Infectious diseases in rising riding-horse and donkey milk industry: First detection of Neospora sp. antibodies in donkeys in Turkey

doi:10.21203/rs.3.rs-1454386/v1

PDF

Research Article

Infectious diseases in rising riding-horse and donkey milk industry: First detection of Neospora sp. antibodies in donkeys in Turkey

https://doi.org/10.21203/rs.3.rs-1454386/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted 21 Mar, 2022

You are reading this latest preprint version

The present study was aimed to investigate the prevalence of some protozoa (B. caballi, T. equi, T. gondii, Neospora sp.) and viral agents (equine influenza, equine viral arteritis, equine herpesviruses) of equids in Balikesir and its surroundings, in Turkey. Plasma and serum samples were collected from 66 horses and 96 donkeys. Babesia caballi, T. equi, Neospora sp. antibodies were detected with c-ELISA while T. gondii antibodies with the Sabin Feldman Dye test. Viral agents were detected by using the PCR technique. The prevalence rates of the protozoa in horses were 12.12% for B. caballi, 34.84% for T. equi, 9.09% for T. gondii, and 10.6% for Neospora sp. respectively. The molecular prevalence of the viral agents was detected as 3.03% for equine influenza virus, and 6.06% for equine herpesvirus 5. Equine viral arteritis virus and other herpesviruses (1,2 and 4) were not detected (0%) in any of the samples. However, the rates of seropositivities in donkeys were B. caballi 1.69%, T. equi 71.87%, T. gondii 90.62%, Neospora sp. 23.95%, equine influenza virus 1.04%, equine viral arteritis virus 0%, equine herpesvirus-5 3.12%, and other herpesviruses 0%. The results indicated that T. equi was more prevalent than B. caballi in both species. This study is important about being is the first study in Turkey that reported the existence of anti-Neospora sp. antibodies in donkeys, and the seroprevalence of T. gondii west side of the country in horses and donkeys.

Equine

Seroprevalence

Virological agent

Toxoplasma gondii

Neospora sp.

The obligatory intraerythrocytic protozoa Babesia caballi and Theileria equi cause equine piroplasmosis, a tick-borne disease (Mehlhorn and Schein 1998). Ticks of the genera Dermacentor, Hyalomma, and Rhipicephalus are the main vectors of both haemoprotozoan parasites (De Waal 1992). Equine piroplasmosis is widespread in tropical and subtropical areas, and its distribution is dependent on the presence of vectors (Brünning 1996). In equids, piroplasmosis can be acute, subacute, or chronic (Rampersad et al. 2003). However, the disease is commonly observed in subclinical form and, after sick animals recovered from the diseases they can transform into long-term carriers (De Waal and Heerden 1994). Clinical symptoms of equine piroplasmosis include icterus, fever, anemia, hemoglobinuria, and bilirubinuria. The movement of equids between countries and continentals has led to the spread of the disease from endemic to non-endemic areas.

Toxoplasma gondii is a zoonotic and obligate intracellular apicomplexan parasite that can nearly infect all warm-blooded animals. Domestic and wild felids are the definitive hosts of the parasite, and they shed the oocysts with their feces (Dubey 2010). Besides transplacental transmission, ingestion of tissue cysts in raw or undercooked meat and milk, and consumption of water contaminated with oocysts are some of the important reasons for infection in humans (Dubey 2009; Machacova et al. 2014). Additionally, the DNA of the parasite has been determined in milk and blood from naturally infected donkeys (Mancianti et al. 2014). Severe toxoplasmosis may occur in immunocompromised animals but generally, T. gondii causes subclinical infection in equids (Dubey and Lindsay 2006; Dubey 2010). However, Kimble et al. (2021) reported that clinical toxoplasmosis was determined at necropsy in a horse that has shown colic, fever, soft feces, and increased liver enzymes; and this report is important regarding it is the first reported clinic toxoplasmosis case in this species. Furthermore, James et al. (2017) reported that they found a significantly important relationship between T. gondii seropositivity and horses showing neurologic symptoms that are compatible with equine protozoal encephalomyelitis.

Neospora sp. is a ubiquitous and obligate intracellular Apicomplexa cyst-forming coccidian closely related to Sarcocystis sp. and T. gondii that belong to the Sarcocystidae family (Cazarotto et al. 2016; Wang et al. 2016). In many different species, Neospora sp. is one of the prominent causes of neurological disease and abortion (Dubey and Lindsay 2006; Dubey et al. 2017). Neospora caninum has been reported in several warm-blooded animal species including horses; furthermore, it is a major cause of abortion and economic loss in cattle breeding (Marsh et al. 1998; Dubey et al. 2017). In recent years, with increasing interest in donkeys using as a pet, onotherapy, and particularly as a milk source for children who have suffered from cow milk allergy (Machacova et al. 2013). Additionally, in some countries, donkeys are grown not only for their meat to eat but also for use in traditional Chinese medicinal purposes (Bennett and Pfuderer 2020). Although using donkeys increase, the seroprevalence of Neospora sp. in donkeys have been reported several countries such as Nigeria (Bartova et al. 2017), Brazil (Galvao et al. 2015), Mexico (Alvarado-Esquivel et al. 2017), Southern Italy (Machacova et al. 2013), and China (Cong et al. 2018).

Many viral diseases are important in horse breeding and some industries (racehorse, show horse, riding horse, etc.). Among these diseases, there are many diseases that settle in the respiratory system (equine influenza virus, etc. (Timurkan and Aydin 2019), digestive system (Equine rotavirus, etc. (Alkan et al. 2013) and genital system (Equine herpesviruses, etc. (Dagalp et al. 2018). Furthermore, herpesviruses are more important as they settle in both the respiratory and genital systems.

Herpesviridae is divided into three subfamilies; these are Alphaherpesvirinae, Beta-, and Gamma- (Davison 2010). Equine herpesvirus 1 (EHV-1) and Equine herpesvirus 4 (EHV-4) are DNA viruses that are classified in Alphaherpesvirinae (Patel and Heldens 2005). Smith et al. (2003) reported that EHV-1 is responsible for the major part of the herpesvirus abortions nevertheless, EHV-4 is also responsible for the minor part of the abortions that are caused by the herpesvirus. While EHV-1 causes abortion in mares, neurological disease, and respiratory disease in young animals, EHV-4 is commonly responsible for pulmonary disorders. Both EHV-1 and EHV-4 are endemic in horse populations and show worldwide distribution (Turan et al. 2012; Dagalp et al. 2018). Equine herpesvirus 2 (EHV-2) and equine herpesvirus 5 (EHV-5) are classified in Gammaherpesvirinae and both of them also show global distribution such as EHV-1 and EHV-4 (Reubel et al. 1995; Marenzoni et al. 2010). Generally, it is considered EHV-2 is more prevalent than EHV-5 (Borchers et al. 1999; Nordengrahn et al. 2002). Although symptoms caused by EHV-2 are well described, there is little information on symptoms that are caused by EHV-5. While EHV-2 causes immunosuppression, keratoconjunctivitis, pharyngitis, ulcerative lesions of the oral mucosa, upper respiratory tract signs, and poor race performance (Kershaw et al. 2001; Galosi et al. 2005; Vengust et al. 2008), EHV- 5 may cause upper respiratory tract signs and equine multinodular pulmonary fibrosis (Nordengrahn et al. 2002; Marenzoni et al. 2011).

Equine influenza virus (EIV) is a member of the Orthomyxoviridae family that causes severe acute respiratory disease and infected horses show characteristic clinical signs of the disease such as pyrexia, dyspnoea, anorexia, and coughing (Madic et al. 1996; Timurkan and Aydin 2019). Equine influenza virus has two different subtypes of influenza A virus: H7N7 and H3N8 (Madic et al. 1996). H7N7 doesn't cause epidemics commonly, it is generally isolated from subclinically ill horses, however, epidemics caused by the H3N8 viruses can be observed frequently worldwide (Madic et al. 1996; Daly et al. 2004).

Equine viral arteritis (EVA) is a contagious and acute disease of equids occurred by the equine arteritis virus, and its clinical symptoms include anorexia, depression, leucopenia, edema, urticaria, abortion, and severe pneumonia in foals (Del Piero et al. 1997). Although the disease causes many different clinical signs, most of the infections are subclinical or infrequently noticeable (Balasuriya 2014). Although EVA can cause important economic loss, except for young, old, and immunosuppressed animals death can be observed rarely (Timoney et al., 1996; Glaser et al. 1997). There is no report about EVA transmission between equids and other species, although it is reported that EVA infected dogs (Crawford et al. 2005).

