduced cells (HEC-1-A 2×10⁵ cells/ well, HEC-1-B 1×10⁵ cells/well) were suspended and added to the upper chambers of 24-well Transwell plates with 8.0-μm pores. Full-serum medium containing 10% FBS was then added into the lower chambers as a chemoattractant. After incubation at 37 °C with 5% CO₂ for 24 hours, cells that had attached to the lower surface of the membrane were fixed with methanol and stained with 0.1% crystal violet. The migratory cells were then observed under a microscope (magnification ×200, XDS-100, Shanghai Caikon Optical Instrument Co. Ltd, Shanghai, China), and the number of invading cells in nine randomly selected fields was counted and averaged. The cell invasion assay was performed in the same way as the cell migration assay, except that the upper chambers of the 24-well Transwell plates were precoated with Matrigel membrane (Corning, USA).

Scratch assays

After 72 hours of transfection, cells in each group were cultured to the logarithmic growth phase, and the cell density was adjusted to 1×10⁶cells/ml in a 96-well plate until the cells reached more than 90% confluence. The cells were inoculated into a marked 96-well plate. After they had adhered to the wall and were growing, the cells with good growth and uniform density were taken for a scratch assay. To perform the scratch assay, a scratch instrument was aimed at the center of the upper end of the 96-well plate and gently pushed upward to form scratches. Residual cells in the scratch area were washed away using phosphate-buffered saline (PBS). After culture, cell migration was detected using a Celigo scanning plate at 0 hours and 48 hours (for HEC-1-A cells) and at 0 hours and 24 hours (for HEC-1-B cells) after scratching. The cell areas at the detection times were analyzed, and cell mobility was calculated. The migration area was calculated as the cell area at 24 hours/48 hours minus the cell area at 0 hours. Mobility was calculated as the migration area/1-cell area at 0 hours. Each group was provided with three compound holes.

Western blot

After 72 hours of transfection,, the total proteins of cells in each group were extracted, and sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) was performed. After transmembrane transfer, skimmed milk powder was added to the cells for 1 hour of blocking. The first antibody (rabbit anti-human Rac1 antibody, 1:500,bs-4186R) was then added for incubation overnight, following which the secondary antibody (1:10000) was added for 1-hour incubation, with β-actin serving as the internal control. The band intensity was quantified with ImageJ software. The target protein level was expressed as the gray value of target protein band/β-actin band. The experiment was repeated three times.

Immunofluorescence staining

After transfection, HEC-1-A and HEC-1-B cells were cultured to the logarithmic phase, and a 1×10⁴ single-cell suspension was prepared and inoculated into a 96-well glass-bottom plate (a special laser confocal culture plate). The plate was then placed in an incubator until the cells formed a monolayer. After being rinsed twice with PBS, the cells were fixed with 4% paraformaldehyde for 10 minutes and then rinsed again with PBS for 5 minutes. Permeabilization was performed using 0.2% Triton for 5 minutes, after which the cells were rinsed twice with PBS, for 5 minutes each time. A blocking solution (PBS containing 5% BSA and 10% sheep serum) was added, and the plate was placed in a wet box at room temperature for 30 minutes. F-actin antibody (1:200) was added, and the plate was refrigerated at 4 °C overnight before being rinsed three times in PBS, for 5 minutes each time. Fluorescein isothiocyanate (FITC)-labeled goat anti-mouse fluorescent IgG secondary antibody (1:400) was added, and the plate was incubated in the dark at 37 °C for 45 minutes. The secondary antibody was discarded, and the cells were rinsed three times with PBS, for 5 minutes each time, and then once with distilled water. The cells were then incubated with DAPI (4’,6-diamidino-2-phenylindole) at room temperature for 10 to 15 minutes, before being rinsed twice with PBS, for 5 minutes each time. Finally, 100 µl PBS was added to each well for preservation and observation.

Laser confocal microscopy

A quantitative image cytometer (CQ1, Yokogawa, Japan) was used to obtain the best tomographic images of cells with excitation filter wavelengths of 405 nm, 488 nm, and 561 nm. Each of the four quadrants of the culture dish was observed, and the cell morphology was recorded.

Statistical analysis

The software SPSS 22.0 (IBM, USA) was used for statistical analysis. A t-test was used for measurement data. A one-way analysis of variance (ANOVA) method was used for counting data. Correlation analysis was performed by the Pearson or Spearman correlation analysis method. A P-value < 0.05 was considered statistically significant.

