Improvement of the Bioethanol Yield in Saccharomyces cerevisiae GPD2 Delta FPS1 Delta ADH2 Delta Constructed by the CRISPR-Cas9 Approach with the Decrease of By-Product Formation

doi:10.21203/rs.3.rs-1446317/v1

Download PDF

Research Article

Improvement of the Bioethanol Yield in Saccharomyces cerevisiae GPD2 Delta FPS1 Delta ADH2 Delta Constructed by the CRISPR-Cas9 Approach with the Decrease of By-Product Formation

https://doi.org/10.21203/rs.3.rs-1446317/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Bioethanol plays an important value in renewable liquid fuel. The inhibition of by-product formation would enhance the ethanol production of Saccharomyces cerevisiae. In fact, the excessive accumulation of glycerol and organic acids caused the decrease of ethanol content in the process of industrial ethanol production.

Results: In this study, S. cerevisiae engineering strains were constructed using the CRISPR-Cas9 approach to delete GPD2, FPS1, and ADH2 to improve the yield of ethanol with the decrease of by-product contents. Engineered S. cerevisiae SCGFA by the GPD2, FPS1, and ADH2 deletion produced 23.1 g/L with 50 g/L of glucose as substrate. SCGFA strain exhibited the ethanol conversion rate of 0.462 g per g of glucose. In addition, the contents of glycerol, lactic acid, acetic acid, and succinic acid in SCGFA decreased by 22.7, 12.7, 8.1, 19.9, and 20.7% compared with the wild-type strain, respectively.

Conclusions: The co-knockout of GPD2, FPS1, and ADH2 dramatically improved the ethanol yield of S. cerevisiae by the inhibition of glycerol release and the prevention of ethanol consumption. This study developed a new S. cerevisiae engineering strain SCGFA with high-level ethanol production after GPD2, FPS1, and ADH2 deletion. The engineering strain SCGFA could apply in ethanol production with less formation of by-products.

Saccharomyces cerevisiae

CRISPR-Cas9

ethanol

gene knockout

by-products

glycerol

organic acids

Ethanol, an alternative energy to fossil fuels, relieved the double pressures of energy crisis and environmental protection [1]. As an ethanol-producing strain, Saccharomyces cerevisiae consumes glucose to produce bioethanol through various biochemical reactions with the following steps: (1) glucose is decomposed into pyruvate through the glycolysis pathway; (2) the pyruvate is catalyzed by a decarboxylase to produce carbon dioxide and acetaldehyde; (3) the acetaldehyde is further catalyzed into ethanol by alcohol dehydrogenase [2]. However, ethanol production is generally accompanied by the formation of by-product during the fermentation of S. cerevisiae [3]. The excessive by-product formation definitely caused the efficiency decrease of glucose conversion [4]. Therefore, the by-product formation in S. cerevisiae reduced product quality and increased operating procedures, thus increasing the production costs.

Glycerol, a main by-product in S. cerevisiae, maintained important physiological functions in osmotic pressure balance and intracellular redox balance [5–7]. However, the excessive accumulation of glycerol undoubtedly reduced the conversion rate of glucose. During the glycerol metabolism, Glycerol 3-phosphate dehydrogenase 2 (GPD2) was responsible for the glycerol synthesis [8]. In addition, GPD2 also played a crucial role in the redox balance under anaerobiosis [9]. The deletion of S. cerevisiae GPD2 caused the decrease of the synthesis efficiency of glycerol [5]. Thus, GPD2 gene modification was an effective way to redirect the carbon flux of glycerol synthesis.

Glycerol uptake experiments indicated glycerol generally consisted of an FPS1-independent component, which facilitated diffusion based on the permeability characteristics of yeast plasma membrane [10]. Aquaglyceroporin FPS1, a member of major intrinsic protein (MIP) family of channel proteins, was a facilitator for glycerol uptake and efflux in response to the extracellular changes in S. cerevisiae [10, 11]. The overexpress of FPS1 enhanced the glycerol production [10]. In contrast, FPS1 depletion prevented the constitutive glycerol release by blockage of the secretory pathway [12]. In addition, the industrial ethanol production was controlled with high-level ethanol accumulation under anaerobic conditions [13]. Under these conditions, ethanol was generally catalyzed into acetaldehyde by alcohol dehydrogenase 2 (ADH2) [14]. The ADH2 deletion increased the ethanol titer and yield during the fermentation processing of S. cerevisiae [15]. Therefore, GPD2, FPS1, and ADH2 deletion could improve the ethanol yield of S. cerevisiae by redirection of the metabolic pathways.