The present study was carried out in horses and donkeys in Balikesir province of Turkey to detect seroprevalence of some protozoa (T. equi, B. caballi, T. gondii, and Neospora sp.), and molecular detection of some viruses (EHV-1, EHV-2, EHV-4, EHV-5, EIV, and EVA). Furthermore, the objective of this study was to investigate the differences in the prevalence of the diseases between regions.

Study design and sample collection

A cross-sectional study was designed to analysis the prevalence of T. equi, B. caballi, Neospora sp., and T. gondii, the seroprevalence of EIV, EVA, EHV 1, 2, 4, and 5 in horses and donkeys at Balikesir province from the Southern Marmara region of Turkey. Blood samples were collected from horses and donkeys that live in five different points and the approximate coordinates of the points were 39° 34´N 26° 59´E, 39° 12´ N 28°18´E, 38 37´N 27° 23´E, 39 44´N 27° 28´E, 39° 40´N 27° 55´E. The inclusion criteria of samples in this study were living in Balikesir province and its surroundings, apparently healthy animals. Additionally, all the blood samples were collected just for serologic surveillance not for therapeutic purposes.

Horses were of various breeds and their ages were between 6 months to 20 years their mean of age was 7.3 years, and of 64 horses, 23 (35%) were female and 43 (65%) were male. Donkeys were also of various breeds and their ages were between 3 months to 17 ages and their mean of age was 6.4, and of 96 donkeys, 94 (98%) were female and 2 (2%) were male.

All blood samples were collected from the jugular vein via vacutainer. Collected whole blood samples were centrifuged at 2000 rpm for 5 minutes on the same day, and after separation of the sera, the samples were stored at -80°C until analysis. Hemogram analyses were performed using Abacus Junior Vet 5 - Diatron immediately after the collection of blood samples to assess the health status of animals. Animals that were found to be sick according to the results of haematological analysis were not included in the study.

Serological examination methods

Theileria equi and Babesia caballi analysis method

A competitive enzyme-linked immunosorbent assay (cELISA) method was used for the detection of B. caballi and T. equi agents. Veterinary Medical Research & Development cELISA catalog no: 273-2 (VMRD®, Pullman, USA). Similarly, in T. equi, Veterinary Medical Research & Development cELISA catalog no: 274-2 was used (VMRD®, Pullman, USA). The analyses were made following the manufacturer's instructions (Xu et al., 2003). Average optical density (OD) at 630 nm wavelength for each microplate will be determined using ELISA reader (ELx 800 UV, Universal Microplate Reader, Bio-Tec Instrumens, Inc). Percent inhibition value for each sample will be calculated by the formula % I = 100- [(sample O.D. value X 100) ÷ (O.D. value of the mean of negative controls)]. Samples with a percent inhibition value ≥ of 40 will be considered positive, while samples <40 will be considered negative.

Toxoplasma gondii analysis method

For T. gondii analysis Sabin Feldman Dye test (SFDT) used (Sabin and Feldman,1948). Sabin Feldman Dye was performed in the Parasitology Laboratory of Refik Saydam Epidemic Diseases Research Directorate. In this analysis, the T. gondii Tr-01 strain was investigated and antibody titer of 1/16 and over was accepted to be positive.

Neospora sp. analysis method

For analysis of Neospora sp., a c-ELISA test kit (VMRD®, Pullman, USA) was used to detect anti-Neospora sp. antibodies (Machacova et al. 2013). Average optical density (OD) at 630 nm wavelength for each microplate will be determined in an ELISA reader (ELx 800 UV, Universal Microplate Reader, Bio-Tec Instrumens, Inc). Percent inhibition value for each sample will be calculated by the formula % I = 100- [(sample O.D. value X 100) ÷ (O.D. value of the mean of negative controls)]. Samples with a percent inhibition value ≥ of 30 will be considered positive, while samples <30 will be considered negative.

Virological analysis method

Preparation of blood samples

After the blood samples were centrifuged at + 4°C, 2000 rpm, for 20 minutes, 200 µl was taken from the upper liquid and buffy coat to be transferred to an RNAase-free sterile 1.5 ml tube. It was stored in sterile tubes at -80°C.

Viral nucleic acid extraction

The RNA and DNA of the viruses to be investigated were obtained using the GF-1 Viral Nucleic Acid Extraction Kit (Vivantis, Malaysia). With this kit, total nucleic acid was isolated from the samples using a silica gel spin column.

Reverse transcription of viral RNA

Revert Aid ™ First Strand cDNA Synthesis Kit (Thermo Scientific, Germany) was used for reverse transcription of RNA viruses from nucleic acids obtained after extraction.

Polymerase chain reaction (PCR) technique

Some of the viral infections of horses were examined in our study. For this purpose, 6 different infections were screened: Equine viral arteritis, Equine influenza virus, Equine herpesvirus 1, Equine herpesvirus 4, Equine herpesvirus 2, and Equine herpesvirus 5. To obtain the relevant products for the gene regions of the relevant viruses, a PCR reaction was performed using the primers and method reported in Table 1. For the gene regions used in the study, PCR mix components and time/cycle information of the PCR cycle are given in Table 2.

Agarose gel electrophoresis of PCR products

To visualize the amplification products, 1% agarose (Prona, Germany) containing ethidium bromide (Safe view classic, ABM, Canada) was prepared. The PCR products were carefully placed into the wells formed by removing the combs by mixing with the loading dye (6x Loading Dye, Thermo scientific, Germany). 1 μl of a 100 bp marker (Thermo scientific, Germany) solution was loaded to determine the approximate product size. Then, the products were subjected to electric current, and the DNA bands formed as a result of PCR were visualized by using gel imaging light approximately 25 minutes later.

Statistical analysis

Descriptive statistics were used to analyse the results of the whole blood and age. All statistical analysis was performed using SPSS 25.0 (SPSS Inc., Chicago, Illinois).

The numbers of B. caballi and T. equi seropositive and seronegative horses were found 8 (12.12%) and 58 (87.88%), 23 (34.84%), and 43 (65.16%); however, in donkeys were found 1 (1.69%) and 95 (99%), 69 (71.87%) and 27 (28.13%), respectively. For T. gondii, 6 (9.09%) of 66 horses were seropositive and 60 of them were seronegative (91%). In donkeys, 87 (90.62%) of them were seropositive and only 9 (9.38%) of them were seronegative. For Neospora sp. antibodies, out of a total of 66 horses, 7 (10.6%) horses were positive, 59 (89.4%) horses were negative, out of a total of 96 donkeys 23 (23.95%) positive, 73 (76.05%) were found to be negative. For equine influenza virus, while 2 (%3.03) horses found to be positive and 64 horses (96.97%) were found to be negative out of a total of 66 horses, out of a total of 96 donkeys, only a 1 (1.04%) donkey was found to be positive, and 95 donkeys found to be (98.96%) negative. For equine viral arteritis virus, no samples were found to be positive in both species. Except for the EHV-5, none of the samples was found to be positive for any herpesvirus strain. For EHV-5 out of a total of 66 horses, 4 (6.06%) horses were found to be positive and 62 (93.94%) were found to be negative, out of a total of 96 donkeys, 3 (3.12%) donkeys were found to be positive, and 93 (96.88%) donkeys were found to be negative. General data for seroprevalence of parasitic diseases and virologic detection in horses and donkeys are shown in Table 3 and Table 4 respectively. The whole blood analysis results are also described in Table 5.

In the present study, the seroprevalences of some important parasitological and virological agents were investigated in horses and donkeys in Balikesir and surroundings, in Turkey. According to the results, it can be suggested that piroplasmosis agents are generally common in both species except B. caballi, which is not common among donkeys. Nevertheless, T. equi was found that very common in donkeys contrary to B. caballi. Although B. caballi was detected at only one sampling point in both species, T. equi was commonly detected in all sampling points in both species. In contrary to this study, Acici et al. (2008) found that B. caballi were detected more prevalent than T. equi in both horses and donkeys. In parallel with this, Machado et al. (2012) reported that B. caballi and T. equi seroprevalence were 93% and 73% respectively in donkeys. However, Garcia-Bocanegro et al. (2013) reported parallel results with our study; B. caballi in horses 7%, in donkeys 17%, T. equi in horses 48%, in donkeys 47% were detected in Southern Spain. Furthermore, Oduori et al. (2015) reported seroprevalences for T. equi and B. caballi were found 81% and 0% in donkeys respectively. When considered that the chronic form of T. equi is more prevalent in donkeys than horses, and the acute form of the disease is rarely observed in donkeys, it can be suggested that the results of the study are highly compatible with our results (Kumar et al., 2009; Wise et al., 2014). Theileria equi was detected significantly higher than B. caballi in both species and it can be suggested that our results are in agreement with previous reports from endemic countries (Salim et al. 2008; Sigg et al. 2010; Garcia-Bocanegra et al. 2013; Oduouri et al. 2015).