Clinical baseline characteristics of EC group and NE group

Table 2 shows the clinical baseline parameters. The average age of patients in EC group was 55.85 ± 8.58 years old, and that in NE group was 53.24 ± 8.32 years old (P = 0.143). There were no differences in menopausal age (P = 0.135), menopause (P = 0.097), gravidity (P = 0.170), parity (P = 0.281), systolic pressure (P = 0.253), diastolic pressure (P = 0.348) and BMI (P = 0.321) between the two groups. The results showed that the two groups were comparable.

Table 2 The basic characteristics of the clinical parameters

Variables	EC group (n=47)	NE group (n=45)	t/χ²	P
Age (years)	55.85±8.58	53.24±8.32	1.478	0.143
Gravidity			3.667	0.170
0	2（4%）	6（13%）
1	5（11%）	8（18%）
≥2	40（85%）	31（69%）
Parity			1.162	0.281
0	3（6%）	7（16%）
≥1	44（94%）	38（84%）
Menopausal age (years)	14.45±2.03	13.91±1.31	1.51	0.135
Menopause			2.755	0.097
no	17（36%）	24（53%）
yes	30（64%）	21（47%）
BMI（kg/m²）	24.98±5.78	24.01±3.05	0.998	0.321
Blood pressure (mmHg)
Systolic pressure	130.38±15.15	126.71±15.43	1.151	0.253
Diastolic pressure	77.26±7.65	79.13±11.06	-0.944	0.348

To investigate the role of Rac1 and CTTN in tumorigenesis and progression of EC, we evaluated their mRNA and protein expression in normal endometrium and type I EC using qPCR and IHC. The relative mRNA expressions of Rac1 and CTTN in the EC group were higher than those in the NE group (Fig. 1A, 1B). In the NE group, 13 cases with high expression of Rac1 protein were less than 32 cases with low expression of Rac1 protein (28.89% vs 71.11%), while in the EC group, 24 cases with high expression of Rac1 protein were slightly higher than 23 cases with low expression (51.06% vs 48.94%, P < 0.05, Fig 1D). In the NE group, 12 cases with high expression of CTTN protein were less than 33 cases with low expression (26.67% vs 73.33%), while in the EC group, 23 cases with high expression of CTTN were slightly lower than 24 cases with low expression (48.94% vs 51.06%, P < 0.05, Fig 1E). There was a positive correlation between the mRNA expression of Rac1 and CTTN in EC group (r=0.446, P=0.002, Fig 1C). Similarly, there was a positive correlation between the protein expression of Rac1 and CTTN in EC group (r=0.492, P＜0.001, Fig 1F). The IHC showed Rac1 protein was localized at cell membrane (Fig.1G), and CTTN protein was localized at cytoplasm (Fig.1H).

We further analyzed the relationship between the expression of Rac1 and CTTN protein and the clinicopathological features of EC. Between the high and low expression groups of Rac1 protein, there were differences in LVSI (P=0.008), depth of myometrial invasion (P=0.020) and FIGO stage (P=0.003). In the group with high expression of CTTN protein, there were differences in the depth of myometrial invasion (P=0.013) and FIGO stage (P=0.001). In the high expression gourps of Rac1 and CTTN protein, there were more patients with myometrial invasion >1/2 and patients with FIGO stage III-IV. In the group with high expression of Rac1 protein, there were more LVSI positive patients (Table 3).

Table 3 The pathological parameters of EC in high and low expression groups of Rac1 and CTTN protein expression

Pathological parameters	n	Rac1 expession		P	CTTN expression		P
Pathological parameters	n	High达	Low	P	High	Low	P
Pelvic lymph node invation
Positive	6	5	1	0.209	4	2	0.622
Negative	41	19	22	0.209	19	22	0.622
LVSI
Positive	8	8	0	0.008	6	2	0.218
Negative	39	16	23	0.008	17	22	0.218
Depth of myometrial invasion
＜1/2	36	15	21	0.020	14	22	0.013
≥1/2	11	9	2	0.020	9	2	0.013
FIGO stage
I-II	36	14	22	0.003	13	23	0.001
III-IV	11	10	1	0.003	10	1	0.001
Histologic grade
1	21	11	10	0.871	8	13	0.181
2-3	26	13	13	0.871	15	11	0.181

Rac1, Ras-related C3 botulinum toxin substrate 1, CTTN, Cortactin, FIGO, International federation of gynecology and obstetrics, LVSI, lymph-vascular space invasion.

