Ginsenoside Rg1 alleviates H2O2-induced oxidative stress and apoptosis in bovine mammary epithelial cells through the NFE2L2 signaling pathway

doi:10.21203/rs.3.rs-1450309/v1

Download PDF

Research Article

Ginsenoside Rg1 alleviates H₂O₂-induced oxidative stress and apoptosis in bovine mammary epithelial cells through the NFE2L2 signaling pathway

https://doi.org/10.21203/rs.3.rs-1450309/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

During the lactation period, the dairy cows is often in a state of negative energy balance. An enhanced lipid mobilization alters the redox imbalance of bovine mammary epithelial cells (bMECs) due to the negative energy balance in the early stage of lactation. Ginsenoside Rg1 (Rg1), the main active components of ginseng, has been well-documented with possession of excellent antioxidant both in humans and non-ruminants. The primary objective of this study was to explore the therapeutic effect of Rg1 on H₂O₂-induced oxidative damage of bMECs and its molecular mechanism. Bovine MEC line MAC-T cells were pretreated with Rg1 (0.25, 0.5, 1 or 2 µM) for 24 h, followed by a H₂O₂ (500 µM) challenge for 24 h.

Results

Rg1 treatment decreased intracellular ROS and apoptosis induced by H₂O₂. These effects are related to the activation of NFE2L2 antioxidant response element (ARE) pathway and the inactivation of caspase / Bcl2 / p53 apoptosis pathway. MAC-T cells were transfected with NFE2L2 siRNA for 48 h, and then treated with Rg1 (2 µM) for another 24 h, followed by a H₂O₂ (500 µM) challenge for 24 h. The protective effect of Rg1 on H₂O₂-induced intracellular ROS accumulation and apoptosis was eliminated after transfection with NFE2L2 siRNA.

Conclusions

These results suggest that NFE2L2 is necessary for the protective mechanism of Rg1 on H₂O₂-induced oxidative damage of bMECs. Thus, Rg1 might be a potent antioxidant in vivo that could be administered to ruminant animals during stressful periods such as the transition into lactation.

Ginsenoside Rg1

bMECs

NFE2L2

antioxidant

Perinatal nutritional health is of great significance to dairy production and profitability ^[1]. High-yielding cows are likely to suffer from altered redox balance because of their high metabolic rate ^[2]. Perinatal physiological changes cause about one-third of cows to have at least one clinical disease in the first 3 weeks of lactation, such as ketosis ^[3]. During this period, bovine mammary epithelial cells (bMECs) will experience serious metabolic challenges and excessive reactive oxygen species, especially in high yield cows ^{[4, 5]}. The increased level of intracellular reactive oxygen species (ROS) causes oxidative stress and inflammation, and even induces mammary epithelial cells apoptosis ^{[5, 6, 7]}. ROS can activate caspase 9, which in turn leads to activation of caspase 3, initiating the caspase level that leads to apoptosis coupling reaction ^[8]. Therefore, the apoptosis of bMECs is regulated by cell redox status ^{[9, 10]}. It is particularly important to develop potential strategies for maintaining redox balance to prevent oxidative damage ^[11].

In non-ruminant animals, transcriptional regulation factor nuclear factor E2 related factor 2 (NFE2L2) is an importantly regulator of cellular redox balance ^[12]. Under stress, NFE2L2 is released from Keap1 and transferred to the nucleus, with the target gene Upper conserved antioxidant reaction element (ARE) binding ^{[13, 14]}. NFE2L2 - ARE activation can affect cell oxidation state, and provide strong protection to oxidation attacks ^{[15, 16]}. NFE2L2 not only regulates the expression of antioxidant and detoxification enzymes and downstream phase II enzymes, such as heme oxygenase-1 (HMOX1), but is also critical in the regulation of genes encoding antioxidant proteins in response to oxidative stress and inflammation ^{[17, 18]}. Work in bMECs have shown that activation of NFE2L2 antioxidant response element pathways protect bMECs against H₂O₂-induced oxidative damage (Nuclear factor erythroid 2-related factor 2 antioxidant response element pathways protect bovine mammary epithelial cells against H₂O₂-induced oxidative damage in vitro). This suggests that the NFE2L2/ARE pathway may play an important role in protecting mammary gland against oxidative stress. Thus, NFE2L2 can be used as a potential exogenous regulator in daily management of dairy cows ^[19].

