Cryopreservation and validation of differentiated PDGFRα-positive cells for long term usage in experimentation

doi:10.21203/rs.3.rs-1453814/v1

Download PDF

Method Article

Cryopreservation and validation of differentiated PDGFRα-positive cells for long term usage in experimentation

https://doi.org/10.21203/rs.3.rs-1453814/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Differentiation of immortalized Mesenchymal Stromal Cells (iMSCs) into PDGFRα-positive cells under controlled growth conditions has several vital implications in functional studies concerned with the pathogenesis of Diabetic Gastroparesis (DGP). Recently, we have demonstrated the importance of these cells as a novel, in-vitro model for investigating the functional role of neuronal nitric oxide synthase. The currently available methods require fresh differentiation of PDGFRα-positive cells for each round of experimentation. This leads to longer delays, higher usage of reagents, and inconsistency in the reproducibility of experiments frequently. To overcome these challenges, we have developed a novel and detailed protocol for maintaining and cryopreserving the iMSC-derived PDGFRα-positive cells for functional investigations. These cells can be thawed and used per the experimental requirements with prolonged preservation of their characteristics.

Results

We first assessed the viability of differentiated PDGFRα-positive cells and observed a non-significant difference between pre-and post-freezing procedures, indicating that there was no loss of capacity due to long-term storage. Consequently, we validated their functional characteristics using flow cytometry, qRT-PCR, and western blotting.

Conclusions

Based on the obtained outcomes, we propose cryopreserved differentiated PDGFRα-positive cells as a feasible model for experimental reproducibility. To the best of our knowledge, this is the first study to use the present methodology, which provides novel technical solutions and can be advantageous in studying gastrointestinal disorders such as DGP.

iMSCs

Stem Cell Differentiation

PDGFRα-positive cells

qRT-PCR

Flow Cytometry

Western Blotting

Diabetic gastroparesis (DGP) is a gastrointestinal (GI) motility disorder with complex pathological features that are associated with numerous risk factors which are not been identified yet [2]. PDGFRα-positive cells which express the PDGFR-α marker are fibroblast-like interstitial cells that are extensively present in the GI smooth muscles suggesting that they might be playing an essential role in GI motility [3–6]. However, using these cells in functional studies is challenging due to the lack of isolation methods specific for PDGFRα-positive cells [7]. In recent studies, the idea of differentiating mesenchymal stromal cells (MSCs) in-vitro to PDGFRα-positive cells using appropriate proportions of growth factors and nutritional media has been encouraged [8, 9]. Based on these findings, telomerase transformed immortalized MSCs (iMSCs) were successfully differentiated into PDGFRα-positive cells using connective tissue growth factor (CTGF) and L-ascorbic acid (LAA) in 21 days [1, 8]. We and others have used this protocol to differentiate iMSCs into PDGFRα-positive cells; however, one of the limitations of the protocol was the waiting time of 21 days for each round of differentiation. Therefore, we have developed and elucidated a novel and stepwise protocol for maintaining these cells post day 21 of differentiation by freezing them through cryopreservation followed by thawing after 3–4 weeks to render them useful in future experiments. This protocol would help investigators have ready to use cryopreserved differentiated PDGFRα-positive cells instead of having repeated rounds of 21-day differentiation to execute their experimentation.

We have also described the details of the various steps used in validating the PDGFRα-positive cells during long-term storage in liquid nitrogen and their subsequent thawing and compared the results to a positive control (primary fibroblasts [F180]) and negative control (undifferentiated iMSCs). These steps involve analyzing cell survivability using MTT, detecting specific cell surface markers using flow cytometry, and analyzing gene and protein expression using qRT-PCR and western blotting.