In this study, a prominent difference was found between the T. gondii seroprevalences of both species. In humans and horses, an association has been described between low-income and increased exposure to T. gondii. The high exposure to the parasite may be caused by poor sanitary conditions associated with low-income populations which may increase the chance of contamination in water sources or else. (Li et al. 2020; Rostami et al. 2020). In parallel with this, the donkeys that we collected blood samples had poor sanitary conditions when compared to the horses; it can explain the difference in the seroprevalence of the parasite between both species. The seroprevalence of the parasite in horses show highly variable between countries and it was detected ranges between %1 and %71 in Sweden (Jakubek et al. 2006) and Iran (Hajialilo et al. 2010) respectively. The difference in seroprevalence can result from hygiene conditions, managing, and feeding practices (Li et al. 2020; Tenter et al. 2000). From different countries in the world, different seroprevalence results are reported that the seroprevalence of the parasite is higher in donkeys than in horses; Brazil (Munhoz et al. 2019) 72% in donkeys and 27% in horses and parallel, other studies from Pakistan (Saqib et al. 2015) and Spain (Garcia-Bocanegra et al. 2012) can be suggested. However, because of are fewer studies evaluating both species in the same cohorts, it is difficult to determine that these results are caused by the naturally higher susceptibility of donkeys or poor sanitary conditions. Nevertheless, there are several suggestions that horses are considered to be naturally resistant to T. gondii infection (Dubey 2010) or they develop very low antibody titers to detect by serological tests (Evers et al. 2013). Likewise, Garcia-Bocanegra et al. (2012) reported that the seroprevalence of T. gondii was higher in the animals that are kept outdoor than are kept indoors. Additionally, Alvarado-Esquivel et al. (2017) stated that horses generally received better care about good feeding and drinking healthy water than donkeys. In this study, our results are compatible with the previous results, the higher seroprevalence in donkeys, reported from different countries (Garcia-Bocanegro et al. 2012; Saqib et al. 2015; Munhoz et al. 2019). Several studies were performed by Gazyagci et al. (2011), Karatepe et al. (2010), Akca et al. (2004), Göz et al. (2007) related the seroprevalence of T. gondii in horses in Turkey, and results of the studies were 36%, 7%, 20%, 28% respectively; it can be suggested that the result of this study (9.09%) is in agreement with the previous reports especially Karatepe et al. (2010). Nevertheless, there are not many investigations about the seroprevalence of T. gondii in donkeys from Turkey; Balkaya et al. (2011) was found the prevalence of the parasite 62%, and that is also compatible with our result. However, T. gondii is not only common in equids but also other mammalian such as sheep (98%) (Çiçek et al. 2011) and (31%) (Oncel and Vural 2006), cattle (93%) (Akca and Mor 2010), cat (35%) (Can et al. 2014), dog (62%) (Balkaya et al. 2010), and also human (58%) (Doni et al. 2015) in Turkey. It can be suggested that T. gondii is highly prevalent in Turkey both humans and other mammalians, and this is a very prominent problem according to public health.

Neosporosis is not considered to be zoonotic and its most important effect is the economic loss caused by the disturbance of the reproduction of cattle and small ruminants. (Dubey et al. 2017). However, due to the consumption of donkey and horse meat in some countries and increased interest in general using the animals, several studies were performed. Cong et al. (2018) and Gennari et al. (2016) found the seropositivity of the parasite in donkeys 10% and 2% respectively. Similarly, Waap et al. (2020) and Machacova et al. (2013) reported that the seroprevalence of the parasite is in horses and donkeys were 9% and 11% respectively. Bartova et al. (2017) found the seroprevalence of Neospora sp. was 8% in horses and all donkey was found to be negative. Kligler et al. (2007) found the seroprevalence of Neospora sp. in horses 12% and this result is prominently lower than the seroprevalence of the donkeys who live in similar geography of Israel. Besides the studies which were found low or no seropositivity. Gharekhani et al. (2013) found the seroprevalences of Neospora sp. were 40% and 52% in horses and donkeys, respectively. Also, Tirosh-Levy et al. (2020) found 70% in donkeys. Sevgili et al. (2003) found the seroprevalence of Neospora sp. 8% in Thoroughbred mares Sanliurfa in Turkey. In this study, Neospora sp. seroprevalences were found 10.6% and 23.95% in horses and donkeys respectively; it can be suggested that our results are compatible with previous reports (Machacova et al. 2013; Gennari et al. 2016; Bartova et al. 2017; Cong et al. 2018; Waap et al. 2020) especially those reported from the rural regions of Israel (Kligler et al. 2007). Furthermore, this report is important according to being the first report about the presence of anti-Neospora sp. antibodies in donkeys in Turkey.

Seroprevalence reports of EVA are globally inconsistent which is ranging from 0–20% between countries. It is considered that these changes between the seroprevalence depend on horse population and surveillance of the country (Maclachlan et al. 2006; Bello et al. 2007; Turan et al. 2007). In parallel, Nejat et al. (2015) found EVA antibodies at 4% in Iran, and Cruz et al. (2016b) found 16% in Spain. Similarly, Marenzoni et al. (2013) and Turan et al. (2007) were found the seroprevalence of EVA in horses in Turkey 16% and 14% respectively. Some reports from Turkey indicate relatively low seroprevalence in both horses and donkeys. While Gür et al. (2019) found the seroprevalence of EVA 3% in donkeys, Bulut et al. (2012) found 23% in horses. In this study, contrary to Marenzoni et al. (2013) and Turan et al. (2007), there was no sample determined to be positive for EVA in both of the species, in the same region in Turkey. It can be suggested that the seroprevalence of EVA is highly changeable not just in Turkey, even in the same region.

Many seroprevalence studies were performed regarding EIV in horses and donkeys, and its seropositivity rate is highly changeable. The seropositivity rate of EIV in horses was found at 38%, 11%, and 93% by Blitvich et al. (2010), Sajid et al. (2013), Happold and Rubira (2011) from Mexico, Pakistan, and Australia respectively. On the other hand, Sajid et al. (2013) and Chencev et al. (2011) were found the seropositivity rate of the virus 12% and 65% from Pakistan and Bulgaria in donkeys, respectively. Ataseven and Daly (2007) were performed a large-scale EIV seroprevalence study on more than six hundred equids from five different regions in Turkey. The overall seroprevalence of the virus was found 31%. The highest overall rate for EIV was found in the Marmara region (60%) where this study also performed and the seropositivity of horses (41%) was more than four-fold higher than donkeys (9%). According to Timurkan and Aydin (2019), 26.3% of antibodies were detected in a study conducted in eastern Turkey, in the province of Erzurum, in jereed horses, but they could not detect a virological positivity. Nevertheless, in this study virological prevalence of EIV was found 3% and 1% in horses and donkeys respectively. It can be suggested that our results are prominently low when the results of previous reports are considered. The reason for the seroprevalence difference between previous studies and this study can be the detection method of the virus. While in this study PCR method was used and antigens of the virus were detected, the ELISA method was used, and the virus-specific antibodies were detected in studies discussed before. So, it can be suggested that seroprevalence may be higher in studies conducted with ELISA than in studies conducted with PCR.