Ginsenoside Rg1 (Rg1) is the most abundant in the ginseng root and one of the highest active compounds ^[20]. Rg1 through cell proliferation, apoptosis, oxidative stress and inflammation such as a variety of mechanisms against damage and cytotoxicity ^{[21, 22, 23]}. By reducing ROS production and inflammation, Rg1 treatments alleviates neuron degeneration ^[24]. This is related to Nrf2/ARE pathway, which is the key pathway of oxidative stress ^[25], by increasing the expression of Nrf2 and HO-1 ^[26]. This suggests that ginseng saponin can effectively relieve oxidative stress injury. Therefore, the purpose of this study was to investigate oxidative stress in Rg1 therapeutic potential of bovine mammary gland epithelial cells and its molecular mechanism.

Cell culture and treatment

The bovine MEC line MAC-T cells was maintained in high-glucose Dulbecco’s modified Eagle’s medium (HG-DMEM, Pierce Hyclone, Fremont, CA, USA). At the same time in the medium supplemented with 100 UmL⁻¹penicillin, 100 g mL⁻¹streptomycin, and 10 % (v/v) heat inactivated fetal bovine serum (Grand Island, New York, USA). The cultivation conditions is 37 °C under 5 % CO₂in a humidified incubator.

MAC-T cells were treated with 0.25, 0.5, 1 or 2 μM Rg1 (Purity > 98 %) for 24 h. Then add 500 μM H₂O₂ to co-culture for another 24 h. Three inhibitors were added to the culture medium 1 h before Rg1 treatment ( Blebbistatin, 1 μM, selective myosin II inhibitor; Y27632, 10 μM, ROCK-specific inhibitor; z-VAD-fmk, 10 μM, caspase inhibitor). The control group was treated with vehicle instead of the drug. All chemicals were dissolved in DMSO and then diluted in the corresponding media to a final DMSO concentration of 0.1% (V/V).

Small RNA interferes with NFE2L2

The siRNA targeting NFE2L2 coding region and out-of-order non-target negative control was designed based on previous studies [27] and synthesized by Shanghai Gena Chemical Co., LTD. (Shanghai, China). The NFE2L2-siRNA primer sequence was sense: CTGGAGCAAGATTTAGATCAT and antisense: ATGATCTAAATCTTGCTCCAG. The cells were transfected in antibiotic-free medium according to the manufacturer's instructions (Shanghai Gena Chemical Co., LTD.), as previously described ^[27]. After routine trypsin treatment, 2 × 10⁶ cells per mL were resuspended in basal medium without antibiotics and cultured for 24 h. The siRNA and lipofectamine were mixed, incubated at room temperature for an additional 20 min, and then added to each well after incubation for 5 min at 37 °C. The same fresh medium was used to replace the basal medium 12 h after transfection. After 36 h, siRNA was removed from the cells and the cells were used for subsequent analysis or treatment.

Cell viability assay

Cell viability was assessed according to manufacturer's protocol using ccK-8 kit (Kumamoto Dojindo, Japan). Briefly, 10 × 10⁴cells per mL were placed on a 96-well culture plate for 4 hours and then treated according to the cell culture and treatment section mentioned earlier. The cells were then incubated with cck-8 solution and the absorbance was measured at 450nm with a microplate reader (Thermo Fisher Scientific, Grand 79 Island, NY). The control group was not exposed to either Rg1 or H₂O₂, and the data of each group were normalized.

Detection of ROS

Intracellular ROS was detected by DCFH-DA staining (Beyotime Biotechnology Institute, Jiangsu, China). The cells were incubated with 25 μM DCFH-DA for 20 min after treatment. Then, the cells were then washed and re-suspended in phosphate-buffered saline (PBS). The concentrations of intracellular ROS are reported as relative fluorescence, normalized to the control by Fluorescence (FACSCalibur, Becton-Dickinson, Sunnyvale, CA).

Detection of oxidative stress indicators

The activities of SOD, GSH-Px and CAT and the content of MDA in cells were determined by spectrophotometric diagnostic kit according to the manufacturer's instructions (Nanjing Jiancheng Biotechnology Institute, Nanjing, China). The cells were collected and suspended in PBS. The absorbance was measured at 560 nm (SOD), 420 nm (GSH-Px), 405 nm (CAT), and 532 nm (MDA), and recorded by 722 N spectrophotometer (Shanghai Scientific Instrument Co., LTD., China).

Detection of cell apoptosis

The determination of apoptosis was referred to relevant literatur ^[28]. The treated cells were collected and washed twice with PBS. Apoptosis was detected using annexin V-FITC / propidium iodide apoptosis assay kit (BD Pharmingen, San Jose, CA, USA) according to the instructions. Then, the cells were analyzed by flow cytometry (Becton Dickinson, San Jose, CA, USA).