Expression of CTTN mRNA in the four EC cell lines

To screen the EC cell lines with high CTTN expression, we detected the mRNA expression of CTTN in the Ishikawa, AN3CA, HEC-1-B, and HEC-1-A cell lines. There was a high expression of CTTN in Ishikawa, AN3CA, HEC-1-B, and HEC-1-A cells (Fig. 2A). CTTN gene expression was higher in the HEC-1-B and HEC-1-A cell lines (6.36±0.117 and 6.44±0.083, respectively) than in the Ishikawa (7.05±0.185) and AN3CA (7.89±0.356) cell lines (Fig. 2B). Therefore, HEC-1-A and HEC-1-B cells were selected for follow-up study.

Effects of RNAi on CTTN gene expression in HEC-1-A and HEC-1-B cells

Compared with that in the CON group (1.003±0.103), CTTN gene expression in HEC-1-A cells was significantly decreased after knockdown using three different CTTN-RNAi lentiviral systems (P < 0.001, Fig. 3A). The expression of CTTN mRNA in the KD1, KD2, and KD3 groups was 0.212±0.043, 0.330±0.021, and 0.131±0.014, respectively. The CTTN gene knockdown efficiency in the KD1, KD2, and KD3 groups was 78.8%, 67%, and 86.9%, respectively. The knockdown efficiency was higher in the KD1 and KD3 groups than in the KD2 group, therefore, the KD1 and KD3 groups were selected for follow-up study.

Compared with that in the CON group (1.000±0.036), CTTN gene expression in HEC-1-B cells decreased significantly after knockdown (P < 0.001, Fig. 3B). The expression of CTTN mRNA in the KD1, KD2, and KD3 groups was 0.258±0.022, 0.405±0.026, and 0.246±0.023, respectively. The CTTN gene knockdown efficiency in the KD1, KD2, and KD3 groups was 74.2%, 59.5%, and 75.4%, respectively. The knockdown efficiency was higher in the KD1 and KD3 groups than in the KD2 group, therefore, the KD1 and KD3 groups were selected for follow-up study.

Effects of CTTN knockdown on the migration ability of HEC-1-A and HEC-1-B cells

The migration rate of HEC-1-A cells was 38.72±12.87% in the KD1 group and 38.75±14.60% in the KD3 group, compared with 66.86±4.83% in the CON group (Fig. 4B). The migration rates of HEC-1-B cells in the KD1 group and the KD3 group were 9.40±5.05% and 7.11±3.74%, respectively, compared with 39.47±7.76% in the CON group (P < 0.001, Fig. 4D).

After CTTN-RNAi transfection, the number of HEC-1-A cells that had migrated through the membrane was 72±2.90 in the CON group, compared with 44±0.62 in the KD1 group (P < 0.0001) and 25±1.20 in the KD3 group (P < 0.0001, Fig. 5B). The number of HEC-1-B cells that had migrated through the membrane was 71±2.27 in the CON group, compared with 65±2.07 in the KD1 group (P = 0.010) and 63±2.09 in the KD3 group (P = 0.002, Fig. 5D). For both cell lines, the numbers of migrating cells were significantly decreased in the KD1 and KD3 groups compared with the CON groups.

The effects of CTTN knockdown on the invasion ability of HEC-1-A and HEC-1-B cells

After CTTN-RNAi transfection, the number of HEC-1-A cells invading the membrane was 30±2.58 in the CON group, compared with 8±1.25 in the KD1 group (P < 0.0001) and 5±0.88 in the KD3 group (P < 0.0001, Fig. 6B). The number of HEC-1-B cells invading the membrane was 30±0.67 in the CON group, compared with 26 ±0.36 in the KD1 group (P < 0.001) and 22 ±1.09 in the KD3 group (P < 0.0001, Fig. 6D). For both cell lines, the numbers of invasive cells were significantly decreased in the KD1 and KD3 groups compared with the CON groups.