However, the single-gene deletion was difficult to improve the overall yield of ethanol because GPD2, FPS1, and ADH2 played different roles in the metabolic mechanism of S. cerevisiae. The effect of the combinations of GPD2, FPS1, and ADH2 deletion on the ethanol yield in S. cerevisiae has still not been investigated so far. In this study, four combinations of GPD2, FPS1, and ADH2 deletion in S. cerevisiae were investigated using the clustered regularly interspaced short palindromic repeats-Cas9 (CRISPR-Cas9) approach (Fig. 1). The ethanol yields of four S. cerevisiae engineering strains ware compared. In addition, the contents of glycerol, organic acids, and carbon dioxide (CO₂) were also determined to investigate the effect of gene deletion on the formation of by-products. This study constructed S. cerevisiae engineering strains for improvement of bioethanol yield based on the comprehensive considerations of by-product formation and ethanol consumption.

1.1 Plasmids, primers, and agents

Plasmid gRNA-trp-HyB and Cas9-NTC were from Addgene Company. Plasmid gRNA-trp-HyB for guide RNA synthesis and Cas9-NTC for S. cerevisiae genome DNA digestion carried hygromycin B and nourseothricin resistance genes, respectively. Primers and genes were synthesized by Sangon Biotech (China). The gene sequencing was also performed by Sangon Biotech (China). Enzymes such as Phusion high-fidelity PCR master mix and Thermus aquaticus DNA polymerase were from NEB Biotech (USA). Other reagents such as nourseothricin, hygromycin B, polyethylene glycol (PEG), salmon sperm DNA (ssDNA), glucose, yeast extract, and peptone were from Trans Gen Biotech (China). All chemical reagents are analytically pure.

1.2 Linear vector construction for gRNA synthesis

The gRNA sequences of 20 bp for S. cerevisiaeGPD2, FPS1, and ADH2 were searched using Weblink http://chopchop.cbu.uib.no/ online search system [16]. The target sequences were selected according to the efficiency and self-complementarity values. Three different gRNA expression vectors were obtained by the amplification of plasmid gRNA-trp-HyB using the designed primers (Table 1). The different pairs of primers were used to amplify three different gRNA vectors by Phusion High-Fidelity PCR Master Mix as the following parameters of 2× Phusion master mix 12.5 μL, forward and reverse primers of 1.25 μL, DNA template of 0.5 μL, nuclease-free water of 9.5 μL. The size of each gRNA vector was 6509 bp. The processing parameters of PCR amplification were 98 °C for 30 s; 98 °C for 8 s, 50 °C for 25 s, 72 °C for 3 min for 29 cycles; 72 °C for 10 min.

1.3 S. cerevisiaeGPD2, FPS1, and ADH2 knockout by CRISPR-Cas9 approach

The CRISPR-Cas9 approach was used to construct S. cerevisiae engineering strains according to the technical solutions shown in Figure 2. The transformation of exogenous genes into S. cerevisiae was performed according to the PEG-mediated LiA-ssDNA method [17]. The target gene was knocked out by the integration of insertion DNA into S. cerevisiae genome DNA by the CRISPR-Cas9 approach [18]. Firstly, Cas9-NTC plasmid was transformed into S. cerevisiae based on the resistance screening of nourseothricin. After transformation, the solution of 50 μL was incubated on the solid yeast extract peptone dextrose medium (YPD) plate containing 80 μg/mL ofnourseothricin. After culture at 30 °C for 48 h, the putative colonies were screened out. The true transformants were named S. cerevisiae-Cas9-NTC after identification. Secondly, gRNA vector and insertion DNA were transformed into S. cerevisiae-Cas9-NTC by the PEG-mediated LiA-ssDNA method [17]. After transformation, the solution of 50 μL was cultured on the solid YPD plate containing 80 μg/mL of nourseothricin and 300 μg/mL of hygromycin B. After cultivation at 30 °C for 48 h, the putative colonies were screened out for further identification.

1.4 Identification of engineering strains by DNA amplification and sequencing

The constructed vectors of gRNA-GPD2, gRNA-FPS1, and gRNA-ADH2 were used to recognize the target sites of GPD2, FPS1, and ADH2, respectively. GPD2, FPS1, and ADH2 were knocked out by the insertion of 2091 bp of TV-AFB1D, 879 bp of OM-PLA1, and 910 bp of DPE in S. cerevisiae, respectively. Three different pairs of primers based on the sequences of TV-AFB1D, OM-PLA1, and DPE genes were designed to amplify insertion DNA for integration identification (Table 1). After sequencing confirmation, the true transformants were identified and used for further research.

1.5 Growth determination of engineered S. cerevisiae

The optical density (OD) at a wavelength of 600 nm was used to determine the cell concentrations of S. cerevisiae to investigate the effect of gene knockout on the cell growth of engineered S. cerevisiae. The amount of 1 mL of S. cerevisiae fermentation broth with 1 OD₆₀₀_nmwas sucked out and then inoculated into a 250-mL conical flask containing 100 mL YPD to culture at 30 °C with a shaking speed of 200 rpm. The OD₆₀₀_nm values were measured every 6 h during the fermentation of 72 h.