RNA isolation and quantitative real-time PCR (qPCR)

Use the Trizol (Takara Biotechnology Co., Ltd, Dalian, China) to isolate total RNA from cells, following instructions. The concentration and purity of RNA were determined by K5500 differential photometer (Beijing Kaiao Technology Development Ltd, Beijing, China). In our study, we determined that the OD₂₆₀/OD₂₈₀ ratio of total RNA was 1.9, meeting the required purity requirements. Electrophoresis results showed that the quality of total RNA was high, and the bands of 28S, 18S and 5S were clear without obvious degradation. Then 1 μg total RNA from each sample was reversely transcribed into cDNA by the supplier's agreement (TaKaRa Biotechnology Co., LTD., Tokyo, Japan). The 7500 Real-Time PCR System (Applied Biosystems) was used to detect mRNA abundance, and using an SYBR green plus reagent kit (Roche, Norwalk, CT, USA). The reaction conditions were as follows: 95 °C for 3 min, followed by 40 cycles at 95 °C for 15 s and 60 °C for 1 min. The cDNA of 3 different samples in each treatment group was repeated 3 times. The results were normalized to the expression of GAPDH and β-actin, and calculated using the 2^−ΔΔCT method. The detailed information of gene primers is shown in Table 1.

Luciferase reporter assays

The cells were cultured in 24-well dishes for 18 hours, and 70% fusion was achieved. Then, the cells were co-transfected with ARE-luciferase reporter plasmid pGL6-ARE and pRL-TK plasmid using a Lipofectamine™2000 reagent (Invitrogen) for 24 h. The cells were then treated and harvested as directed. Luciferase activity was measured using a Dual Luciferase Reporter Assay kit (Promega). The luciferase activity of ARE was normalized to the luciferase activity of Renilla.

Statistical analysis

The values are expressed as mean ± SEM. When comparisons included more than three groups, One-way ANOV A with Bonferroni correction was used. The two groups were compared using Student’s t-test. Statistical significance is indicated by *P < 0.05 and **P < 0.01.

3.1 Effects of Rg1 on cell viability

Treatment with H₂O₂ decreased the MAC-T viability, while Rg1 enhanced the viability of MAC-T cells under H₂O₂ treatment, and it was dose-dependent (Fig. 1; P < 0.05 and P < 0.01).

3.2 Rg1 attenuated H₂O₂-induced oxidative stress

H₂O₂ treatment enhanced the level of intracellular ROS in MAC-T cells (Fig. 2A; P < 0.01), and the content of MDA (Fig. 2B; P < 0.01), while it decreased the activity of SOD (Fig. 2C; P < 0.01), GSH-P_X (Fig. 2D;P < 0.01) and CAT (Fig. 2E; P < 0.01), compared with the control group. However, ROS (P < 0.05 and P < 0.01) decreased significantly after Rg1 and H₂O₂ co-treatment and MDA (P < 0.01) production induced by H₂O₂. Compared with H₂O₂ alone, Rg1 induced similar activities of SOD, GSH-P_X and CAT (P < 0.01).

3.3 Rg1 activated the NFE2L2-ARE pathway

Compared with the control cultures, H₂O₂ treatment reduced the nuclear protein level of NFE2L2 (Fig. 3). Rg1 significantly increased the level of NFE2L2 nucleoprotein in MAC-T cells in the presence or absence of H₂O₂ (Fig. 3A; P < 0.01). In addition, luciferase reporter assay showed that H₂O₂ treatment reduced the activity of ARE compared with control cultures, while Rg1 significantly increased the activity of ARE in MAC-T with or without H₂O₂ (Fig. 3B; P < 0.01). Consistent with the increased nuclear NFE2L2 and activity of ARE, H₂O₂ decreased the mRNA abundance of downstream genes HMOX1 and NQO1 in the NFE2L2 pathway, while Rg1 upregulated the mRNA abundance of HMOX1 and NQO1 induced by H₂O₂ compared with the H₂O₂-treated group (Fig. 3C and D; P < 0.01).