2.1. Cell culture and fibroblastic differentiation

Negative Control: Telomerase transformed immortalized human bone marrow-derived mesenchymal stromal cells (iMSCs; RRID: CVCL_B5PE); Applied Biological Materials, Richmond, Canada; Catalogue no. abm T0529.
Positive Control: primary human fibroblasts [F180]; University Hospital Sharjah, Sharjah, UAE.
Six well plates; Jet Biofil, Guangzhou, China.
Minimum Essential Medium-alpha modification (MEM-α); Sigma Aldrich, St. Louis, MO, USA; Catalogue no. 32571-028.
Fetal Bovine Serum; Sigma Aldrich, St. Louis, MO, USA; Catalogue no. F7524.
L-glutamine; Sigma Aldrich, St. Louis, MO, USA; Catalogue no. G3126-500G.
Penicillin-Streptomycin; Sigma Aldrich, St. Louis, MO, USA; Catalogue no. P4333-100ML.
Connective tissue growth factor (CTGF); Biovendor, Brno, Czech Republic; RefCode: RD191035299R.
L-Ascorbic acid (LAA); Sigma Aldrich, St. Louis, MO, USA; Catalogue no. A92902.
T-25 and T-75 cell culture flasks; Sigma Aldrich, St. Louis, MO, USA.
Trypsin-EDTA solution; Sigma Aldrich, St. Louis, MO, USA; Catalogue no. T4299.
Dulbecco’s Phosphate Buffered Saline (PBS); Sigma Aldrich, St. Louis, MO, USA; Catalogue no. D8537
Dulbecco’s Modified Eagle Media (DMEM); Sigma Aldrich, St. Louis, MO, USA; Catalogue no. D5671.

2.2 Cryopreservation of the differentiated PDGFRα-positive cells

2ml cryovials; Thermo Fisher Scientific, Waltham, MA, USA; Catalogue no.5000-0012.
Trypsin-EDTA solution; Sigma Aldrich, St. Louis, MO, USA; Catalogue no. T4299.
Dulbecco’s Phosphate Buffered Saline (PBS); Sigma Aldrich, St. Louis, MO, USA; Catalogue no. D8537.
Complete MEM-α and DMEM media (Media recipes #1).
Dimethyl sulfoxide (DMSO); Sigma Aldrich, St. Louis, MO, USA; Catalogue no. D8418.

2.3 Measuring cell viability using MTT

3-[4,5-dimethylthiazol-2-yl]-2,5 diphenyltetrazolium bromide (MTT); Sigma-Aldrich, St. Louis, MO, USA; Catalogue no. CAS 298-93-1.
96-well plates; Jet Biofil, Guangzhou, China.
Trypsin-EDTA solution; Sigma Aldrich, St. Louis, MO, USA; Catalogue no. T4299.
Dulbecco’s Phosphate Buffered Saline (PBS); Sigma Aldrich, St. Louis, MO, USA; Catalogue no. D8537.
Complete MEM-α and DMEM media (Media recipes #1).
Dimethyl sulfoxide (DMSO); Sigma Aldrich, St. Louis, MO, USA; Catalogue no. D8418.

2.4. Flow cytometry analysis for cell surface marker expression in differentiated PDGFRα-positive cells

Anti-CD-34-PE; BD Pharmingen, San Diego, CA, USA; Catalogue No. 555822; RRID: AB_396151.
Anti-CD-44-APC; BD Pharmingen, San Diego, CA, USA; Catalogue No. 559942; RRID: AB_398683.
CD140α/PDGFRα-BB515; BD Horizon, Franklin Lakes, NJ, USA; Catalogue No. 564594; RRID: AB_2738860.
Haemocytometer; Marienfeld, Lauda-Konigshofen, Germany; Catalogue No. 5000201466-640030.
Dulbecco’s Phosphate Buffered Saline (PBS); Sigma Aldrich, St. Louis, MO, USA; Catalogue no. D8537.
FACS buffer containing 2% FBS (Materials and reagents #2.1e) and 1mM EDTA (Catalogue No. E9884); Sigma Aldrich, St. Louis, MO, USA.
Dulbecco’s Modified Eagle Medium (DMEM); Sigma Aldrich, Carlsbad, CA, USA; Catalogue no. D5671.
Trypsin-EDTA solution; Sigma Aldrich, St. Louis, MO, USA; Catalogue no. T4299.

2.5. Gene expression analysis for validation of differentiated PDGFRα-positive cells

PureLink® RNA Mini Kit; Invitrogen, Carlsbad, CA, USA; Catalogue no.12183018A.
High-capacity cDNA synthesis kit; Applied Biosystems, Foster City, MA, USA; Catalogue no. 4368814.
GoTaq® SYBR green master mix; Promega Corporation, Madison, WI, USA; Catalogue no. A6001.
Human primers used for quantitative PCR (qPCR) are listed in Table 1 and were obtained from Tong et al. [8]:

Table 1: List of primers used for gene expression analysis of cryopreserved PDGFRα-positive cells using qPCR. The below primer sequences were obtained from the study by Tong et al. [8].