1.6 Sample treatment for the content measurement of by-products

The glucose and ethanol concentrations were measured to investigate the relation of glucose consumption with ethanol production. The S. cerevisiae engineering strains were inoculated into a 250-mL conical flask containing 100 mL of YPD medium containing 50 g/L of glucose when the cell concentration reached 1 OD₆₀₀. After fermentation for 24 h, the fermentation solution was transferred into an anaerobic fermentation condition. The fermentation solution was sucked out for the detection of ethanol and glucose contents every 6 h during the fermentation of 72 h. In addition, the concentrations of glycerol and organic acids were also investigated. The organic acids in the broth mainly included succinic acid, acetic acid, and lactic acid in this study. The CO₂ concentration was determined using a CO₂ online detector manufactured by Hengxin Company (China).

1.7 Determination of by-products by the HPLCmethod

The concentrations of glucose, ethanol, and glycerol were measured by High-Performance Liquid Chromatography (HPLC) [19]. The operation parameters are a mobile phase of 0.01 mol/L H₂SO₄, column temperature of 50 °C, instruments of Waters 1525 Binary HPLC Pump, Waters 2410 Refroctive Index Detector, and Shodex SH1011 chromatographic column. The concentrations of organic acids were determined according to the HPLC method [20]. The parameters were a detection wavelength of 210 nm, mobile phase A of 10 mM KH₂PO₄, mobile phase B of methanol, flow rate of 1.0 mL/min, and column temperature of 30 °C, instruments of Waters Alliance E2695, Waters 2489 UV detector, and Waters XSelect HSS column.

1.8 Data analysis

All statistics data were mean ± standard error by three repetitions. The curve figures were drawn using ProginPro 2018 Software.

2.1 Engineered S. cerevisiae construction

The 20-bp of gRNA sequences for GPD2, FPS1, and ADH2 knockout were chosen on the online search platform of weblink http://chopchop.cbu.uib.no/. The efficiencies of GPD2, FPS1, and ADH2 deletion were 70.6, 70.4, and 70.9%, respectively (Table 1). S. cerevisiae engineering strains were transformed by Cas9-NTC and gRNA vectors using insertion DNA as an exogenous donor DNA. In this study, engineered S. cerevisiae strains with GPD2Δ, FPS1Δ, GPD2Δ FPS1Δ, and GPD2Δ FPS1Δ ADH2 Δ were named by SCG, SCF, SCGF, and SCGFA, respectively. Four S. cerevisiae engineering strains of SCG, SCF, SCGF, and SCGFA were constructed according to the technology step (Figure 3-A). The putative SCGFA colony was screened on the solid plates containing double antibiotics of nourseothricin and hygromycin B (Figure 3-B). PCR amplification was used to identify SCGFA using the genome DNA as a template. The DNA bands with the sizes of 2091, 910, and 879 bp indicated TV-AFB1D, DPE, and OM-PLA1 as insertion DNA, respectively (Figure 3-C). The true SCGFA transformants were confirmed by gene sequencing. The other three transformants of SCG, SCF, and SCGF were also confirmed by DNA amplification and gene sequencing.

Table 1

Primers for gRNA vector construction and insertion DNA identification

Primers	Sequence	Description
GPD2-gRNA-F1	TGATTGGTTCTGGTAACTGGGGGGTTTTAGAGCTAGAAATAGCAAG	GPD2-gRNA vector construction
GPD2-gRNA--R1	CCCCCAGTTACCAGAACCAATCAGATCATTTATCTTTCACTGCGGA	GPD2-gRNA vector construction
Fps1-gRNA-F1	AATAAGCAGTCATCCGACGAAGGGTTTTAGAGCTAGAAATAGCAAG	FPS1-gRNA vector construction
Fps1- gRNA -R1	CCTTCGTCGGATGACTGCTTATTGATCATTTATCTTTCACTGCGGA	FPS1-gRNA vector construction
ADH2-gRNA-F1	GGAAACATTGATGATACCGTGGGGTTTTAGAGCTAGAAATAGCAAG	ADH2-gRNA vector construction
ADH2-gRNA-R1	CCCACGGTATCATCAATGTTTCCGATCATTTATCTTTCACTGCGGA	ADH2-gRNA vector construction
Us-TV-AFB1D	5'- ATGGCTCGCGCGAAGTACTC -3'	2091 bp
Ds-TV-AFB1D	5'-TTAAAGCTTCCGCTCTATGAA -3'	2091 bp
Us-OM-PLA1	5'-TATGCGCATTTTGTCAGGGA-3'	879 bp
Ds-OM-PLA1	5'-GATTACATAATATCGTTCAGC-3	879 bp
Us-DPE	5’-CAGAAAAGCGAAAGAGACACC-3’	910 bp
Ds-DPE	5’-TGAGGATATTATCGCAAATC-3	910 bp

Note: Primers of GPD2-gRNA-F1/GPD2-gRNA-R1, Fps1-gRNA-F1/Fps1-gRNA-R1, ADH2-gRNA-F1/ADH2-gRNA-R1 were used to construct GPD2-gRNA, FPS1-gRNA, and ADH2-gRNA vectors, respectively. The underlined and bold DNA sequences were designed to amplify the target for Cas9-RNA-guided endonucleases (20 bp-NGG). The other primers of Us-TV-AFB1D/Ds-TV-AFB1D, Us-OM-PLA1/Ds-OM-PLA1, Us-DPE/Ds-DPE were used to identify the insertion DNA with the sizes of 2091, 879, and 910 bp, respectively.