3.4 Rg1 attenuated H₂O₂-activated caspase pathway activity and apoptosis

Addition of H₂O₂ in cell culture can increase the expression of p53 mRNA (Fig. 4A). Compared with H₂O₂ treatment group, the expression of P53 mRNA in Rg1 + H₂O₂ treatment group was decreased (Fig. 4A; P < 0.01). Compared with the control group, culture with H₂O₂ alone increased the mRNA expression of caspase 3, caspase 9 and Bax, while it decreased the expression of Bcl-2 (Fig. 4B–E;P < 0.01). In contrast, Rg1 decreased the mRNA expression of caspase3, caspase9 and Bax, and increased the expression of Bcl-2 in the absence or presence of H₂O₂ (P < 0.05 and P < 0.01). Consistent with the effects of Rg1 on the caspase pathway, Rg1 also attenuated H₂O₂-induced apoptosis (Fig. 5F; P < 0.01).

3.5 Rg1 attenuated H2O2-induced oxidative stress, inflammatory responses and apoptosis through NFE2L2

Transfection of NFE2L2 siRNA reduced the mRNA level of NFE2L2 compared with the control group (Fig. 5A; P < 0.01). Compared with the H₂O₂-treated group, ROS production in Rg1 + H₂O₂ treatment group decreased; however, ROS generation was greatly increased by si-NFE2L2 + Rg1 + H₂O₂ treatment compared with that with si-Control + Rg1 + H₂O₂ (Fig. 5B; P < 0.01), suggesting that the ability of Rg1 to attenuate the H₂O₂-induced oxidative stress was abolished by NFE2L2 knockdown. In contrast, the apoptosis rate was increased with si-NFE2L2 + Rg1 + H₂O₂ treatment compared with that with si-Control + Rg1 + H₂O₂ (Fig. 5C; P < 0.01).

During lactation, bovine mammary epithelial cells undergo metabolic stress and accumulate of free radicals, such as ROS ^[4]. Excess ROS is an important factor in inducing inflammation and apoptosis of cells ^[16]. Therefore, improving the antioxidant capacity of dairy cow breast tissue may effectively protect the health of dairy cow during lactation. Rg1 is one of the most abundant and active compounds in ginseng roots. Rg1 has been found that it can effectively reduce oxidative stress injury in human and non-ruminant cells ^{[18, 29]}. The data from this study highlight its biological role in H₂O₂ induced oxidative stress and apoptosis.Its mechanisms include activation of NFE2L2 pathway and inhibition of p53 / caspase/Bcl2 pathway (Fig. 6). Therefore, Rg1 may be a potential therapeutic agent for antioxidant damage in ruminants.

The transition of dairy cows from late pregnancy to lactation is the most challenging period in the lactation cycle, usually accompanied by negative energy balance ^[30]. This will trigger the mobilization of fat in the body, increase the production of ROS at the cellular level ^[31], resulting in oxidative stress. The OS is the result of the imbalance between the production of ROS and the ability to reduce their damaging effects by enzymes such as superoxide dismutase (SOD) and glutathione (GSH) ^[32]. The release of ROS usually triggers lipid peroxidation, leading to inflammation and tissue damage ^[33]. Therefore, maintaining intracellular redox balance and preventing the occurrence of oxidative stress-related diseases are very important for the health of dairy cows during the transition period. Rg1 can directly clear ROS and promote the expression of antioxidant proteins to help cells resist oxidative stress ^{[34, 35]}. Therefore, the increase of superoxide dismutase, glutathione peroxidase and catalase activities under oxidative stress highlights the positive effect of Rg1 on cellular antioxidant defense system. The increased activity of SOD, GSH-PX and CAT in the present study highlights the positive effect of Rg1 on the cellular antioxidant defense system. Although, it is not clear whether the oxidative stress model of bovine mammary epithelial cells can reflect the physiological stress conditions experienced by perinatal cows. However, in vivo studies, we should pay attention to the role of Rg1 in the regulation of redox state.

The activation of NFE2L2-ARE pathway can provide strong protection against oxidative attack ^{[15, 16]}. Some studies have pointed out that antioxidant supplementation can alleviate oxidative stress of bovine breast epithelial cells by activating NFE2L2-ARE pathway ^{[36, 37]}. These results suggest that NFE2L2 may be involved in improving the antioxidant capacity of bovine breast epithelial cells. The co-addition of Rg1 and H₂O₂ weakened the inhibition of NFE2L2 mRNA abundance, and increased the mRNA levels of HMOX1 and NQO1. These results suggest that Rg1 may inhibit oxidative stress-induced injury by activating the NFE2L2 pathway.Caspase-9, as the initiating caspase component of the apoptotic body complex, can be activated by ROS ^[38]. Activated Caspase-9 activates Caspase-3 in the caspase cascade, leading to apoptosis.The internal pathways of apoptosis also include Bcl-2 family proteins ^[39]. Bcl-2 inhibits apoptosis by inhibiting oxygen free radical mediated membrane damage and stabilizing mitochondrial membrane potentiall ^[40]. The gene of p53 is one of the most important tumor suppressor genes, p53 directly stimulates mitochondria to release cytochrome c through mitochondrial translocation, thereby inducing apoptosis ^{[41, 42, 43]}. Changes in the Bax/Bcl-2 ratio suggest that cytotoxic ROS signaling seems to trigger mitochondrial apoptotic pathways leading to cypsin-3 activation ^[41]. The reversal of the effect of H₂O₂ on the expression of p53, Caspase3 and caspase9 after treatment with Rg1 confirmed the protective effect of Rg1 on H₂O₂ induced apoptosis of bovine mammary epithelial cells.