Many studies were performed about EHV-1, 2, 4, and 5 in both healthy and unhealthy horses that different and contrary results were found. Ata et al. (2020) were found the seroprevalence of EHV-1 64% in Monufia, Egypt. However, Amer et al. (2011) investigate the seroprevalence of EHV-1,2,4 via polyclonal antibody pool technical ELISA and they found the seroprevalence was 36% in Arabian horses in Egypt. Cruz et al. (2016a) reported that the seroprevalence of EHV-1 and EHV-4 in Spanish purebred horses were 26% and 2% in Spain respectively. In contrary to this report, Aharonson-Raz et al. (2014) reported the seroprevalence of EHV-1 and EHV-4 in horses were 0.7% and 99% in Israel respectively. Although EHV-1 and EHV-4 were detected in many studies that used, no positive samples were detected in this study. In Turkey, Yildirim et al. (2015) found the seroprevalence of EHV-1 and EHV-4 in horses 52% and 83% in Kars, respectively. Ataseven et al. (2009) found the seroprevalences of EHV-1 and EHV-4%4 and 71% in horses respectively from three different regions of Turkey. In another study conducted in Turkey, Dagalp et al. (2018), 3.4%, 58.6%, 58.6% and 75.9% were found positive for EHV-1, EHV-4, EHV-2 and EHV-5, respectively. It is important to note that, all the studies which are reported high seroprevalence were performed using either PCR or ELISA. It can be suggested that the reason for the low seroprevalences of EHV-1 and EHV-4 in our study was the inclusion of random but healthy horses, the use of PCR, and both viral agents caused subclinical infections. Negussie et al. (2017) investigated the seroprevalence of EHV-1,2,4, and 5 in equids with and without clinical symptoms. In horses with clinical symptoms, seroprevalences of both EHV-1 (8.1%) and EHV-4 (7.5%) were found to be low compared to the EHV-2 (25%) and EHV-5 (28%). Furthermore, in horses without clinical symptoms, the seroprevalences of EHV-2 and EHV-5 were 7% and 17% while no horses were positive for EHV-1 and EHV-4. Similarly, Akkutay et al. (2014) investigated the seroprevalences of EHV-2 and EHV-5 in horses with and without clinical signs and they found the results of the seroprevalences 59% and 62% respectively. Krisova et al. (2020) collected peripheral blood samples and ocular swabs in horses suffering from an ocular disease to investigate EHV-2 seroprevalence and the results were found 54% and 51% respectively. In parallel with previous reports, Borchers et al. (1997) investigated the seroprevalence of EHV-2 in horses with and without clinical symptoms, and the overall seroprevalence of the virus was 62% in horses with clinical symptoms. However, the seroprevalence of the virus in horses without clinical symptoms was 42%. According to our literature search, there are fewer studies related seroprevalence of herpesviruses in donkeys. Negussie et al. (2017) found many types of herpes virus in donkeys with clinical signs and their seroprevalences were EHV-1 19%, EHV-2 4%, EHV-4 9%, and EHV-5 7%. However, asymptomatic donkeys were all seronegative. Mekonen et al. (2017) found the seroprevalence of EHV-1/EHV-4 was 74% in donkeys. Similarly, Yildirim et al. (2015) found the seroprevalence of EHV-1 and EHV-4 85% and 64% respectively in donkeys that included in the study randomly. Wondimagegnehu et al. (2021) performed a seroprevalence study about EHV-2 and EHV-5 using PCR donkeys. EHV-2 seroprevalence was found higher in horses (54%) than donkeys (4%). In contrast, EHV-5 seroprevalence was found higher in donkeys (56%) than horses (18%). Ali and Mohammadi (2016) reported that EHV-1 was not detected in any donkeys or mules however, the seroprevalence of EHV-4 was 18% in donkeys and mules. Studies performed in Turkey, Ataaseven et al. (2009) reported that EHV-1 seroprevalence was 24% in donkeys. Additionally, Yildirim et al. (2015) EHV-1 antibodies were found in 85% of investigated donkey samples, and EHV-4 antibodies were found in 64.20% of these samples. EHV-2 positive equids were had clinical signs significantly higher proportion than negative equids. As stated before, the random collection of samples or inclusion of animals with clinical signs into the study, being used ELISA more than PCR can be important factors that increase the seroprevalences of equine herpesviruses in both species.

It has been observed that the results obtained as a result of the hematological examination carried out to evaluate the health status of horses and donkeys are in accordance with the reference values specified for both species (Aiello and Moses 2016; Trimboli et al. 2020).

In this study, the seroprevalence of many parasitological and virological agents was investigated by using different laboratory technics. Most of the samples came from unregistered animals with general use ownership. In Turkey's rural areas, these types of equids are used as transport and pack animals or in traditional gaming. Piroplasmosis can be considered prevalent in the territory. Theileria equi was found highly common in donkeys and this can be important according to be an infection source for horses that show high performance. Toxoplasma gondii was found high prevalence surprisingly in donkeys. Especially donkeys have been observed living in poor managing and health conditions such as their close contact with domestic felids, their free-ranging in the around. Considering the increase in donkey milk consumption and use in recent years, it is important to know the seroprevalence of T. gondii in donkeys. Furthermore, when their meats or carcasses are consumed by wild or domestic felids it can be a serious problem for public health due to the carnivores can be shed oocysts into the environment and water sources via their feces. Similarly, N. caninum can be important especially for ruminant breeding regarding causes abortions and other economic losses. None of the prevalence of viral agents was considered critically high. However, in this study, the seroprevalence of viral agents was determined only by PCR. Besides, it can be argued that the reason why the seroprevalence of viral agents is higher in horses compared to donkeys is that the horses are raised extensively and kept close.

As a result, this study is a comprehensive study investigating both protozoal and virological diseases in horses and donkeys, and similar studies from different regions of Turkey will provide valuable information about the prevalence of the aforementioned infectious agents, which are important for human and animal health. Moreover, this research is important because it is the first in Turkey to confirm the presence of anti-Neospora sp. antibodies in donkeys, as well as seroprevalence of T. gondii in horses and donkeys on the western side of the country.

Authors contribution

All authors contributed to the study conception and design. Material preparation, data collection performed by EB, UA, FK. Statistical analysis was performed by FK. Analyses was performed by, EB, FK, AEU, OT, UE and CB. The first draft of the manuscript was written by FK and EB, UA, AEU, OT, UE commented previous versions of the paper. All authors read the paper and approved the final version.

Funding

This research supported by Department of Scientific Research Project of Balikesir University. Project No: 2019/001.

Data availability

The datasets in this study are available from the corresponding author on reasonable request.

Ethics committee

The experimental procedures were approved by the Committee of Animal Experiments of Balikesir University. Approval number and date:2020/5-12, 20.08.2020.

Conflict of interest

Authors declare that there is no conflict of interest.

Consent to participate

All authors participated and helped voluntarily in the research.