Gene	GenBank No.	Forward Primer (5’-3’)	Reverse Primer (5’-3’)	Product size (bp)
GAPDH	NM_002046	GAAATCCCATCACCATCTTCCAGG	GAGCCCCATGCAGCCTTCTCCATG	120
p53	NM_000546	TGCGTGTGGAGTATTTGGATG	GTGTGATGATGGTGAGGATGG	168
AGG	NM_013227	TCGAGGACAGCGAGGCC	TCGAGGGTGTAGCGTGTAGAGA	85
ALP	NM_000478	TGGAGCTTCAGAAGCTCAACACCA	ATCTCGTTGTCTGAGTACCAGTCC	454
FSP-1	NM_019554	AGCTTCTTGGGGAAAAGGAC	CCCCAACCACATCAGAGG	200
CD-44	NM_001001392	TGCCGCTTTGCAGGTGTAT	GGCCTCCGTCCGAGAGA	70
HAS3	NM_005329	TGTGCAGTGTATTAGTGGGCCCTT	TTGGAGCGCGTATACTTAGTT	177
TIMP-1	NG_012533	TTTCTTGGTTCCCCAGAATG	CAGAGCTGCAGAGCAACAAG	99
COL I	NM_000089	AACAAATAAGCCATCACGCCT	TGAAACAGACTGGGCCAATGTC	101
ELA	NM_001081755	AAAGCAGCAGCAAAGTTCGG	ACCTGGGACAACTGGAATCC	274
DEC	NM_133503	GATGCAGCTAGCCTGAAAGG	TCACACCCGAATAAGAAGCC	274

2.6. Protein expression analysis of differentiated PDGFRα-positive cells using western blotting

Nitrocellulose membranes; Biorad laboratories, Hercules, CA, USA; Catalogue no.1620112.
M-PER™ mammalian protein extraction reagent (Catalogue no.78505) with the HALT™ protease inhibitor cocktail (Catalogue no.78429); Thermo Fisher Scientific, Waltham, MA, USA.
Bradford reagent; Biorad Laboratories, Hercules, CA, USA; Catalogue no.5000205.
Anti-ALP (1:1000; Catalogue no. ab83259; RRID: AB_1859833), anti-CD44 (1:2000; Catalogue no. ab189524; RRID: AB_2885107), anti-S100A4 [FSP-1] (1:500; Catalogue no. ab124805; RRID: AB_10978091) and anti-aggrecan [AGG] (1:100; Catalogue no. ab3778; RRID: AB_304071); Abcam, Cambridge, UK.
Anti-β actin; Sigma Aldrich, St. Louis, MO, USA; Catalogue no. A1978; RRID: AB_476692.
Secondary antibodies: Anti-mouse IgG (Catalogue no. 7076S; RRID: AB_330924) and anti-rabbit IgG (Catalogue no. 7074S; RRID: AB_2099233); Cell Signaling Technology, Danvers, MA, USA.
Clarity Western ECL substrate reagent; Biorad Laboratories, Hercules, CA, USA; Catalogue no.170-5060.

Standard preparations of washing, blocking, running, transfer, and tris-buffer were used for western blotting. 10% of resolving and 4% of stacking gel composition were used for gel preparation.

1. Complete media: MEM-α and DMEM

To MEM-α (Materials and reagents #2.1d), 0.292g/L of L-glutamine (Materials and reagents #1f), 10% heat inactivated FBS (Materials and reagents #2.1e) and 1 % Penicillin-Streptomycin (Materials and reagents #2.1g) were added. To DMEM (Materials and reagents #2.1m), 10% heat inactivated FBS (Materials and reagents #2.1e) and 1 % Penicillin-Streptomycin (Materials and reagents #2.1g) were added.

2. Fibroblastic differentiation medium

Complete MEM-α supplemented with 100ng/L CTGF (Materials and reagents# 2.1h) and 50µg/mL LAA (Materials and reagents #2.1i).