Activation of NFE2L2 antioxidant signals has been shown to reduce inflammation and apoptosis ^[16]. In this study, increased ROS levels in bovine mammary epithelial cells suggest that knockdown of NFE2L2 by siRNA can inhibit the antioxidant function of Rg1. In addition, Rg1 could not reduce the apoptosis rate of bovine mammary epithelial cells when NFE2L2 was silenced under oxidative stress.These data confirm the direct role of Rg1 and NFE2L2 in antioxidant response.

In conclusion, the current findings provide important evidence for the potential cytoprotective effect of Rg1 on H₂O₂ induced oxidative damage of bovine breast epithelial cells. The mechanisms include reducing ROS production, maintaining intracellular redox balance, activating NFE2L2 pathway and inactivating p53 / caspase / BCL2 apoptosis pathway. The cytoprotective effect of Rg1 depends at least in part on the activation of NFE2L2 pathway. Rg1 may be used as an antioxidant compound in transitional dairy cows.

Authors’ contributions

WQ, SF and XS conceived the study; WQ, RC, HJ, SF and XS carried out experiments and data analysis; WQ and RC interpreted the data, and WQ, RC, HJ and XS wrote the manuscript. All authors approved the final version.

Funding

This work was supported by the National Natural Science Foundation of China (Beijing, China; grant no. 32002348), Heilongjiang Postdoctoral Science Foundation (Heilongjiang, China; grant no. LBH-Q21038), Natural Science Foundation of Heilongjiang Province (grant no. LH2020C085) and National Natural Science Foundation of China (Beijing, China; grant no. 31873028).