Acici M, Umur S, Guvenc T, Arslan H, Kurt M (2008) Seroprevalence of equine babesiosis in the Black Sea region of Turkey. Parasitol Int 57: 198-200. https://doi.org/10.1016/j.parint.2007.12.009
Aharonson-Raz K, Davidson I, Porat Y, Altory A, Klement E, Steinman A (2014) Seroprevalence and Rate of Infection of Equine Influenza Virus (H3N8 and H7N7) and Equine Herpesvirus (1 and 4) in the Horse Population in Israel. J. Equine Vet Sci 6: 828–832. https://doi.org/10.1016/j.jevs.2014.01.012
Aiello SE, Moses MA (2016) Health management interaction: horses, The Merck Veterinary Manual, Merck & Co., Inc, Kenilworth, NJ, USA, 11th edn.
Akca A, Babur C, Arslan MO, Gicik Y, Kara M, Kilic S (2004) Prevalence of antibodies to Toxoplasma gondii in horses in the province of Kars, Turkey. Vet. Med. – Czech., 49, 9–13. DOI:10.17221/5667-
Akca A, Mor N, 2010. Seroprevalence of Toxoplasma gondii in cattle in the province of Kars, Turkey as determined by ELISA. J Anim Vet Adv 9: 876-878. DOI : 10.3923/javaa.2010.876.878
Akkutay AZ, Osterrieder N, Damiani A, Tischer BK, Borchers K, Alkan F (2014) Prevalence of equine gammaherpesviruses on breeding farms in Turkey and development of a TaqMan MGB real-time PCR to detect equine herpesvirus 5 (EHV-5). Arch Virol 159: 2989–2995. https://doi.org/10.1007/s00705-014-2165-5
Ali S, Mohammadi G (2016) Detection Of Equine Herpesvırus-1 And Equine Herpesvirus-4 In Mules and Donkeys By Real Time PCR. Vet 17: 160-163.
Alkan F, Timurkan MÖ, Karayel I (2013) Rotavirus diarrhea outbreaks in arabian thoroughbred foals in a stud farm, Turkey. Kafkas Univ Vet Fak Derg 19, 141-145. DOI: 10.9775/kvfd.2012.8186
Alvarado-Esquivel C, Howe DK, Yeargan MR, Alvarado-Esquivel D, Zamarripa-Barboza JA, Dubey JP (2017) Seroepidemiology of Sarcocystis neurona and Neospora hughesi infections in domestic donkeys (Equus asinus)in Durango, Mexico. Parasite 24: 27. https://doi.org/10.1051/parasite/2017030
Amer HM, Asmaa KS, Ibrahim MS, Ahmed AS, Mohamed AS (2011) Prevalence of equine herpes viruses 1, 2 and 4 in Arabian horse population in Egypt. Afr J Microbiol Res 5: 4805-4811. https://doi.org/10.5897/AJMR11.421
Ata EB, Salama A, Zaghawa A, Ghazy AA, Elsify A, Nayel M, Hegazy Y, Abdel-Rahman EH,Warda S (2020) Seroprevalence Of Equıne Herpes Virus-1 In Endemic Area of Egypt With Risk Factors Assessment. Bulg J Vet Med 23: 102-111. DOI: 10.15547/bjvm.2168
Ataseven VS, Dagalp SB, Guzel M, Basaran Z, Tan MT, Geraghty B (2009) Prevalence of equine herpesvirus-1 and equine herpesvirus-4 infections in equidae species in Turkey as determined by ELISA and multiplex nested PCR. Res Vet Sci 86: 339–344. https://doi.org/10.1016/j.rvsc.2008.06.001
Ataseven VS, Daly JM (2007) Seroepidemiology of Equine Influenza Virus Infection in Turkey. Turk J Vet Anim Sci 31: 199-202.
Balasuriya UB (2014) Equine viral arteritis. Vet Clin N Am Equine Pract 30: 543-560. https://doi.org/10.1016/j.cveq.2014.08.011
Balkaya I, Aktaş MS, Ozkanlar Y, Babur C, Çelebi B (2010) Seroprevalence of Toxoplasma gondii in dogs in eastern Turkey. Isr J Vet Med 65: 58-61.
Balkaya I, Babür C, Celebi B, Utuk AE (2011) Seroprevalence of toxoplasmosis in donkeys in Eastern Turkey. Isr J Vet Med 66: 39-42.
Bártová E, Sedlák K, Kobédová K, Budíková M, Atuman YJ, Kamani K (2017) Seroprevalence and risk factors of Neospora spp. and Toxoplasma gondii infections among horses and donkeys in Nigeria, West Africa. Acta Parasitol 62: 606-609. https://doi.org/10.1515/ap-2017-0073
Bello ACPP, Cunha AP, Braz GF, Lara MCSH, Reis JKP, Haddad JPH, Rocha MA, Leite RC (2007) Frequency of equine viral arteritis in Minas Gerais State, Brazil. Arq Bras Vet Zootec 59: 1077-1079.
Bennett R, Pfuderer S (2020) The Potential for New Donkey Farming Systems to Supply the Growing Demand for Hides. Animals: 10, 718. https://doi.org/10.3390/ani10040718
Blitvich BJ, Ibarra-Juarez LA, Cortes-Guzman AJ, Root JJ, Franklin AB, Sullivan HJ, Fernandez-Salas I (2010) Seroprevalence of equine influenza virus in north- east and southern Mexico. Vet Rec 166: 565-566. doi: 10.1136/vr.b4845
Borchers K, Frolich K, Ludwig H (1999) Detection of equine herpesvirus types 2 and 5 (EHV-2 and EHV-5) in Przewalski’s wild horses. Arch Virol 144:771–780. https://doi.org/10.1007/s007050050542
Borchers K,Wolfinger U, Goltz M, Broll H, Ludwig H (1997) Distribution and relevance of equine herpesvirus type 2 (EHV-2) infections. Arch Virol 142: 917-928. https://doi.org/10.1007/s007050050128
Brüning A (1996) Equine piroplasmosis an update on diagnosis, treatment and prevention. Br Vet J 152: 139-151. https://doi.org/10.1016/S0007-1935(96)80070-4
Bulut O, Yavru S, Yapıcı O, Kale M, Avcı A (2012) The Serological Investigation of Equine Viral Arteritis Infection in Central Anatolia of Turkey. J Anim Vet Adv 11: 924-936. https://doi.org/10.31196/huvfd.508980
Can H, Döşkaya M, Ajzenberg D, Özdemir HG, Caner A, İz SG, Doskaya AU, Atalay E, Cetinkaya C, Urgen S, Karacalı S, Un C, Darde ML, Guruz Y (2014) Genetic Characterization of Toxoplasma gondii Isolates and Toxoplasmosis Seroprevalence in Stray Cats of İzmir, Turkey. PLoS one 9, e104930. https://doi.org/10.1371/journal.pone.0104930
Cazarotto CJ, Balzan A, Grosskopf RK, Boito JP, Portella LP, Vogel FF, Fávero JF, Cucco DC, Biazus AH, Machado G, Da Silva AS (2016) Horses seropositive for Toxoplasma gondii, Sarcocystis spp. and Neospora spp.: Possible risk factors for infection in Brazil. Microb Pathog 99: 30-35. https://doi.org/10.1016/j.micpath.2016.07.016
Chenchev I, Rusenova N, Sandev N (2011) Seroepidemiological Studıes Of Donkeys’ Blood For Detection Of Some Virus Infections On Ungulates. TJS 9: 82-86.
Çiçek H, Babür C, Eser M. (2011) Seroprevalence of Toxoplasma gondii in Pırlak Sheep in the Afyonkarahisar Province of Turkey. Turkiye Parazitol Derg 35: 137-9. DOI:10.5152/tpd.2011.34
Cong W, Nie L, Qin S, Wang W, Qian A, Meng Q (2018) Prevalence of Neospora spp. in donkeys in China. Parasite 25: 16. doi: 10.1051/parasite/2018018
Crawford PC, Dubovi EJ, Castleman WL, Stephenson I, Gibbs EPJ, Chen L, Smith C, Hill RC, Ferro P, Pompey J, Bright RA, Medina MJ, Johnson CM, Olsen CW, Cox NJ, Klimov AI, Katz MJ, Donis RO (2005) Transmission of Equine Influenza Virus to Dogs. Science. 310: 482. DOI: 10.1126/science.1117950
Cruz F, Fores P, Mughini-Gras L, Ireland J, Moreno MA, Newton JR, 2016a. Seroprevalence and factors associated with equine herpesvirus type 1 and 4 in Spanish Purebred horses in Spain. Vet Rec 16, 398. https://doi.org/10.1136/vr.103573
Cruz F, Fores P, Mughni-Gras P, Ireland J, Moreno MA, Newton R. (2016b) Seroprevalence and factors associated with seropositivity to equine arteritis virus in Spanish Purebred horses in Spain. Equine Vet J 48: 573–577. https://doi.org/10.1111/evj.12500
Dağalp SB, Babaoğlu AR, Ataseven VS, Karapinar Z, Timurkan MÖ, Doğan F, Ozkul A, Alkan F (2018) Determination of presence of equid alpha and gammaherpesvirus infections in foals with respiratory distress. Ankara Univ Vet Fak Derg 65: 63-68.
Daly JM, Newton JR, Mumford JA (2004) Current perspectives on control of equine influenza. Vet Res 35: 411-423. https://doi.org/10.1051/vetres:2004023
Davison AJ (2010) Herpesvirus systematics. Vet Microbiol 143: 52–69. https://doi.org/10.1016/j.vetmic.2010.02.014
De Waal D, van Heerden J (1994) Equine babesiosis. In: Coetzer, J., Thomson, G., Tustin, R. (Eds.), Infectious Diseases of Livestock with Special Reference to South Africa, Oxford University Press, Cape Town, South Africa, pp. 293–304.
De Waal T (1992) Equine piroplasmosis: A review. Br Vet J 148: 6–14. https://doi.org/10.1016/0007-1935(92)90061-5