Effects of CTTN knockdown on pseudopodia in HEC-1-A and HEC-1-B cells

After CTTN knockdown, observation of HEC-1-A and HEC-1-B cells under the confocal laser scanning microscope showed that the number of blebs was increased, while the number of lamellipodia was decreased (Fig. 7A ,7B). After transfection of CTTN-RNAi into HEC-1-A and HEC-1-B cells, the pseudopodia were observed using F-actin staining and the confocal laser microscope. At the edge of the cell membrane, the blebs were blister-like, and the lamellipodia were broad and flaky. In both cell lines after knockdown, there were higher numbers of blebs in the KD1 and KD3 groups than in the CON groups, whereas the numbers of lamellipodia showed the opposite result.

Effects of CTTN knockdown on Rac1 protein expression in HEC-1-A and HEC-1-B cells

After CTTN knockdown in HEC-1-A cells, the band density of Rac1 protein was lower in the KD1 (0.086) and KD3 (0.096) groups than in the CON group (0.116) (Fig. 8A). Similarly, in HEC-1-B cells, the band density of Rac1 protein in the KD1 (0.075) and KD3 (0.029) groups was lower than that in the CON group (0.093) following CTTN knockdown (Fig.8B). Compared with the CON groups in both cell lines, the expression of Rac1 protein decreased after CTTN knockdown.

Rac1 and CTTN were considered to play a major role in promoting epithelial tumor metastasis, and the activation of the two genes were reported in ovarian, breast and colon cancer [11, 14, 15]. First, through the detection of clinical tissues, we found that the high expression of Rac1 and CTTN was related to the poor prognosis of EC. Our preliminary conclusion was similar to those of the above studies. Therefore, we further explore the mechanism in vitro.

CTTN is involved in the invasion and metastasis of tumor cells [18]. It is transferred from the perinuclear cytoplasm to the cell periphery, where it first activates Rac1 and Cdc42 [22] and then the downstream F-actin nucleation-promoting factor, before finally activating the Arp2/3 complex [23, 24]. CTTN can also directly bind to the Arp2/3 complex to stimulate actin nucleation, resulting in dynamic changes in the cytoskeleton and promoting the formation of lamellipodia, which are involved in cellular movement [18, 25, 26]. Our study found that the invasion and migration abilities of EC cells decreased significantly after CTTN knockdown, which suggests that CTTN may be involved in cell invasion and migration in EC.

The plasma membrane extends forward at the front edge of the cell to initiate cell movement [27]. There are four different protuberances involved in the process of plasma membrane extension: lamellipodia, filopodia, invadopodia, and blebs [28, 29]. Pseudopodia includes lamellipodia, filopodia, invadopodia, and it is the main executors of tumor cell movement [30], and their number is related to the migration ability of malignant tumor cells [31]. Increased AMP-activated protein kinase (AMPK) activity and downregulation of the Jun N-terminal kinase (JNK) pathway can reduce the formation of lamellipodia and cell migration ability [9, 32].

Lamellipodia are mainly responsible for cell invasion and long-distance migration [33, 34]. The microfilament is the main part of pseudopodia, which is assembled by the actin monomer G-actin. The fiber bundle formed, a double-stranded helix called F-actin, is implicated in the dynamic change of polymerization and depolymerization which can drive pseudopodia extension and movement [35, 36]. Blebs were first described in 1919 as transparent cellular blebbing [37] of 2 µm to 15 µm in diameter. They were later described as smooth circular extensions of the plasma membrane, which contract from the cytoplasm to the initial position [38]. Blebs promote directional cell migration during development [39]. Vesicle-based migration can also be observed in cancer cells [40]. High cell tension is beneficial to the growth of blebs, while activation of Arp2/3 reduces tension and facilitates lamellipodia formation [41]. Therefore, lamellipodia formation can be blocked by inhibiting the function of wave regulatory complex (WRC) or the Arp2/3 complex, which can, in turn, promote bleb formation [42–43]. The ability of cancer cells to switch between different migration modes enables their adaptation to different environments, which helps to maintain their high invasiveness [44]. In this study, immunofluorescence staining revealed that the number of lamellipodia decreased, the number of membrane vesicles increased, and cell migration and invasion abilities decreased after CTTN knockdown, which was consistent with the findings of a previous studies [44]. Our results suggest that CTTN may affect the migration and invasion abilities of EC cells by regulating lamellipodia. However, the mechanism through which CTTN regulates the movement of EC cells needs to be further explored.