Availability of data and materials

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Ethics approval

All animals are handled in accordance with the Guidelines for The Care and Use of Experimental Animals issued by Heilongjiang Bayi Agricultural University (Daqing, China) and approved by the Animal Ethics Committee of Heilongjiang Bayi Agricultural University.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Stevenson JS, Banuelos S, Mendonça. L G D. Transition dairy cow health is associated with first postpartum ovulation risk, metabolic status, milk production, rumination, and physical activity[J]. J Dairy Sci. 2020;103(10):9573–86.
Piccione G, Borruso M, Giannetto C, Morgante M, Giudice E. Assessment of oxidative stress in dry and lactating cows. Acta Agriculturae Scandinavica A: Animal Sciences. 2007;57:101–4.
Kaufman EI, Asselstine VH, Leblanc SJ, et al. Association of rumination time and health status with milk yield and composition in early-lactation dairy cows[J]. J Dairy Sci. 2017;101(1):462–71.
Chen M, Xi Y, Chen K, et al. Upregulation Sestrin2 protects against hydrogen peroxide-induced oxidative damage bovine mammary epithelial cells via a Keap1‐Nrf2/ARE pathway[J]. J Cell Physiol. 2021;236(1):392–404.
Guo W, Liu J, Sun J, et al. Butyrate alleviates oxidative stress by regulating NRF2 nuclear accumulation and H3K9/14 acetylation via GPR109A in bovine mammary epithelial cells and mammary glands[J]. Free Radic Biol Med. 2020;152:728–42.
Ma YF, Wu ZH, Gao M, Loor JJ. Nuclear factor erythroid 2-related factor 2 antioxidant response element pathways protect bovine mammary epithelial cells against H2O2-induced oxidative damagein vitro. J Dairy Sci. 2018;101:5329–44.
Jozwik A, Krzyzewski J, Strzalkowska N, Polawska E, Bagnicka E, Wierzbicka A, Niemczuk K, Lipinska P. & Horbanczuk JO2012 Relations between the oxidative status, mastitis, milk quality and disorders of reproductive functions in dairy cows–a review.Animal Science Papers and Reports30297–307.
Li D, Ni S, Miao KS, Zhuang C. PI3K/Akt and caspase pathways mediate oxidative stress-induced chondrocyte apoptosis. Cell Stress Chaperones. 2019;24:195–202.
Miranda SG, Purdie NG, Osborne VR, Coomber BL, Cant JP. Selenomethionine increases proliferation and reduces apoptosis in bovine mammary epithelial cells under oxidative stress. J Dairy Sci. 2011;94:165–73.
Abuelo A, Hernandez J, Benedito JL, Castillo C. Association of oxidative status and insulin sensitivity in periparturient dairy cattle: An observational study. J Anim Physiol Anim Nutr (Berl ). 2016;100:279–86.
Sun X, Chang R, Tang Y, et al. Transcription factor EB (TFEB)-mediated autophagy protects bovine mammary epithelial cells against H2O2 -induced oxidative damage in vitro[J]. Journal of Animal Science and Biotechnology, 2021, 12(1).
Denzer I, Münch G, Friedland K. Modulation of mitochondrial dysfunction in neurodegenerative diseases via activation of nuclear factor erythroid-2-related factor 2 by food-derived compounds. Pharmacol Res. 2016;103:80–94.
Itoh K, Chiba T, Takahashi S, Ishii T, Igarashi K, Katoh Y, Oyake T, Hayashi N, Satoh K, Hatayama I, Yamamoto M, Nabeshima Y. An Nrf2/small Maf heterodimer mediates the induction of phase II detoxifying enzyme genes through antioxidant response elements. Biochem Biophys Res Commun. 1997;236:313–22.
Kansanen E, Kuosmanen SM, Leinonen H, Levonen AL. The Keap1-Nrf2 pathway: Mechanisms of activation and dysregulation in cancer. Redox Biol. 2013;1:45–9.
Kobayashi M, Yamamoto M. Nrf2-Keap1 regulation of cellular defense mechanisms against electrophiles and reactive oxygen species. Adv Enzyme Regul. 2006;46:113–40.
Sun X, Jia H, Xu Q, et al. Lycopene alleviates H 2 O 2 -induced oxidative stress, inflammation and apoptosis in bovine mammary epithelial cells via the NFE2L2 signaling pathway[J]. Food & Function, 2019, 10(10):pp. 6276–85.
Ishii T, Itoh K, Takahashi S, Sato H, Yanagawa T, Katoh Y, Bannai S, Yamamoto M. Transcription factor Nrf2 coordinately regulates a group of oxidative stress-inducible genes in macrophages. J Biol Chem. 2000;275:16023–9.
Itoh K, Mochizuki M, Ishii Y, Ishii T, Shibata T, Kawamoto Y, Kelly V, Sekizawa K, Uchida K, Yamamoto M. Transcription factor Nrf2 regulates inflammation by mediating the effect of 15-deoxy-Delta(12,14)-prostaglandin j(2). Mol Cell Biol. 2004;24:36–45.
Ma YF, Wu ZH, Gao M, Loor JJ. Nuclear factor-like factor 2-antioxidant activation through the action of ataxia telangiectasia-mutated serine/threonine kinase is essential to counteract oxidative stress in bovine mammary epithelial cells. J Dairy Sci. 2018a;101:5317–28.
C. Fernández-Moriano E, González-Burgos, Iglesias I, et al. Evaluation of the adaptogenic potential exerted by ginsenosides Rb1 and Rg1 against oxidative stress-mediated neurotoxicity in an in vitro neuronal model[J]. PLoS ONE, 2017, 12(8):e0182933.