Del Piero F, Wilkins PA, Lopez JW, Glaser AL, Dubovi EJ, Schlafer DH, Lein DH (1997) Equine viral arteritis in newborn foals: clinical, pathological, serological, microbiological and immunohistochemical observations. Equine Vet J 29: 178-185. https://doi.org/10.1111/j.2042-3306.1997.tb01666.x
Doni NY, Simsek Z, Gurses G, Zeyrek FY, Demir C (2015) Prevalence and associated risk factors of Toxoplasma gondii in female farmworkers of southeastern Turkey. JIDC 9:87-93. DOI: https://doi.org/10.3855/jidc.5824
Dubey JP (2009) History of the discovery of the life cycle of Toxoplasma gondii. Int J Parasitol 39:877–882. https://doi.org/10.1016/j.ijpara.2009.01.005
Dubey JP (2010) Toxoplasmosis of animals and humans. Secondth edition. CRC Press Inc., Boca Raton, New York.,1–313.
Dubey J, Hemphill A, Calero-Bernal R, Schares G (2017) Neosporosis in Animals; CRC Press: Boca Raton, FL, USA,
Dubey JP, Lindsay DS (2006) Neosporosis, toxoplasmosis, and sarcocystosis in ruminants. Vet Clin North Am Food Anim Pract 22: 645–671. https://doi.org/10.1016/j.cvfa.2006.08.001
Evers F, Garcia JL, Navarro IT, Zulpo DL, Nino BSL, Ewald MPC, Pagliari S, Almeida JC, Freire RL (2013). Diagnosis and isolation of Toxoplasma gondii in horses from Brazilian slaughterhouses. Rev Bras Parasitol Vet 22: 58-63. https://doi.org/10.1590/S1984-29612013005000009
Galosi CM, de la Paz VC, Fernandez LC, Martinez JP, Craig MI, Barrandeguy M, Etcheverrrigaray ME (2005) Isolation of equine herpesvirus-2 from the lung of an aborted fetus. J Vet Diagn Invest 17: 500–502. https://doi.org/10.1177/104063870501700520
Galvão CM, Rezende-Gondim MM, Chaves AC, Schares G, Ribas JR, Gondim LF (2015) Brazilian donkeys (Equus asinus) have a low exposure to Neospora spp. Rev Bras Parasitol Vet 24: 340-344. https://doi.org/10.1590/S1984-29612015057
García-Bocanegra I, Arenas-Montes A, Hernández E, Adaszek L, Carbonero A, Almería S, Jaén-Téllez JA, Gutiérrez-Palomino P, Arenas A (2013) Seroprevalence and risk factors associated with Babesia caballi and Theileria equi infection in equids. Vet J 195: 172-178. https://doi.org/10.1016/j.tvjl.2012.06.012
Garcia-Bocanegra I, Cabezon O, Arenas-Montes A, Carbonero A, Dubey JP, Perea A, Almeria S (2012) Seroprevalence of Toxoplasma gondii in equids from Southern Spain. Parasitol Int 61: 421-424. https://doi.org/10.1016/j.parint.2012.02.003
Gazyağci S, Macun HC, Babür C (2011) Investigation of seroprevalance of toxoplasmosis in mares and stallions in Ankara province, Turkey. Iran J Vet Res 12: 354-356.
Gennari MS, Pena JHD, Lindsay DS, Lopes MG, Soares HS, Cabral AD, Vitaliano SN, Amaku M (2016) Prevalence of antibodies against Neospora spp. and Sarcocystis neurona in donkeys from northeastern Brazil. J Vet Parasitol 25: 109-111. https://doi.org/10.1590/S1984-29612016003
Gharekhani J, Tavoosidana GR, Naderisefat GR (2013) Seroprevalence of Neospora infection in horses and donkeys in Hamedan province. Vet World 2231-0916.
Glaser AL, Chimside ED, Horzinek MC, De Vries AAF (1997) Equine arteritis virus. Theriogenology, 47: 1275-1295. https://doi.org/10.1016/S0093-691X(97)00107-6
Gür S, İrehan B, Gürçay M, Turan T (2019) Serological investigation of equine viral arteritis in donkeys in eastern and south-eastern Anatolia regions of Turkey. Acta Vet Brno 88: 385–391. https://doi.org/10.2754/avb201988040385
Göz Y, Babür C, Aydın A, Kılıç S (2007) Seroprevalence of toxoplasmosis, brucellosis and listeriosis in horses in Hakkari, eastern region of Turkey. Revue Méd Vét 11: 534-539.
Hajialilo E, Ziaali N, Harandi MF, Saraei M, Hajialilo M (2010) Prevalence of anti-Toxoplasma gondii antibodies in sport horses from Qazvin, Iran. Trop Anim Health Prod 42: 1321–1322. https://doi.org/10.1007/s11250-010-9576-4
Happold J, Rubira R (2011) Equine influenza: patterns of disease and seroprevalence in Thoroughbred studs and implications for vaccination. Aust Vet J 89: 135–137. https://doi.org/10.1111/j.1751-0813.2011.00735.x
Jakubek EB, Lunden A, Uggla A (2006) Seroprevalences of Toxoplasma gondii and Neospora sp. infections in Swedish horses. Vet Parasitol 138: 194–199. DOI: 10.1016/j.vetpar.2006.02.002
James KE, Smith WA, Packham AE, Conrad PA, Nusterla N (2017) Toxoplasma gondii seroprevalance and association with equine protozoal myeloencephalitis: A case-control study of Californian horses. Vet J 224: 38-43. doi: 10.1016/j.tvjl.2017.05.008.
Karatepe B, Babür C, Karatepe M, Kılıç S (2010) Seroprevalence of toxoplasmosis in horses in Niğde Province of Turkey. Trop Anim Health Prod 42: 385–389. doi: 10.1007/s11250-009-9430-8
Kershaw O, von Oppen T, Glitz F, Deegen E, Ludwig H, Borchers K (2001) Detection of equine herpesvirus type 2 (EHV-2) in horses with keratoconjunctivitis. Virus Res 80: 93–99. doi: 10.1016/s0168-1702(01)00299-4.
Kimble KM, Gomez G, Szule JA, Dubey JP, Buchanan B, Porter BF (2021) Systemic toxoplasmosis in a horse. J Comp Path 182: 27-31. https://doi.org/10.1016/j.jcpa.2020.11.004
Kligler EB Shkap V, Baneth G, Mildenberg Z, Steinman A (2007) Seroprevalence of Neospora spp. among asymptomatic horses, aborted mares and horses demonstrating neurological signs in Israel. Vet Parasitol 148: 109–113. doi: 10.1016/j.vetpar.2007.06.002.
Krisová S, Tóthová K, Molinková D, Makra Z, Zisopoulou AM (2020) Prevalence of equine herpesvirus 2 (EHV-2) in equine ocular disease. Acta Vet Brno 89: 115–123. https://doi.org/10.2754/avb202089020115
Kumar S, Kumar R, Sugimoto C (2009) A perspective on Theileria equi infections in donkeys. Jpn. J Vet Res 56: 171-80.
Li X, Ni HB, Ren WX, Jiang J, Gong QL, Zhang XX (2010) Seroprevalence of Toxoplasma gondii in horses: A global systematic review and meta-analysis. Acta Trop 201: 105222. doi: 10.1016/j.actatropica.2019.105222.
Machacova T, Bartova E, Di Loria A, Sedlak K, Guccione J, Fulgione D, Veneizano V (2013) Seroprevalence and risk factors of Neospora spp. in donkeys from Southern Italy. Vet Parasitol 198: 201-204. doi: 10.1016/j.vetpar.2013.08.013.
Machacova T, Bartova E, Di Loria A, Sedlak K, Mariani U, Fusco G, Fulgione D, Veneziano V, Dubey JT (2014) Seroprevalence of Toxoplasma gondii in donkeys (Equus asinus) in Italy. J Vet Med Sci 76:265–7. doi: 10.1292/jvms.13-0352
Machado RZ, Toledo CZP, Teixeira MCA, Andre MR, Freschi CR, Sampaio PH (2012) Molecular and serological detection of Theileria equi and Babesia caballi in donkeys (Equus asinus) in Brazil. Vet Parasitol 186: 461-465. doi: 10.1016/j.vetpar.2011.11.069.
Maclachlan NJ, Balasuriya UB (2006) Equine viral arteritis. Adv Exp Med Biol 581: 429-433. doi: 10.1007/978-0-387-33012-9_77.
Madic J, Martinovic S, Naglic T, Hajsig D, Cvetnic S (1996) Serological evidence for the presence of A/equine-1 influenza virus in unvaccinated horses in Croatia. Vet Rec 138: 68. doi: 10.1136/vr.138.3.68.
Mancianti F, Nardoni S, Papini R, Mugnaini L, Martini M, Altomonte I, Salari, F, D’Ascenzi C, Dubey JP (2014) Detection and genotyping of Toxoplasma gondii DNA in the blood and milk of naturally infected donkeys (Equus asinus). Parasit Vectors 7:165. doi: 10.1186/1756-3305-7-165.
Marenzoni ML, Coppola G, Maranesi M, Passamonti F, Cappelli K, Capomaccio S, Verini Supplizi A, Thiry E, Coletti M, (2010) Age-dependent prevalence of equid herpesvirus 5 infection. Vet Res Commun 34:703–708. doi: 10.1007/s11259-010-9443-9.
Marenzoni ML, Cuteri V, De Parri F, Danzetta MI, Yılmaz Z, Yaramış ÇP, Kennerman E, Or ME, Marchi S, Casciari, C, De Mia GM, Valente C, Costarelli S (2013) A pilot study on the epidemiological status of equine infectious anaemia, equine viral arteritis, glanders, and dourine in Turkey. Turk J Vet Anim Sci 37: 76-80. doi:10.3906/vet-1110-46