2.2 Effect of gene deletion on the proliferation of S. cerevisiae

The OD_{600 nm} values of the wild-type and four S. cerevisiae engineered strains were determined to investigate the effect of gene knockout on the cell growth of engineered strains (Figure 4). After fermentation for 72 h, the OD _{600 nm} values of the wild-type strain, SCG, SCF, SCGF, and SCGFA were 9.83, 9.59, 9.47, 9.64, and 9.77, respectively. No significant differences existed among these groups (p˂0.05). Thus, the gene knockouts in GPD2, FPS1, and ADH2 loci did not significantly affect the cell proliferation of S. cerevisiae engineered strains.

2.3 Effect of gene knockout on the glucose consumption

The residual contents of glucose were determined to investigate the efficiency of glucose consumption by engineered S. cerevisiae after gene knockout (Figure 5). The glucose was almost consumed after fermentation for 48 h using the initial glucose contents of 50 g/L. Four engineered strains of S. cerevisiae have a similar change trend to the wild-type strain under a batch fermentation. The gene deletion in three loci of GPD2, FPS1, and ADH2 did not affect the consumption of glucose.

2.4 Effect of gene deletion on the ethanol production

The ethanol contents were measured to investigate the effect of gene deletion on the ethanol production of S. cerevisiae engineering strains. The ethanol contents of engineering strains had a similar change trend to the wild-type strain during the initial fermentation of 0-24 h. However, the ethanol contents of strains exhibited a remarkable difference during the subsequent fermentation of 24-48 h. The ethanol contents from engineering strains exceeded the wild-type strain. The ethanol contents of strains kept relatively stable during the final fermentation of 48-72 h. the highest ethanol contents of SCG (20.6 g/L), SCF (20.9 g/L), SCGF (22.2 g/L) and SCGFA (23.1 g/L) were 1.05, 1.07, 1.13, and 1.18-fold compared with the wild-type S. cerevisiae (19.6 g/L), respectively. The ethanol conversion rate of SCGFA was 0.462 g per g of glucose, which was higher than the wild-type strain (0.392 g ethanol per g of glucose). Thus, SCGFA strain constructed by triple-deletion GPD2, FPS1, and ADH2 obtained a higher yield of ethanol than the single or double-deletion approaches.

2.5 Glycerol production of engineered S. cerevisiae

The glycerol contents in the fermentation broth were determined to compare the difference among the S. cerevisiae engineering strains (Figure 6). All the glycerol contents of SCG, SCF, SCGF, and SCGFA were lower than the wild-type S. cerevisiae during the fermentation. After fermentation for 72 h, SCG, SCF, SCGF, and SCGFA obtained 1787, 1729, 1677, and 1738 mg/L of glycerol in broth, respectively, which decreased by 20.5, 23.1, 25.4, and 22.7% compared with the wild-type strain (2249 mg/L). The glycerol contents from four different engineering strains decreased due to the gene deletion under different combinations. SCGF strain with GPD2 and FPS1 deletion represented the lowest glycerol content in broth among four engineering strains.

2.6 Lactic acid production of S. cerevisiae

The contents of lactic acid were measured to investigate the effect of gene knockout on lactic acid production in S. cerevisiae (Figure 7). The lactic acid contents of four engineered strains were lower than the wild-type S. cerevisiae. The lactic acid contents of SCG (7.22 mg/L), SCF (6.38 mg/L), SCGF (6.88 mg/L), SCGFA (6.59 mg/L) decreased by 4.4, 15.5, 8.9, and 12.7% compared with the wild-type strain (7.55 mg/L), respectively. Thus, the SCF strain constructed by only FPS1 deletion represented the lowest lactic acid content among the four engineering strains.

2.7 Effect of gene knockout on the production of acetic acid

The contents of acetic acid in the fermentation broth were measured to investigate the effect of gene deletion with different combinations on the acetic acid production during the fermentation (Figure 8). The acetic acid contents in four engineering strains were lower than the wild-type S. cerevisiae. After fermentation for 72 h, the acetic acid contents of SCG (116 mg/L), SCF (112 mg/L), SCGF (115 mg/L), and SCGFA (114 mg/L) in fermentation broth decreased by 6.5, 9.7, 7.3, and 8.1% compared with the wild-type S. cerevisiae (124 mg/L), respectively. Therefore, the SCF strain with only FPS1 knockout exhibited the lowest acetic acid content among all the tested strains.