Liu Q, Kou JP, Yu BY. Ginsenoside Rg1 protects against hydrogen peroxide-induced cell death in PC12 cells via inhibiting NF-kappaB activation. Neurochem Int. 2011;58:119–25.
Wu J, Pan Z, Wang Z, et al. Ginsenoside Rg1 protection against beta-amyloid peptide-induced neuronal apoptosis via estrogen receptor alpha and glucocorticoid receptor-dependent anti-protein nitration pathway. Neuropharmacology. 2012;63:349–61.
Ma J, Liu J, Wang Q, et al. The beneficial effect of ginsenoside Rg1 on Schwann cells subjected to hydrogen peroxide induced oxidative injury. Int J Biol Sci. 2013;9:624–36.
Li Y, Wang L, Wang P, et al. Ginsenoside-Rg1 Rescues Stress-Induced Depression-Like Behaviors via Suppression of Oxidative Stress and Neural Inflammation in Rats[J]. 2020: Oxidative medicine and, cellular longevity; 2020. pp. 1–15.
Ginsenoside Rg1. prevents acetaminophen-induced oxidative stress and apoptosis via Nrf2/ARE signaling pathway[J]. Journal of Asian Natural Products Research, 2019.
Qin Q, Lin N, Huang H, et al. Ginsenoside Rg1 ameliorates cardiac oxidative stress and inflammation in streptozotocin-induced diabetic rats[J]. Metabolic Syndrome: Targets and Therapy: Diabetes; 2019. p. 12.
Ma YF, Wu ZH, Gao M, Loor JJ. Nuclear factor erythroid 2-related factor 2 antioxidant response element pathways protect bovine mammary epithelial cells against H₂O₂-induced oxidative damage in vitro,J. Dairy Sci., 2018, S0022030218302704.
Wu J, Sun J, Xue Y. Involvement of JNK and P53 activation in G2/M cell cycle arrest and apoptosis induced by titanium dioxide nanoparticles in neuron cells,Toxicol. Lett. 2010;199:269–76.
Tan-Zhen Xu. Xiao-Yan, et al. Ginsenoside Rg1 protects against H₂O₂?induced neuronal damage due to inhibition of the NLRP1 inflammasome signalling pathway in hippocampal neurons in?vitro.[J]. International Journal of Molecular Medicine; 2018.
Gross JJ, Bruckmaier RM. Invited review: Metabolic challenges and adaptation during different functional stages of the mammary gland in dairy cows: Perspectives for sustainable milk production. J Dairy Sci. 2019 Apr;102(4):2828–2843. doi: 10.3168/jds.2018-15713. Epub 2019 Feb 22. PMID: 30799117.
Bernabucci U, Ronchi B, Lacetera N, Nardone A. Influence of body condition score on the relationship between metabolic status and oxidative stress in periparturient dairy cows. J Dairy Sci. 2005;88:2017–26.
Juan-García A, Juan C, Tolosa J, Ruiz M-J. 2019. Effects of deoxynivalenol, 3- acetyl-deoxynivalenol and 15-acetyl-deoxynivalenol on parameters associated with oxidative stress in HepG2 cells. Mycotoxin Res 35 (2), 197–205. https://doi.org/ 10.1007/s12550-019-00344-0.
Jing Z, Jmw C, Htf A, et al. Pterostilbene inhibits deoxynivalenol-induced oxidative stress and inflammatory response in bovine mammary epithelial cells - ScienceDirect[J]. Toxicon. 2020;189:10–8.
Xu TZ, Shen XY, Sun LL, Chen YL, Zhang BQ, Huang DK, Li WZ. Ginsenoside Rg1 protects against H₂O₂induced neuronal damage due to inhibition of the NLRP1 inflammasome signalling pathway in hippocampal neurons in vitro. Int J Mol Med. 2019 Feb;43(2):717–26. doi:10.3892/ijmm.2018.4005. Epub 2018 Nov 30.
Gao Y, Chu SF, Zhang Z, Ai QD, Xia CY, Huang HY, Chen NH. Ginsenoside Rg1 prevents acetaminophen-induced oxidative stress and apoptosis via Nrf2/ARE signaling pathway. J Asian Nat Prod Res. 2019 Aug;21(8):782–797. doi: 10.1080/10286020.2018.1504024. Epub 2019 Jan 4.
Li R, Fang H, Shen J, Jin Y, Zhao Y, Wang R, Fu Y, Tian Y, Yu H, Zhang J. Curcumin Alleviates LPS-Induced Oxidative Stress, Inflammation and Apoptosis in Bovine Mammary Epithelial Cells via the NFE2L2 Signaling Pathway. Toxins (Basel). 2021 Mar 12;13(3):208. doi: 10.3390/toxins13030208.
Ma YF, Zhao L, Coleman DN, Gao M, Loor JJ. Tea polyphenols protect bovine mammary epithelial cells from hydrogen peroxide-induced oxidative damage in vitro by activating NFE2L2/HMOX1 pathways. J Dairy Sci. 2019 Feb;102(2):1658–1670. doi: 10.3168/jds.2018-15047. Epub 2018 Dec 26.
Oh SH, Lim SC. A rapid and transient ROS generation by cadmium triggers apoptosis via caspase-dependent pathway in HepG2 cells and this is inhibited through N-acetylcysteine-mediated catalase upregulation.[J]. Toxicol Appl Pharmacol. 2006;212(3):212–23.
Levine B, Sinha SC, Kroemer G. Levine B, Sinha S, Kroemer GBcl-2 family members: dual regulators of apoptosis and autophagy. Autophagy 4(5): 600–606[J]. Autophagy, 2008, 4(5):600–606.
Desa Gh Er S, Martinou JC. Desagher S, Martinou JC. Mitochondria as the central control point of apoptosis. Trends Cell Biol10: 369–377 10.1016/S0962-8924(00)01803-1[J]. Trends in Cell Biology, 2000, 10(9):369–377.
Ali D, Tripathi A, Alali H, et al. ROS-dependent Bax/Bcl2 and caspase 3 pathway-mediated apoptosis induced by zineb in human keratinocyte cells[J]. OncoTargets and Therapy. 2018;11:489–97.
Marchenko ND, Moll UM. Mitochondrial death functions of p53[J]. Mol Cell Oncol. 2014;1(2):-.
Moll UM, Zaika A. Nuclear and mitochondrial apoptotic pathways of p53[J]. FEBS Lett. 2001;493:2–3.