Marenzoni ML, Passamonti F, Lepri E, Cercone M, Capomaccio S, Cappelli K, Felicetti M, Coppola G, Coletti M, Thiry E (2011) Quantification of equid herpesvirus 5 DNA in clinical and necropsy specimens collected from a horse with equine multinodular pulmonary fibrosis. J Vet Diagn Investig 23: 802–806. doi: 10.1177/1040638711407890.
Marsh AE, Barr BC, Packham AE, Conrad PA (1998) Description of a new Neospora species (Protozoa: Apicomplexa: Sarcocystidae). J Parasitol 84: 983–991.
Mehlhorn H, Schein E (1998) Redescription of Babesia equi Laveran, 1901 as Theileria equi Mehlhorn, Schein 1998. Parasitol Res 84: 467–475. doi: 10.1007/s004360050431.
Mekonnen A, Eshetu A, Gizaw D (2017) Equine herpesvirus 1 and/or 4 in working equids: seroprevalence and risk factors in North Shewa Zone, Ethiopia. Ethiop Vet J 21: 28-39. https://dx.doi.org/10.4314/evj.v21i2.3
Munhoz AD, Souza MA, Costa SCL, Freitas JS, Silva AND, Lacerda LC, Cruz RDS, Albuquerque GR, Pereira MJS (2019) Factors associated with the distribution of natural Toxoplasma gondii infection among equids in Northeastern Brazil. Rev Bras Parasitol Vet 28: 283–290.
Negussie H, Gizaw D, Tesfaw L, Li1 Y, Oguma K, Sentsui H, Tessema TS, Nauwynck HJ (2017) Detection of Equine Herpesvirus (EHV) -1, -2, -4 and -5 in Ethiopian Equids with and without Respiratory Problems and Genetic Characterization of EHV-2 and EHV-5 Strains. Transbound Emerg Dis 64: 1970–1978. doi: 10.1111/tbed.12601.
Nejat S, Momtaz H, Yadegari M, Dehkordi FS, Khamesipour F (2015) Seasonal, Geographical, Age and Breed Distributions of Equine Viral Arteritis in Iran. Kafkas Univ Vet Fak Derg 21: 111-116. DOI: 10.9775/kvfd.2014.11934
Nordengrahn A, Merza M, Ros C, Lindholm A, Palfi V, Hannant D, Belak S (2002) Prevalence of equine herpesvirus types 2 and 5 in horse populations by using type-specific PCR assays. Vet Res 33: 251–259. doi: 10.1051/vetres:2002013.
Oduori DO, Onyango SC, Kimari JN, MacLeod ET (2015) A Field Survey for the Seroprevalence of Theileria equi and Babesia caballi in Donkeys from Nuu Division, Kenya. Ticks and Tick-borne Dis 6:683-688. DOI: 10.1016/j.ttbdis.2015.05.015
Oncel T, Vural G (2006) Occurrence of Toxoplasma gondii antibodies in sheep in Istanbul, Turkey. Vet Arhiv 76: 547-553.
Patel JR, Heldens J (2005) Equine herpesviruses 1 (EHV-1) and 4 (EHV-4) epidemiology disease and immunoprophylaxis. Vet J 170: 14– 23. doi: 10.1016/j.tvjl.2004.04.018.
Rampersad J, Cesar E, Campbell MD, Samlal M, Ammons D (2003) A field evaluation of PCR for the routine detection of Babesia equi in horses. Vet Parasitol 114: 81–87. doi: 10.1016/s0304-4017(03)00129-8.
Reubel GH, Crabb BS, Studdert MJ, (1995) Diagnosis of equine gammaherpesvirus 2 and 5 infections by polymerase chain reaction. Arch Virol 140: 1049–1060. doi: 10.1007/BF01315414.
Rostami A, Riahi SM, Gamble HR, Fakhri Y, Nourollahpour-Shiadeh M, Danesh, M., Behniafar, H, Paktinat S, Foroutan M, Mokdad AH, Hotez PJ, Gasser RB (2020) Global prevalence of latent toxoplasmosis in pregnant women: A systematic review and meta-analysis. Clin Microbiol Infect 26: 673–683. doi: 10.1016/j.cmi.2020.01.008.
Sabin AB, Feldman HA (1948) Dyes as microchemical indicators of new immunity phenomenon affecting a protozoon parasite (Toxoplasma). Science. 108: 660-663. doi: 10.1126/science.108.2815.660.
Sajid M, Ahmad M, Khan MA, Anjum MA, Mushtaq MH (2013) Investigation of equine influenza virus in two geographical regions of Pakistan. Trop Anim Health Prod 45: 693–694. doi: 10.1007/s11250-012-0247-5.
Salim BO, Hassan SM, Bakheit MA, Alhassan A, Igarashi I, Karanis P, Abdelrahman MB (2008) Diagnosis of Babesia caballi and Theileria equi infections in horses in Sudan using ELISA and PCR. Parasitol Res 103: 1145–1150. doi: 10.1007/s00436-008-1108-z.
Saqib M, Hussain MH, Sajid MS, Mansoor MK, Asi MN, Fadya AA, Zohaib A, Sial AU, Muhammad G, Ullah I(2015) Seroepidemiology of equine toxoplasmosis using a latex agglutination test in the three metropolises of Punjab, Pakistan. Trop Biomed 32: 276–285.
Sevgili M, Sahin T, Cimtay I, Cetin H, Keskin O, Gokcen A (2003) Determination of antibodies to Neospora caninum in Thoroughbred mares from Sanliurfa. YYU Vet Fak Derg 14: 15–7.
Sigg L, Gerber V, Gottstein B, Doherr MG, Frey CF (2010) Seroprevalence of Babesia caballi and Theileria equi in the Swiss horse population. Parasitol Int 59: 313–317. doi: 10.1016/j.parint.2010.02.005.
Smith KC, Blunden AS, Whitwell KE, Dunn KA, Wales AD (2003) A survey of equine abortion, stillbirth and neonatal death in the UK from 1988 to 1997. Equine Vet J 35: 496–501. doi: 10.2746/042516403775600578.
Tenter AM, Heckeroth AR, Weiss LM (2009) Toxoplasma gondii: From animals to humans. Int J Parasitol 30: 1217–1258. doi: 10.1016/s0020-7519(00)00124-7.
Timoney PJ, Klingeborn B, Lucas MH (1996) A perspective on equine viral arteritis (infectious arteritis of horse) Rev Sci Tech 15: 1203-1208. doi: 10.1016/s0020-7519(00)00124-7.
Timurkan MO, Aydin H (20199 Cirit Atlarında İnfluenza A Virus Enfeksiyonunun Serolojik ve Moleküler Yöntemlerle Araştırılması. Ataturk Univ Vet Bilim Derg 14: 71-77. https://doi.org/10.17094/ataunivbd.441972
Tirosh- Levy S, Steinman A, Minderigiu A, Arieli O, Savitski I, Fleiderovits L, Edery N, Schvartz G, Mazuz ML, (2020) High Exposure to Toxoplasma gondii and Neospora spp. in Donkeys in Israel: Serological Survey and Case Reports. Animals 10: 1921.
Trimboli F, De Amicis I, Di Loria A, Ceniti C, Carluccio A (2020) Reference Ranges for Hematological and Biochemical Profile of Martina Franca Donkeys. Front Vet Sci 7: 602984. https://doi.org/10.3390/ani10101921
Turan N, Ekici H, Yilmaz H, Kondo T, Hasoksuz M, Sato I, Tuchiya K, Fukunaga Y (2007) Detection of antibodies to equine arteritis virus in horse sera using recombinant chimaeric N/GL Protein. Vet Rec 161: 352-354. doi: 10.1136/vr.161.10.352.
Turan N, Yildirim F, Altan E, Sennazli G, Gurel A, Diallo I, Yilmaz H (2012) Molecular and pathological investigations of EHV-1 and EHV-4 infections in horses in Turkey. Res Vet Sci 93: 1504-1507. doi: 10.1016/j.rvsc.2012.01.019.
Turan N, Ekici H, Yilmaz H, Kondo T, Hasoksuz M, Sato I, Tuchiya K, Fukunaga Y (2007) Detection of antibodies to equine arteritis virus in horse sera using recombinant chimaeric N/GL protein. Vet Rec 161: 352–354. doi: 10.1136/vr.161.10.352.
Vengust M, Baird JD, van Dreumel T, Ackerley C, Bienzle D (2008) Equid herpesvirus 2-associated oral and esophageal ulceration in a foal. J Vet Diagn Invest 20: 811–815. doi: 10.1177/104063870802000618.
Waapa H, Oliveirac UV, Nunes T, Gomesa J, Gomese T, Bärwaldf A, Munhozc AD, Schares G (2020) Serological survey of Neospora spp. and Besnoitia spp. in horses in Portugal. Vet Parasitol Reg Stud Reports 20: 100391. doi: 10.1016/j.vprsr.2020.100391.
Wang S, Yao Z, Zhang N, Wang D, Ma J, Liu S, Zheng B, Zhang B, Liu K, Zhang H (2016) Serological study of Neospora caninum infection in dogs in central China. Parasite 23: 25. doi: 10.1051/parasite/2016025.
Wise LN, Pelzel-McCluskey AM, Mealey RH, Knowles DP (2014) Equine piroplasmosis. Vet Clin North Am Equine Pract 30:677-93. doi: 10.1016/j.cveq.2014.08.008.
Wondimagegnehu K, Leta S, Amenu K, Negussie H (2021) Molecular Detection and Epidemiology of Equine Herpesvirus 2 and 5 in Working Equids in Central Ethiopia. Research Square. DOI: 10.21203/rs.3.rs-130965/v1
Xu Y, Zhang S, Huang X, Bayin C, Xuenan X, Igarashi I, Fujisaki K, Kabeya H, Maruyama S, Mikami T (2003) Seroepidemiologic studies on Babesia equi and Babesia caballi infections in horses in Jilin province of China. J. Vet Med Sci 65, 1015-1017. doi: 10.1292/jvms.65.1015.
Yildirim Y, Yilmaz V, Kirmizigul AH (2015) Equine herpes virus type 1 (EHV-1) and 4 (EHV-4) infections in horses and donkeys in northeastern Turkey. Iran J Vet Res 16: 341-344.