2.8 Succinic acid production during the fermentation of S. cerevisiae

The succinic acid concentrations were measured to investigate the gene deletion with different combinations on succinic acid production (Figure 9). The succinic acid concentrations from four S. cerevisiae engineering strains were lower than the wild-type S. cerevisiae. The succinic acid concentrations from SCG (17.3 mg/L), SCF (16.3 mg/L), SCGF (16.2 mg/L), SCGFA (15.7 mg/L) decreased by 11.73, 16.84, 17.35, and 19.9% compared with the wild-type S. cerevisiae (19.6 mg/L), respectively. Thus, the SCGFA strain represented the lowest succinic acid concentration among all the tested strains.

2.9 Comparison of CO₂ concentrations of the wild-type and engineered strains

The concentrations of CO₂ released from different S. cerevisiae strains were investigated by the online detection approach (Figure 10). Four engineered strains exhibited lower CO₂concentrations compared with the wild-type S. cerevisiae. The CO₂ concentrations from SCG (1011 mg/L), SCF (956 mg/L), SCGF (924 mg/L), and SCGFA (897mg/L) decreased by 10.6, 15.5, 18.3 and 20.7 % compared with the wild-type S. cerevisiae (1131 mg/L). The GPD2, FPS1, and ADH2 deletion resulted in the decrease of CO₂concentrations released from four engineering S. cerevisiae strains. Thus, the gene deletion had a dramatic effect on the respiratory metabolism of S. cerevisiae based on the amount of CO₂ emission.

2.10 Stability of ethanol production by SCGFA engineering strain

The contents of ethanol by SCGFA engineering strains after multiple generations of culture were measured to analyze the stability of ethanol production (Figure 11). The contents of ethanol of SCGFA engineering strain after the 1^st, 10^th, 20^th, 30^th, 40^th, and 50^th generations were close to 23 g/L using 50 g/L as fermentation substrate, which was higher than the wild-type strain (19.6 g/L). The results indicated that SCGFA engineering strain could steadily produce ethanol after several generations. Therefore, SCGFA engineering strain constructed by the CRISPR-Cas9 approach still maintained the stable capability of ethanol production after the gene deletion.

Ethanol is likely to play an important role in the development of renewable fuel [21]. During the fermentation for ethanol production, glycerol was generally formatted as a byproduct to maintain osmotic stress and prevent water loss under hyperosmotic conditions [22]. However, the excessive accumulation certainly caused an adverse impact on ethanol production. The gene deletion has been proved to be an effective way to increase the ethanol yield with the reduction of glycerol production in the previous reports (Table 2). The redirection of glycerol flux could improve the ethanol yield in engineered S. cerevisiae by the supply increase for ethanol formation [23]. In addition, the minimization of glycerol synthesis also resulted in the yield decrease of acetic acid in S. cerevisiae mutant [6, 7].

In the carbon flow metabolic network of S. cerevisiae, GPD2 and FPS1, and ADH2 were mainly responsible for the glycerol production, glycerol transport, and ethanol oxidation to acetaldehyde, respectively [8, 24]. The deletion of GPD2, FPS1, and ADH2 affected the content of ethanol during the fermentation of S. cerevisiae. GPD2 and FPS1 deletion in S. cerevisiae caused the decrease of glycerol content by 7.95 and 18.8%, respectively [25, 26]. ADH2 deletion in S. cerevisiae also resulted in the improvement of ethanol yield [27]. This study showed that the growth rate of ethanol yield in SCGFA with GPD2, FPS1, and ADH2 deletion was higher than SCGF with double-deletion GPD2 and FPS1, SCG with single-deletion GPD2, and SCF with single-deletion FPS1. Therefore, the GPD2, FPS1, and ADH2 deletion contributed to the improvement of ethanol yield in S. cerevisiae based on the metabolic pathway redirection.

Table 2

The yields of ethanol and glycerol in S. cerevisiae engineering strains

Mutated gene	Ethanol yield	Glycerol yield	References
GPD2Δ	↑5.1%	↓20.5%	this study
FPS1Δ	↑6.6%	↓23.1%	this study
GPD2Δ FPS1Δ	↑13.3%	↓25.4%	this study
GPD2Δ FPS1Δ ADH2Δ	↑17.9%	↓22.7%	this study
GPD2Δ	↑7.41%	↓7.95%	[25]
FPS1Δ	↑10%	↓18.8%	[26]
FPS1Δ GAPNΔ	↑9.18%	↓21.47%	[28]
GPD1▼	↑9.7%	↓19%	[29]
FPS1Δ	↑10%	↓24%	[30]
FPS1Δ GLT1○	↑14%	↓30%	[30]
FPS1Δ	↑3%	---	[31]

Note: Symbol Δ, ○, and ▼ represented gene deletion, overexpression, and inhibition, respectively.