Table. 1. Gene primer sequence analysis.

Gene	Primer sequences（5’-3’）	Length（bp）
NFE2L2	F GCCCTCACTGGATAAAGAA R CATGCCGTTGCTGGTAC	202
NQO1	F AACCAACAGACCAGCCAATC R CACAGTGACCTCCCATCCTT	154
HMOX1	F CAAGGAGAACCCCGTCTACA R CCAGACAGGTCTCCCAGGTA	225
p53	F GAGCACTGCCTACCAACA R CATCCAGAGCATCCTTCA	150
Caspase 3	F AGAACTTGGTGGTCCATACA R CTCAACCCGTCTCCCTTTAT	242
Caspase 9	F TTCCCCCTTATTTTGCTC R ACGGCTCCCACCCCAGTC	148
Bax	F CCTTTTGCTTCAGGGTTTC R GCTCAGCTTCTTGGTGGAT	109
Bcl-2	F TGACCGAGTACCTGAACCG R CAGCCAGGAGAAATCAAACA	116
β-actin	F GCCCTGAGGCTCTCTTCCA R GCGGATGTCGACGTCACA	101
GAPDH	F GTCTTCACTACCATGGAGAAGG R TCATGGATGACCTTGGCCAG	197

Download PDF

Version 1

posted

You are reading this latest preprint version

Ginsenoside Rg1 alleviates H₂O₂-induced oxidative stress and apoptosis in bovine mammary epithelial cells through the NFE2L2 signaling pathway

Status:

Version 1

Abstract

Background

Results

Conclusions

Figures

1. Introduction

2. Materials And Methods

3. Results

3.1 Effects of Rg1 on cell viability

3.2 Rg1 attenuated H₂O₂-induced oxidative stress

3.3 Rg1 activated the NFE2L2-ARE pathway

3.4 Rg1 attenuated H₂O₂-activated caspase pathway activity and apoptosis

3.5 Rg1 attenuated H2O2-induced oxidative stress, inflammatory responses and apoptosis through NFE2L2

3. Discussion

Declarations

References

Tables

F TGACCGAGTACCTGAACCG

R CAGCCAGGAGAAATCAAACA

R GCGGATGTCGACGTCACA

F GTCTTCACTACCATGGAGAAGG

Status:

Version 1

Ginsenoside Rg1 alleviates H2O2-induced oxidative stress and apoptosis in bovine mammary epithelial cells through the NFE2L2 signaling pathway

Status:

Version 1

Abstract

Background

Results

Conclusions

Figures

1. Introduction

2. Materials And Methods

3. Results

3.1 Effects of Rg1 on cell viability

3.2 Rg1 attenuated H2O2-induced oxidative stress

3.3 Rg1 activated the NFE2L2-ARE pathway

3.4 Rg1 attenuated H2O2-activated caspase pathway activity and apoptosis

3.5 Rg1 attenuated H2O2-induced oxidative stress, inflammatory responses and apoptosis through NFE2L2

3. Discussion

Declarations

References

Tables

F TGACCGAGTACCTGAACCG

R CAGCCAGGAGAAATCAAACA

R GCGGATGTCGACGTCACA

F GTCTTCACTACCATGGAGAAGG

Status:

Version 1

Ginsenoside Rg1 alleviates H₂O₂-induced oxidative stress and apoptosis in bovine mammary epithelial cells through the NFE2L2 signaling pathway

3.2 Rg1 attenuated H₂O₂-induced oxidative stress

3.4 Rg1 attenuated H₂O₂-activated caspase pathway activity and apoptosis