Rac1 is the node at which multiple signaling pathways, such as tumor proliferation, invasion, and movement, converge [45]. The activation of Rac1 increases the tumor invasiveness [46]. Rac1 has been found to regulate lamellipodia formation [47] and the migration and invasion of tumor cells [48]. The migration and invasion inhibitory protein (MIIP) can block the Rac1 signal transduction pathway and inhibit the migration of EC cells by directly binding to the downstream effector molecule PAK1 [49]. PAK1 controls the cytoskeleton, especially lamellipodia formation, primarily by regulating the structure of polymeric actin [50]. In the present study, we found that the expression of Rac1 decreased after CTTN knockdown, which suggested that CTTN might affect the expression of Rac1. The deletion of CTTN has been found to reduce Rac1 activity, while transfection of cells with active Rac1 can save the phenotype, which indicates that CTTN may be a branch sensor which activates Rac1 [51]. More interestingly, some studies have found that CTTN is the downstream effector of the Rac1 pathway [52, 53]. Therefore, some researchers have proposed that Rac1 and CTTN form a positive and negative feedback network [54]. We found that the expression of the Rac1 protein decreased in the experimental groups after CTTN knockdown. Therefore, CTTN may affect cell movement by regulating Rac1. However, the specific regulatory mechanism needs to be explored through further experiments.

To sum up, this study found that CTTN can improve the invasion and migration abilities of EC cells by increasing the number of lamellipodia. This phenomenon may be related to the regulation of Rac1 by CTTN, but the specific regulation mechanism needs further study.

Authors’ contributions

Dan Sun designed and administered the experiments and edited the manuscript. Lihong Pang supervised data analysis and edited the manuscript. Huisi Lin performed the experiments, analyzed and interpreted the data, and wrote the manuscript. Yujuan Fan provided technical support, and designed and analyzed the experiments. Zhifu Zhi handled the picture and article format. All authors contributed exhaustively to the realization of this study.

Funding

This study was supported by the Natural Science Foundation of Guangxi Province (2020JJB140152), the Scientific Research Project of the Guangxi Health Commission (Z20200232 and Z2016726), the National Natural Science Foundation of China (81960281), the Special Fund of Characteristic Innovation Team of the First Affiliated Hospital of Guangxi Medical University (YYZS202008), and the Construction of Clinical Intervention Protocols Guangxi Key R&D Program (Guike AB20159031).

Conflicts of Interest

The authors have no conflicts of interest to declare.