The maximum theoretical ethanol yield of glucose is 0.51 g (g of glucose) in S. cerevisiae. However, the ethanol yields only reached 90 to 93% of the maximal theoretical value in the current industrial processes [32]. In fact, during fermentation, some carbon was used to format biomass and by-products, particularly glycerol and organic acids [9]. Since even small improvements in ethanol yield would have a dramatic impact on profits in the large-scale production of ethanol, there still was a great interest to enhance ethanol yield with the formation reduction of by-products under the conditions of industrialization. In this study, SCGFA GPD2Δ FPS1Δ ADH2Δ exhibited the ethanol conversion rate of 0.462 g per g of glucose, which was higher than the wild-type strain (0.392 g ethanol per g of glucose). Based on the results in this study, we drew glucose metabolic pathway in S. cerevisiae engineering strain SCGFA GPD2Δ FPS1Δ ADH2Δ constructed by the CRISPR-Cas9 approach (Figure 12). The mutation sites of GPD2, FPS1, and ADH2 were located on the glycerol synthesis pathway, glycerol transmembrane path, and ethanol consumption. These mutations resulted in the improvement of ethanol content with the reduction of by-product content. The engineering strain still maintained a high level of cell proliferation activity and glucose consumption because the gene knockout did not affect the main metabolic pathways of Embden-Meyerhof-Parnas (EMP) and tricarboxylic acid cycle (TCA cycle), as well as respiratory metabolic-related pathways. Therefore, SCGFA was suitable for industrial bioethanol production under anaerobic conditions.

The formation of by-products affected the ethanol yield in S. cerevisiae during the fermentation processing of glucose. In this study, the CRISPR-Cas9 technology was used to construct S. cerevisiae engineering strains by the GPD2, FPS1, and ADH2 deletion. The highest ethanol contents of SCG, SCF, SCGF, and SCGFA increased by 5.1, 6.6, 13.3, and 17.9% compared with the wild-type S. cerevisiae. In addition, the glycerol contents of SCG, SCF, SCGF, and SCGFA strains decreased by 20.5, 23.1, 25.4, and 22.7% compared with the wild-type strain, respectively. SCGFA exhibited the highest ethanol conversion rate of 0.462 g per g of glucose among four S. cerevisiae engineering strains. Thus, S. cerevisiae engineering SCGFA with the GPD2, FPS1, and ADH2 deletion could dramatically improve the ethanol yield due to the inhibition of glycerol synthesis and the prevention of ethanol consumption.

S. cerevisiae: Saccharomyces cerevisiae;

GPD2: Glycerol-3-phosphate dehydrogenase 2;

ADH2: Alcohol dehydrogenase 2;

FPS1: Aquaglyceroporin for glycerol transport;

CRISPR-Cas9: Clustered Regularly Interspaced Short Palindromic Repeats-Cas9;

SCG: Engineered S. cerevisiae with GPD2 deletion;

SCF: Engineered S. cerevisiae with FPS1 deletion;

SCGF: Engineered S. cerevisiae with GPD2 and FPS1 deletion;

SCGFA: Engineered S. cerevisiae with GPD2, FPS1, and ADH2 deletion;

YPD: Yeast extract peptone dextrose medium;

HPLC: High-Performance Liquid Chromatography;

PEG: Polyethylene glycol;

ssDNA: Salmon sperm DNA;

CO₂: Carbon dioxide;

NTC: Nourseothricin;

HyB: Hygromycin B;

gRNA: Guide RNA;

OD: Optical density;

EMP: Embden-Meyerhof-Parnas;

TCA: Tricarboxylic acid

Conflict of Interest:

All the authors declare that they have no competing financial interests that could have appeared to influence the work reported in this manuscript.

Author Contributions:

PZY provided conceptualization, SYJ performed writing; SWJ provided software; ZZ and STJ provided resources; SHL, JCC and WJW performed investigation. All authors have read and agreed to the published version of the manuscript.

Funding:

This research was funded by Natural Science Foundation of Anhui Province (CN)(1908085MC80); Major Science and Technology Projects of Anhui Province (202003c08020001; 202103b06020014).

Data Availability:

The datasets are available from the corresponding author on reasonable request.