Nanodrop 2000 spectrophotometer; Thermo Fisher Scientific, Waltham, MA, USA.
Veriti Thermal Cycler; Applied Biosystems, Foster City, CA, USA.
Rotor-Gene Q PCR system; Qiagen, Hilden, Germany.
BD FACS Aria™ III sorter; BD Biosciences, Franklin Lakes, NJ, USA.
Olympus Optical Microscope; Model CKX53SF, Tokyo, Japan.
Centrifuge: Rotanta 460 R; Hettich Zentrifugen, Tuttlingen, Germany and Prism R, Labnet International LLC, Edison, NJ, USA.
Chemi-Doc visualizer; Biorad Laboratories, Hercules, CA, USA.
Rotor-stator cell homogenizer; Pro Scientific inc., Oxford, CT, USA.
Microplate ELISA reader (ELx808); BioTek, Winooski, Vermont, USA.
CO₂ incubator (HERAcell 240i); Thermo Fisher Scientific, Waltham, MA, USA.
-80°C freezer (TSE series); Thermo Fisher Scientific, Waltham, MA, USA
Liquid nitrogen tank; Thermo Fisher Scientific, Waltham, MA, USA.
Water bath (WB-010D); NS Biotec, Alexandria, Egypt.
-20°C freezer and 4°C fridge; Frimed Medizintechnik, Tuttlingen, Germany.

GraphPad Prism 9 (RRID: SCR_002798)
ImageJ Version 15.3m (RRID:SCR_003070)
FlowJo Version v10 (RRID:SCR_008520)
Biorender (RRID: SCR_018361)

6.1. Cell culture and fibroblastic differentiation

Telomerase transformed iMSCs (Materials and reagents #2.1a) were cultured in complete MEM-α (Media recipes #1) in a humidified atmosphere of 5% CO₂ at 37°C (Equipments #4.10) in T-75 tissue culture flasks (Materials and reagents #2.1j).
Cells were harvested at 80% confluency by adding 500ul of 0.25% trypsin-EDTA solution (Materials and reagents#2.1k) and incubating for 1min at 37°C (Equipments #4.10).
iMSCs were then plated in 6 well plates (Materials and reagents #2.1b) at a density of 250× cells/well.
When the cells reached 70-80% confluency, a fibroblastic differentiation medium (Media recipes #2) was added.
The medium was changed every day for 21 days.
iMSCs (Materials and reagents #2.1a) cultured in MEM-α were used as a negative control, and primary human fibroblasts [F180] (Materials and reagents #2.1b) cultured in DMEM were used as a positive control in the absence of CTGF and LAA.
The differentiated PDGFRα-positive cells were subsequently harvested on the 21^st day for storage through cryopreservation for future studies.

6.2 Cryopreservation of the differentiated PDGFRα-positive cells

On day 21, the differentiated PDGFRα-positive cells were washed twice with PBS (Materials and reagents #2.2c) to remove the old media.
Subsequently, 100µL of trypsin-EDTA (Materials and reagents #2.2b) was added and distributed over the entire surface area of the wells, ensuring complete coverage of the adherent cell layer and incubated at 37°C for 2 mins (Equipments #4.10).
The differentiated cells were observed under the microscope (Equipments #4.5) to confirm complete detachment. Fresh complete media (MEM-α, Media recipes #1) was added to the cells, dispersed by gentle repeated pipetting to avoid clumping and achieve single-cell suspension. Similarly, for the controls, iMSCs were resuspended in MEM-α, and fibroblasts were resuspended in DMEM (Media recipes #1).
The cell suspension was then collected in 15ml falcon tubes and centrifuged (Equipments #6) at 1500 rpm (g-101) at 24°C for 5 mins.
The supernatant was discarded, and the pellets were resuspended in 90% of fresh complete media (Media recipes #1), to which 10% of cryoprotectant (DMSO; Materials and reagents #2.2c) was added dropwise.
The above cell suspension was distributed into cryovials with approximately 1x10⁶ cells per vial (Materials and reagents #2.2a)
The cryovials were then stored in a -80°C freezer (Equipments #11) for 24 hours up to 1-week; they were transferred to a liquid nitrogen tank (Equipments #4.12) until the future use.