Urick ME, Bell DW. Clinical actionability of molecular targets in endometrial cancer. Nat Rev Cancer. 2019 Sep,19(9):510-21.
Jonusiene V, Sasnauskiene A. Notch and Endometrial Cancer. Adv Exp Med Biol. 2021,1287:47-57.
Hamilton CA, Pothuri B, Arend RC, et al. Endometrial cancer: A society of gynecologic oncology evidence-based review and recommendations. Gynecol Oncol. 2021 Mar,160(3):817-26.
Colombo N, Creutzberg C, Amant F, et al. ESMO-ESGO-ESTRO Consensus Conference on Endometrial Cancer: Diagnosis, Treatment and Follow-up. Int J Gynecol Cancer. 2016 Jan,26(1):2-30.
Chen J, Gao F, Liu N. L1CAM promotes epithelial to mesenchymal transition and formation of cancer initiating cells in human endometrial cancer. Exp Ther Med. 2018 Mar,15(3):2792-7.
Wu H, Parsons JT. Cortactin, an 80/85-kilodalton pp60src substrate, is a filamentous actin-binding protein enriched in the cell cortex. J Cell Biol. 1993 Mar,120(6):1417-26.
Svitkina TM. Actin Cell Cortex: Structure and Molecular Organization. Trends Cell Biol. 2020 Jul,30(7):556-65.
Schnoor M, Stradal TE, Rottner K. Cortactin: Cell Functions of A Multifaceted Actin-Binding Protein. Trends Cell Biol. 2018 Feb,28(2):79-98.
Yin M, Ma W, An L. Cortactin in cancer cell migration and invasion. Oncotarget. 2017 Sep 19,8(50):88232-43.
Ramos-García P, González-Moles MÁ, González-Ruiz L,et al.An update of knowledge on cortactin as a metastatic driver and potential therapeutic target in oral squamous cell carcinoma. Oral Dis. 2019 May,25(4):949-71.
Li A, Zhang L, Zhang X, et al. Expression and clinical significance of cortactin protein in ovarian neoplasms. Clin Transl Oncol. 2016 Feb,18(2):220-7.
Watkins RJ, Imruetaicharoenchoke W, Read ML, et al. Pro-invasive Effect of Proto-oncogene PBF Is Modulated by an Interaction with Cortactin. J Clin Endocrinol Metab. 2016 Dec,101(12):4551-63.
Ji J,Feng XJ,Shi M,et al.Rac1 is correlated with aggressiveness and a potential therapeutic target for gastric cancer. Int J Oncol. 2015 Mar,46(3):1343-53.
Bao Y，Guo HH，Lu YL，et al. Blocking hepatic metastases of colon cancer cells using an shRNA against Rac1 delivered by activatable cell-penetrating peptide. Oncotarget. 2016 Nov 22,7(47):77183-95.
Melzer C, Hass R, von der Ohe J, et al. The role of TGF-β and its crosstalk with RAC1/RAC1b signaling in breast and pancreas carcinoma. Cell Commun Signal. 2017 May 12,15(1):19.
Zou T , Mao X , Yin J ,et al. Emerging roles of RAC1 in treating lung cancer patients. Clin Genet. 2017 Apr,91(4):520-8.
De P, Aske JC, Dey N. RAC1 Takes the Lead in Solid Tumors. Cells. 2019 Apr 26,8(5):382.
Ji R, Zhu XJ, Wang ZR, Huang LQ. Cortactin in Epithelial-Mesenchymal Transition. Front Cell Dev Biol. 2020 Oct 20,8:585619.
Head JA, Jiang D, Li M, et al. Cortactin tyrosine phosphorylation requires Rac1 activity and association with the cortical actin cytoskeleton. Mol Biol Cell. 2003 Aug,14(8):3216-29.
Hu M, Li Z, Qiu J,et al. CKS2 (CDC28 protein kinase regulatory subunit 2) is a prognostic biomarker in lower grade glioma: a study based on bioinformatic analysis and immunohistochemistry. Bioengineered. 2021 Dec,12(1):5996-6009.
Fromowitz FB, Viola MV, Chao S,et al. ras p21 expression in the progression of breast cancer. Hum Pathol. 1987 Dec,18(12):1268-75.
Clark EA, King WG, Brugge JS, et al. Integrin-mediated signals regulated by members of the rho family of GTPases. J Cell Biol. 1998 Jul 27,142(2):573-86.
Higgs HN, Pollard TD. Regulation of actin filament network formation through ARP2/3 complex: activation by a diverse array of proteins. Annu Rev Biochem. 2001,70:649-76.
Hall A. Rho GTPases and the actin cytoskeleton. Science. 1998 Jan 23,279(5350):509-14.
Uruno T, Liu J, Zhang P, et al. Activation of Arp2/3 complex-mediated actin polymerization by cortactin. Nat Cell Biol. 2001 Mar,3(3):259-66.
Bryce NS, Clark ES, Leysath JL, et al. Cortactin promotes cell motility by enhancing lamellipodial persistence. Curr Biol. 2005 Jul 26,15(14):1276-85.
Ridley AJ, Schwartz MA, Burridge K, et al. Cell migration: integrating signals from front to back. Science. 2003 Dec 5,302(5651):1704-9.
Ridley AJ. Life at the leading edge. Cell. 2011 Jun 24,145(7):1012-22.
Rottner K, Schaks M. Assembling actin filaments for protrusion. Curr Opin Cell Biol. 2019 Feb,56:53-63.