Kumari D, Singh R: Pretreatment of lignocellulosic wastes for biofuel production: A critical review. Renew Sust Energ Rev2018, 90:877-891.
Ha SJ, Galazka JM, Kim SR, Choi JH, Yang XM, Seo JH, Glass NL, Cate JHD, Jin YS: EngineeredSaccharomyces cerevisiaecapable of simultaneous cellobiose and xylose fermentation. Proceedings of the National Academy of Sciences of the United States of America2011, 108(2):504-509.
Watcharawipas A, Sae-tang K, Sansatchanon K, Sudying P, Boonchoo K, Tanapongpipat S, Kocharin K, Runguphan W: Systematic engineering ofSaccharomyces cerevisiae for D-lactic acid production with near theoretical yield. FEMS Yeast Res2021, 21(4):15.
Milne N, Wahl SA, van Maris AJA, Pronk JT, Daran JM: Excessive by-product formation: A key contributor to low isobutanol yields of engineeredSaccharomyces cerevisiae strains. Metabolic engineering communications2016, 3:39-51.
Remize F, Barnavon L, Dequin S: Glycerol export and glycerol-3-phosphate dehydrogenase, but not glycerol phosphatase, are rate limiting for glycerol production inSaccharomyces cerevisiae. Metabolic engineering2001, 3(4):301-312.
Sarris D, Papanikolaou S: Biotechnological production of ethanol: Biochemistry, processes and technologies. Eng Life Sci2016, 16(4):307-329.
Zhang AL, Chen X: Improve ethanol yield through minimizing glycerol yield in ethanol fermentation of Saccharomyces cerevisiae. Chinese J Chem Eng2008, 16(4):620-625.
Kong Q-X, Zhang A-L, Cao L-M, Chen X: Over-expressing GLT1 in a gpd2 Delta mutant of Saccharomyces cerevisiae to improve ethanol production. Applied Microbiology and Biotechnology2007, 75(6):1361-1366.
Hubmann G, Guillouet S, Nevoigt E: Gpd1 and Gpd2 fine-tuning for sustainable reduction of glycerol formation in Saccharomyces cerevisiae. Applied and Environmental Microbiology2011, 77(17):5857-5867.
Luyten K, Albertyn J, Skibbe WF, Prior BA, Ramos J, Thevelein JM, Hohmann S: Fps1, a yeast member of the MIP family of channel proteins, is a facilitator for glycerol uptake and efflux and is inactive under osmotic stress. The EMBO journal1995, 14(7):1360-1371.
Oliveira R, Lages F, Silva-Graca M, Lucas C: Fps1p channel is the mediator of the major part of glycerol passive diffusion in Saccharomyces cerevisiae: artefacts and re-definitions. Bba-Biomembranes2003, 1613(1-2):57-71.
Tamás MJ, Luyten K, Sutherland FCW, Hernandez A, Albertyn J, Valadi H, Li H, Prior BA, Kilian SG, Ramos Jet al: Fps1p controls the accumulation and release of the compatible solute glycerol in yeast osmoregulation. Molecular Microbiology1999, 31(4):1087-1104.
van Aalst ACA, de Valk SC, van Gulik WM, Jansen MLA, Pronk JT, Mans R: Pathway engineering strategies for improved product yield in yeast-based industrial ethanol production. Synthetic and systems biotechnology2022, 7(1):554-566.
Maestre O, Garcia-Martinez T, Peinado RA, Mauricio JC: Effects of ADH2 overexpression inSaccharomyces bayanus during alcoholic fermentation. Applied and Environmental Microbiology2008, 74(3):702-707.
Wang JY, Liu W, Ding WT, Zhang GC, Liu JJ: Increasing ethanol titer and yield in a gpd1 Delta gpd2 Delta strain by simultaneous overexpression of GLT1 and STL1 in Saccharomyces cerevisiae. Biotechnol Lett2013, 35(11):1859-1864.
Montague TG, Cruz JM, Gagnon JA, Church GM, Valen E: CHOPCHOP: a CRISPR/Cas9 and TALEN web tool for genome editing. Nucleic Acids Res2014, 42(W1):W401-W407.
Gietz RD, Schiestl RH: Large-scale high-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method. Nature Protocols2007, 2(1):38-41.
Zhang GC, Kong, II, Kim H, Liu JJ, Cate JHD, Jin YS: Construction of a quadruple auxotrophic mutant of an industrial polyploidSaccharomyces cerevisiaestrain by using RNA-guided Cas9 nuclease. Applied and Environmental Microbiology2014, 80(24):7694-7701.
Perpelea A, Wijaya AW, Martins LC, Rippert D, Klein M, Angelov A, Peltonen K, Teleki A, Liebl W, Richard Pet al: Towards valorization of pectin-rich agro-industrial residues: Engineering of Saccharomyces cerevisiaefor co-fermentation of D-galacturonic acid and glycerol. Metabolic Engineering2022, 69:1-14.
Bressani APP, Martinez SJ, Sarmento ABI, Borem FM, Schwan RF: Organic acids produced during fermentation and sensory perception in specialty coffee using yeast starter culture. Food Research International2020, 128:10.
Lu N, Rice RW: Demand drivers and price supports for bioethanol use as fuel in the United States: A brief review. Forest Products Journal2010, 60(2):126-132.
Pagliardini J, Hubmann G, Alfenore S, Nevoigt E, Bideaux C, Guillouet SE: The metabolic costs of improving ethanol yield by reducing glycerol formation capacity under anaerobic conditions in Saccharomyces cerevisiae. Microb Cell Fact2013, 12.
Yu KO, Kim SW, Han SO: Reduction of glycerol production to improve ethanol yield in an engineered Saccharomyces cerevisiaeusing glycerol as a substrate. Journal of Biotechnology2010, 150(2):209-214.
Lee J, Reiter W, Dohnal I, Gregori C, Beese-Sims S, Kuchler K, Ammerer G, Levin DE: MAPK Hog1 closes theS. cerevisiae glycerol channel Fps1 by phosphorylating and displacing its positive regulators. Genes & Development2013, 27(23):2590-2601.
Guo ZP, Zhang L, Ding ZY, Wang ZX, Shi GY: Interruption of glycerol pathway in industrial alcoholic yeasts to improve the ethanol production. Applied Microbiology and Biotechnology2009, 82(2):287-292.
Zhang A, Kong Q, Cao L, Chen X: Effect of FPS1 deletion on the fermentation properties of Saccharomyces cerevisiae. Lett Appl Microbiol2007, 44(2):212-217.
Xue T, Liu K, Chen D, Yuan X, Fang JP, Yan HS, Huang LQ, Chen YQ, He WJ: Improved bioethanol production using CRISPR/Cas9 to disrupt the ADH2 gene inSaccharomyces cerevisiae. World J Microbiol Biotechnol2018, 34(10):12.
Wang PM, Zheng DQ, Ding R, Chi XQ, Tao XL, Min H, Wu XC: Improvement of ethanol production inSaccharomyces cerevisiae by hetero-expression of GAPN and FPS1 deletion. J Chem Technol Biotechnol2011, 86(9):1205-1210.
He W, Ye S, Xue T, Xu S, Li W, Lu J, Cao L, Ye B, Chen Y: Silencing the glycerol-3-phosphate dehydrogenase gene in Saccharomyces cerevisiaeresults in more ethanol being produced and less glycerol. Biotechnol Lett2014, 36(3):523-529.
Kong QX, Gu JG, Cao LM, Zhang AL, Chen X, Zhao XM: Improved production of ethanol by deleting FPS1 and over-expressing GLT1 inSaccharomyces cerevisiae. Biotechnol Lett2006, 28(24):2033-2038.
Wei N, Xu H, Kim SR, Jin Y-S: Deletion of FPS1, encoding aquaglyceroporin Fps1p,improves xylose fermentation by engineered Saccharomyces cerevisiae. Applied and Environmental Microbiology2013, 79(10):3193-3201.
Bai FW, Anderson WA, Moo-Young M: Ethanol fermentation technologies from sugar and starch feedstocks. Biotechnol Adv2008, 26(1):89-105.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Improvement of the Bioethanol Yield in Saccharomyces cerevisiae GPD2 Delta FPS1 Delta ADH2 Delta Constructed by the CRISPR-Cas9 Approach with the Decrease of By-Product Formation