6.3 Thawing and sub-culturing of the differentiated PDGFRα-positive cells

The frozen cell suspension in cryovial stored at -80°C/liquid nitrogen (Equipments #4.11) was thawed in a 37°C water bath (Equipments #4.13) for less than a minute with gentle swirling after which it was transferred into a 15 mL sterile tube. An additional 4-6mL of complete media (Media recipes #1) was added to this tube.
The above tube with cells was centrifuged (Equipments #4.6) at 1500rpm for 5 mins at 24°C to get rid of DMSO.
The supernatant was discarded, and the pellet was resuspended in 4-6 mL of complete media, after which the cell suspension was transferred into a T-25 culture flask (Materials and reagents #2.1j) and incubated at 37°C with 5% CO₂ (Equipments #4.10).
The cells were observed over the following few days, and media was changed every 2 days until the cells were healthy and reached 60-80% confluency. They were sub-cultured and used for further experimentation.

6.4 Measuring cell viability using MTT

1) Two sets of PDGFRα-positive cells were used for MTT analysis: pre-cryopreservation on day 21 (Group 1: before freezing) and post thawing after 3-4 weeks (Group 2: after freezing).

2) Approximately 1 × 10⁴ PDGFRα-positive cells were seeded in triplicates in 96-well plates (Materials and methods #2.3b) and maintained in 200μL complete MEM-α medium (Media recipes #1) at 37 °C with 5% CO2 (Equipments #4.10).

2) After 72 hours, the old culture medium was discarded, and 20μL of MTT (5 mg/mL; Materials and methods #2.3a) dissolved in 100μL of PBS (Materials and methods #2.3d) was added to each well.

3) Plates were incubated for 2h at 37 °C (Equipments #4.10).

4) The MTT+PBS solution was discarded carefully, following which 100μL of DMSO; (Materials and methods #2.3f) was added per well.

5) Absorbance was recorded at 570 nm on a microplate reader (Equipments #4.9). Figure 1 shows absorbance values for Group 1 and 2 with a minor (2.3%), a non-significant difference.

6.5 Confirming the presence of cell surface markers of differentiated PDGFRα-positive cells using flow cytometry analysis

PDGFRα-positive cells and the positive and negative control cells were harvested using 0.5% trypsin-EDTA (Materials and methods #2.4h).
5× cells were counted using a hemocytometer (Materials and reagents #2.4d).
The cells were centrifuged (Equipments #6) at 6000 RPM for 15 min at 4°C to obtain a pellet.
The pellet was washed twice with Dulbecco’s Phosphate Buffered Saline (PBS; Materials and reagents #2.4e).
The cells were resuspended in 100µL of FACS buffer containing 2% FBS and 1mM EDTA (Materials and reagents #2.4f).
Recommended volumes (as per the manufacturer) of specific cell surface markers were added. The markers used were as follows: CD-34-PE (Materials and reagents #2.4a), CD-44-APC (Materials and reagents #2.4b) and CD-140α-BB515 (Materials and reagents #2.4c).
Cells were incubated at room temperature for 15 to 20 mins with respective antibodies in separate flow cytometry tubes before detection.
A minimum of 15000 gated events with forward and side light scatter characteristics were collected for analysis using BD FACS Aria™ III sorter (Equipments #4.4). Figure 2 illustrates maintenance of differentiation in PDGFRα-positive cells post thawing after 3-4 weeks of cryopreservation (Group 2) as obtained from flow cytometry analysis. Figure 3 shows functional validation of freshly differentiated PDGFRα-positive cells before cryopreservation (Group 1) and is published in our previous study [1].

6.6 Gene expression analysis for validation of the cryopreserved and differentiated PDGFRα-positive cells

RNA isolation and cDNA synthesis

RNA was isolated from PDGFRα-positive cells along with iMSCs (negative control; Materials and reagents #2.1a) and fibroblasts (positive control; Materials and reagents #2.1b) and using PureLink® RNA Mini Kit (Materials and reagents #2.4a) using the manufacturer’s protocol.
Due to many cells, lysis was done by sonication using a rotor-stator cell homogenizer (Equipments #4.8) for 30 to 45 seconds.

RNA was eluted in 50µL of RNase-free water and quantified using Nanodrop 2000 spectrophotometer (Equipments #4.1)

Purity was determined using the ratio A260/A280.
5µg of the purified RNA was reverse transcribed to cDNA in a final reaction volume of 20µL using the High-capacity cDNA synthesis kit (Materials and reagents #2.4b) in a Veriti thermal cycler (Equipments #4.2) as per manufacturer’s instructions.