Blanchoin L, Boujemaa-Paterski R, Sykes C, Plastino J. Actin dynamics, architecture, and mechanics in cell motility. Physiol Rev. 2014 Jan,94(1):235-63.
Small JV, Stradal T, Vignal E, et al. The lamellipodium: where motility begins. Trends Cell Biol. 2002 Mar,12(3):112-20.
Lin SC, Lin CH, Shih NC, et al. Cellular prion protein transcriptionally regulated by NFIL3 enhances lung cancer cell lamellipodium formation and migration through JNK signaling. Oncogene. 2020 Jan,39(2):385-98.
Beli P, Mascheroni D, Xu D, et al. WAVE and Arp2/3 jointly inhibit filopodium formation by entering into a complex with mDia2. Nat Cell Biol. 2008 Jul,10(7):849-57.
Condeelis JS, Wyckoff JB, Bailly M,et al. Lamellipodia in invasion. Semin Cancer Biol. 2001 Apr,11(2):119-28.
Borm B, Requardt RP, Herzog V, Kirfel G. Membrane ruffles in cell migration: indicators of inefficient lamellipodia adhesion and compartments of actin filament reorganization. Exp Cell Res. 2005 Jan 1,302(1):83-95.
DUBUISSON M. Contribution à l'étude de la transformation G-actine--F-actine [Contribution to the study of the transformation of G-actin into F-actin]. Biochim Biophys Acta. 1950 Jun,5(3/4):426-32. Undetermined Language.
Hogue MJ. THE EFFECT OF HYPOTONIC AND HYPERTONIC SOLUTIONS ON FIBROBLASTS OF THE EMBRYONIC CHICK HEART IN VITRO. J Exp Med. 1919 Nov 30,30(6):617-48.
Charras GT. A short history of blebbing. J Microsc. 2008 Sep,231(3):466-78. 39.Charras G, Paluch E. Blebs lead the way: how to migrate without lamellipodia. Nat
Rev Mol Cell Biol. 2008 Sep,9(9):730-6.
Lawson CD, Ridley AJ. Rho GTPase signaling complexes in cell migration and invasion. J Cell Biol. 2018 Feb 5,217(2):447-57.
Bergert M, Chandradoss SD, Desai RA, Paluch E. Cell mechanics control rapid transitions between blebs and lamellipodia during migration. Proc Natl Acad Sci U S A. 2012 Sep 4,109(36):14434-9.
Davidson AJ, Amato C, Thomason PA, et al. WASP family proteins and formins compete in pseudopod- and bleb-based migration. J Cell Biol. 2018 Feb 5,217(2):701-14.
Chikina AS, Svitkina TM, Alexandrova AY. Time-resolved ultrastructure of the cortical actin cytoskeleton in dynamic membrane blebs. J Cell Biol. 2019 Feb 4,218(2):445-54.
Paluch EK, Raz E. The role and regulation of blebs in cell migration. Curr Opin Cell Biol. 2013 Oct,25(5):582-90.
Hudson LG, Gillette JM, Kang H, et al. Ovarian Tumor Microenvironment Signaling: Convergence on the Rac1 GTPase. Cancers (Basel). 2018 Sep 27,10(10):358.
Zhou K, Rao J, Zhou ZH, et al. RAC1-GTP promotes epithelial-mesenchymal transition and invasion of colorectal cancer by activation of STAT3. Lab Invest. 2018 Aug,98(8):989-98.
Hohmann T, Dehghani F. The Cytoskeleton-A Complex Interacting Meshwork. Cells. 2019 Apr 18,8(4):362.
Lozano E, Betson M, Braga VM. Tumor progression: Small GTPases and loss of cell-cell adhesion. Bioessays. 2003 May,25(5):452-63.
Wang Y, Hu L, Ji P, et al. MIIP remodels Rac1-mediated cytoskeleton structure in suppression of endometrial cancer metastasis. J Hematol Oncol. 2016 Oct 19,9(1):112.
Rane CK, Minden A. P21 activated kinases: structure, regulation, and functions. Small GTPases. 2014,5:e28003.
Lai FP, Szczodrak M, Oelkers JM, et al. Cortactin promotes migration and platelet-derived growth factor-induced actin reorganization by signaling to Rho-GTPases. Mol Biol Cell. 2009 Jul,20(14):3209-23.
Lim Lam VK, Hin Wong JY, Chew SY, et al. Rac1-GTPase regulates compression-induced actin protrusions (CAPs) of mesenchymal stem cells in 3D collagen micro-tissues. Biomaterials. 2021 Jul,274:120829.
Moshfegh Y, Bravo-Cordero JJ, Miskolci V, et al. A Trio-Rac1-Pak1 signalling axis drives invadopodia disassembly. Nat Cell Biol. 2014 Jun,16(6):574-86.
Krause M, Gautreau A. Steering cell migration: lamellipodium dynamics and the regulation of directional persistence. Nat Rev Mol Cell Biol. 2014 Sep,15(9):577-90.

No competing interests reported.

Short-hairpin RNA-mediated suppression of cortactin may inhibit the migration and invasion abilities of endometrial cancer cells by reducing lamellipodia

Status:

Version 1

Abstract

Background

Methods

Results

Conclusion

Figures

Introduction

Methods And Materials

Results

Discussion

Declarations

References

Additional Declarations

Status:

Version 1