Status:

Version 1

Abstract

Figures

Introduction

1 Materials And Methods

1.1 Plasmids, primers, and agents

1.2 Linear vector construction for gRNA synthesis

1.3 S. cerevisiaeGPD2, FPS1, and ADH2 knockout by CRISPR-Cas9 approach

1.4 Identification of engineering strains by DNA amplification and sequencing

1.5 Growth determination of engineered S. cerevisiae

1.6 Sample treatment for the content measurement of by-products

1.7 Determination of by-products by the HPLCmethod

1.8 Data analysis

2 Results

2.1 Engineered S. cerevisiae construction

2.2 Effect of gene deletion on the proliferation of S. cerevisiae

2.3 Effect of gene knockout on the glucose consumption

2.4 Effect of gene deletion on the ethanol production

2.5 Glycerol production of engineered S. cerevisiae

2.6 Lactic acid production of S. cerevisiae

2.7 Effect of gene knockout on the production of acetic acid

2.8 Succinic acid production during the fermentation of S. cerevisiae

2.9 Comparison of CO₂ concentrations of the wild-type and engineered strains

2.10 Stability of ethanol production by SCGFA engineering strain

3 Discussions

4 Conclusions

Abbreviations

Declarations

References

Additional Declarations

Status:

Version 1

Improvement of the Bioethanol Yield in Saccharomyces cerevisiae GPD2 Delta FPS1 Delta ADH2 Delta Constructed by the CRISPR-Cas9 Approach with the Decrease of By-Product Formation

Status:

Version 1

Abstract

Figures

Introduction

1 Materials And Methods

1.1 Plasmids, primers, and agents

1.2 Linear vector construction for gRNA synthesis

1.3 S. cerevisiaeGPD2, FPS1, and ADH2 knockout by CRISPR-Cas9 approach

1.4 Identification of engineering strains by DNA amplification and sequencing

1.5 Growth determination of engineered S. cerevisiae

1.6 Sample treatment for the content measurement of by-products

1.7 Determination of by-products by the HPLCmethod

1.8 Data analysis

2 Results

2.1 Engineered S. cerevisiae construction

2.2 Effect of gene deletion on the proliferation of S. cerevisiae

2.3 Effect of gene knockout on the glucose consumption

2.4 Effect of gene deletion on the ethanol production

2.5 Glycerol production of engineered S. cerevisiae

2.6 Lactic acid production of S. cerevisiae

2.7 Effect of gene knockout on the production of acetic acid

2.8 Succinic acid production during the fermentation of S. cerevisiae

2.9 Comparison of CO2 concentrations of the wild-type and engineered strains

2.10 Stability of ethanol production by SCGFA engineering strain

3 Discussions

4 Conclusions

Abbreviations

Declarations

References

Additional Declarations

Status:

Version 1

2.9 Comparison of CO₂ concentrations of the wild-type and engineered strains