Relative fold change analysis by quantitative real-time PCR

Quantitative real-time PCR (qPCR) was performed using the Qiagen Rotor-Gene QPCR system (Equipments #4.3) with GoTaq®SYBR green master mix (Materials and reagents #2.4c) in a total reaction volume of 20
Cycling parameters used were as follows: initialization at 95°C for 2 mins; denaturation at 95°C for 15 seconds; annealing/extension at 60°C for 1 min; total cycles = 40.
Purity confirmation of PCR product was done by melt curve analysis using sequential heating at 95°C for 15 seconds, 60°C for 1 min, and 95°C for 15 seconds.
A list of primer sequences used for specific gene amplification of extracellular matrix and stem cell differentiation markers is given in Table 1 (Materials and reagents #2.4e).
The relative fold change was obtained using the 2^-ddCt method using the housekeeping gene glyceraldehyde-3 phosphate dehydrogenase (GAPDH) (Materials and Reagents #2.4e). Figures 3 and 4 show the gene expression analysis results for extracellular matrix proteins and stem cell differentiation markers, respectively, adapted from our published study [1].

6.7 Protein expression analysis of differentiated PDGFRα-positive cells using western blotting

Approximately 1× PDGFRα-positive cells along with iMSCs (negative control; Materials and reagents #2.1a) and fibroblasts (positive control; Materials and reagents #2.1b) were used for protein lysis.
Protein lysis of the cells was carried out using the M-PER™ mammalian protein extraction reagent with the HALT™ protease inhibitor cocktail (Materials and reagents #2.5b) added to it in a 1:1000 dilution.
Protein lysates were prepared as per the manufacturer’s instructions and quantified using Bradford reagent (Materials and reagents #2.5c) using a microplate ELISA reader (Equipments #4.9).
50µg of protein was loaded onto 10% SDS-PAGE gels for western blotting.
The gels were transferred onto nitrocellulose membranes (Materials and reagents #2.5a).
The membranes were incubated with blocking buffer (Media recipes #2) for 1 hour at room temperature.
Primary antibodies for the genes were added as mentioned in Materials and Reagents #2.5d and e.
The above antibodies were incubated overnight at 4°C (cold room).
The next day, membranes were incubated for 1 hour at room temperature with the appropriate secondary antibodies (Materials and reagents #2.5f).
The membranes were visualized using Clarity Western ECL substrate reagent (Materials and reagents #2.5g) in a Chemi-Doc visualizer (Equipments #4.7).
The proteins were quantified and analyzed using ImageJ (Softwares #5b). Figure 5 shows the results of the protein expression analysis for stem cell differentiation markers and is adapted from our previous study [1].

The main advantages of developing the present protocol were reducing the time taken to differentiate PDGFRα-positive cells, making the cells readily available for functional studies, reducing the cost of reagents, and achieving more excellent reproducibility. MTT viability assay has revealed a non-significant difference in cell survival before and after freezing, indicating no adverse effects of long-term storage on the cells comparable to the freshly differentiated cells. Validation experiments using flow cytometry have shown that the efficiency of differentiation is due to increased expression of the CD140α cell surface marker, also known as PDGFRα. Gene and protein expression analysis has also highlighted the intact functional capacity of these cells to be used for further experimentation. Comparing the outcomes with relevant positive and negative control cells cultured simultaneously further provides proof of maintained differentiation. However, future studies, including cell population analysis, are warranted to reveal important information about the ratio of differentiated vs. non-differentiated cells in this homogenous population.

AGG Aggrecan

ALP Alkaline Phosphatase

COL I Collagen type I.

CTGF Connective Tissue Growth Factor

DEC Decorin.

DM Diabetes Mellitus

ECM Extracellular Matrix

EDTA Ethylenediaminetetraacetic acid

ELA Elastin.

PDGFRα-positive cells Platelet-derived growth factor receptor-α-positive cells

iMSCs Telomerase transformed mesenchymal stromal cells

LAA L-ascorbic acid

iMSCs telomerase transformed mesenchymal stromal cells

TIMP1 Tissue Inhibitor of Metalloproteinases 1

HAS3 Hyaluronic Acid Synthase 3

SK3 Small conductance calcium-activated potassium channel.

Ethics approval and consent to participate: Not applicable.

Consent for publication: Not applicable.

Availability of data and materials: The datasets used and analyzed during the current study are available from the corresponding author on reasonable request.