Table 1

Primers, genome localizations and product sizes used in the study.

Disease	Primary Name	Primary Index	Product (bp)	Annealing Degree (C°)	Reference
Equine Viral Arteritis	M1	CTGAGGTATGGGAGCCATAG	411	60	Echeverria et al. (2007)
	M10	GGCCTGCGGACGTGATCG
Equine Influenza Virus	INFV-M52C	CTT CTA ACC GAG GTC GAA ACG	244	55	Quinlivan et al. (2005)
	INFV-M253R	AGGGCATTTTGGACAAAGCGTCTA
Equine Herpes Virus 1	FC2	CTTGTGAGATCTAACCGCAC	1150	60	Wang et al. (2007)
	RC	GGGTATAGAGCTTTCATGGG
	FC3	ATACGATCACATCCAATCCC	188
	R1	GCGTTATAGCTATCACGTCC
Equine Herpes Virus 4	FC2	CTTGTGAGATCTAACCGCAC	1150
	RC	GGGTATAGAGCTTTCATGGG
	FC3	ATACGATCACATCCAATCCC	677
	R4	CCTGCATAATGACAGCAGTG
Equine Herpes Virus 2	EHV2L1	GATGGTCTCACCTCTAGCAT	1111
	EHV2R1	CTGGTGTAACACAGGTCTTC
	EHV2L2	GGTCTCACCTCTAGCATAAC	817
	EHV2R2	GCCACACTCTCTTCCTTAGT
Equine Herpes Virus 5	EHV5L1	CCAACACAGAAGACAAGGAG	1339
	EHV5R1	CACGGTGATACAGTCAGAGA
	EHV5L2	CCAACACAGAAGACAAGGAG	410
	EHV5R2	AGTTGACCGTCGTTCTAGTG

Table 2

PCR mix components and program for gene regions used in the study

Component	Concentration	Program
Taq DNA polymerase (5u/ µl)	0,5 µl	95 C°- 5 minutes 94 C°- 1 minute (*)C° -1 minute 35 cycles 72 C° -2 minutes 72 C° -10 minutes
10 X Taq buffer (tampon)	3 µl
MgCl2 (25 mM)	2,4 µl
10 mM dNTP mix	0,5 µl
Primary- forward (10 pmol/µl)	0,5 µl
Primary- reverse (10 pmol/µl)	0,5 µl
Deionized water	19,6 µl
cDNA	3 µl
Total	30 µl

Table 3

Seroprevalence of diseases in horses

Region

B. caballi

T.equi

T. gondii

N. caninum

EVA

EHV-1

EHV-2

EHV-4

EHV-5

EIV

City

Center

Positive (N)

Negative (N)

Seropositivity Rate (%)

%21.62

%25

%17.14

%8,82

%5,88

%2,77

Sindirgi province

Positive (N)

Negative (N)

Seropositivity Rate (%)

%33.33

%10,5

%5,88

%5,55

Balya province

Positive (N)

Negative (N)

Seropositivity Rate (%)

%66.66

%15,3

%7,69

Total

Seropositivity Rate (%)

%12.12

%34.84

%9.09

%10.60

%6.06

%3.03

Table 4

Seroprevalence of diseases in donkeys

Region

B. caballi

T.equi

T. gondii

N. caninum

EVA

EHV-1

EHV-2

EHV-4

EHV-5

EIV

Manisa

Positive (N)

Negative (N)

Seropositivity Rate (%)

%1.69

%79.66

%98.3

%8,4

%3,38

%1,69

Sındırgı

Positive (N)

Negative (N)

Seropositivity Rate (%)

%63.63

%81.81

%63.63

Edremit

Positive (N)

Negative (N)

Seropositivity Rate (%)

%57.69

%76

%42.30

%3,84

Total

Seropositivity Rate (%)

%1.04

%71.87

%90.62

%23.95

%3.12

%1.04

Table 5

Whole blood analysis of horses and donkeys

Species

White Blood Cell 10*9/l

Lymphocyte

10*9/l

Monocyte

10*9/l

Neutrophile

10*9/l

Eosinophile

10*9/l

Basophile

10*9/l

Red Blood Cell

10*12/l

Haemoglobine

g/dl

Pocket Cell Volume

Platelet

10*9/l

Horse

Mean

Std Deviation

10,80

3,52

3,72

1,84

0,29

0,24

6,14

2,72

0,54

0,57

0,15

0,78

9,34

2,11

16,9

14,25

48,1

39,1

133

60,7

Donkey

Mean

14,51

6,73

0,50

6,19

0,91

0,22

6,65

12,6

38,4

162

Std Deviation

4,21

2,74

0,41

2,83

0,70

1,04

1,43

2,69

7,8

69,3

No competing interests reported.

PDF

Version 1

posted 21 Mar, 2022

You are reading this latest preprint version

Infectious diseases in rising riding-horse and donkey milk industry: First detection of Neospora sp. antibodies in donkeys in Turkey

Status:

Version 1

Abstract

Introduction

Material And Methods

Study design and sample collection

Serological examination methods

Theileria equi and Babesia caballi analysis method

Toxoplasma gondii analysis method

Neospora sp. analysis method

Virological analysis method

Preparation of blood samples

Viral nucleic acid extraction

Reverse transcription of viral RNA

Polymerase chain reaction (PCR) technique

Agarose gel electrophoresis of PCR products

Statistical analysis

Results

Discussion

Declarations

References

Tables

Competing Interests

Status:

Version 1