Competing interests: The authors declare no competing interests.

Funding: Boehringer Ingelheim (UOS-B12018), University of Sharjah (1701090129-P) and Al Jalila Foundation (AJF2018082).

Authors' contributions: AS conceptualized the long-term usage of differentiated PDGFRα-positive cells. BMM validated the idea as a follow-up of differentiation of iMSCs into PDGFRα-positive cells. BMM supported the study by research grants from Boehringer Ingelheim, University of Sharjah, and Al Jalila Foundation. AS and SHA performed and analyzed validation experiments. AS and RR drafted the manuscript. BMM, AAK, and SHA edited and revised the manuscript. All authors approved the final draft of the manuscript.

Acknowledgements: The authors would like to thankMr. Manju N.J. (Sharjah Institute of Medical Research, University of Sharjah) for providing technical support in flow cytometry analysis.

Conflicts of Interest: The authors declare no conflict of interest

Mussa, B.M.; Khan, A.A; Srivastava, A.; Abdallah S.H. Differentiated PDGFRα – positive Cells: A Novel In-Vitro Model for Functional Studies of Neuronal Nitric Oxide Synthase. Intl.J. Mol. Sci. 2021, 22, 3514.
Camilleri, M. Diabetic Gastroparesis.N.Engl. J. Med 2007, 356, 820–829 [CrossRef] [PubMed]
Vannucchi, M.G. The Telocytes: Ten years after their introduction in the scientific literature. An update on their morphology., distribution, and potential roles in the gut. Int. J. Mol. Sci. 2020, 21, 4478. [CrossRef] [PubMed]
Horiguchi, K.; Komuro, T. Ultrastructural observations of fibroblast-like cells forming gap junctions in the W/W (nu) mouse small intestine. J.Auton. Nerv. Syst. 2000, 80, 142–147. [CrossRef]
Iino, S,;Horiguchi, K.; Horiguchi S.; Nojyo, Y. c-Kit negative PDGFRα- positive express platelet- derived growth factor receptor α in the murine gastrointestinal musculature. Histochem. Cell Biol. 2009, 131,691–702. [CrossRef] [PubMed]
Iino, Nojyo, Y. Immunohistochemical demonstration of c-Kit negative PDGFRα- positive in the murine gastrointestinal musculature. Arch Histol. Cytol. 2009, 72, 107–115. [CrossRef]
Kurahashi, M.; Zheng, H.; Dwyer, L.; Ward, S.M..; Koh, S.D; Sanders, K.M. A functional role for the ‘fibroblast-like cells’ in gastrointestinal smooth muscles. J. Physiol. 2011, 589, 697–710. [CrossRef] [PubMed]
Tong, Z.; Sant, S.; Khademhosseini, A.; Jia,X. Controlling the fibroblastic differentiation of mesenchymal stem cells via the combination of fibrous scaffolds and connective tissue growth factor. Tissue Eng. Part A 2011, 17,2773–2785. [CrossRef]
Xu, C.; Jiang,J.; Sotille, V.; McWhir,J.; Lebkowski,J.; Carpenter, M.K Immortalized Fibroblast-like cells derived from human embryonic stem cells support undifferentiated cell growth. Stem Cells 2004, 22,972–980. [CrossRef] [PubMed]

No competing interests reported.

floatimage1.png
Graphical abstractCryopreservation, thawing, and maintenance of differentiated PDGFRα-positive cells. iMSCs were treated with connective tissue growth factor (CTGF) and L-ascorbic acid (LAA) for 21 days to allow their differentiation into PDGFRα-positive cells. Post day 21, the cells were cryopreserved for 3-4 weeks as a new approach, then thawed and sub-cultured. The survival of the cells was assessed using MTT assay, and functional validation was conducted using flow cytometry for detection of cell surface markers, qRT-PCR for gene expression analysis, and western blotting for protein expression analysis. Image created with BioRender.com (RRID: SCR_018361).

Download PDF

Version 1

posted

You are reading this latest preprint version

Cryopreservation and validation of differentiated PDGFRα-positive cells for long term usage in experimentation

Status:

Version 1

Abstract

Background

Results

Conclusions

Figures

1. Background

2. Materials And Reagents

3. Media Recipes

4. Equipments

5. Softwares

6. Procedures

7. Discussion

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1