Study organisms: The mosquito used for investigation was the A. aegypti, Liverpool Blackeye strain, a highly susceptible mosquito strain to D. immitis used predominately in research for Aedes sp. (Buxton & Mullen 1981). Although A. aegypti is just one of 28 different mosquito species reported to vector D. immitis, the relative expertise on this particular species limited us to its use as our study organism.
Mosquito maintenance: Aedes aegypti, originally obtained from the Filariasis Research Reagent Resource Center (FR3) (Michalaski et al. 2011), were raised under standard laboratory conditions – 27 °C, 80+5% relative humidity, and a 12:12-hour light diurnal cycle (Dharmarajan et al. 2019). Adult female mosquitoes, five days post emergence were blood fed using artificial membrane feeder. One day prior to membrane feeding 31 female mosquitoes were transferred to ~500 mL plastic containers with mesh tops (henceforth ‘‘cages’’). Females were starved of sugar for 12 hours and deprived of water for four hours prior to blood feeding. Mosquitoes in each cage (31 each) were allowed to feed for two hours or until repletion on a Parafilm membrane stretched over an inverted water-jacketed glass membrane feeder maintained at 40oC. Each feeder was filled with 200 uL of dog blood infected or uninfected with D. immitis. The amount of microfilariae fed to each mosquito group was determined as previously reported (Dharmarajan et al., 2019). The dog blood was obtained from FR3.
Dirofilaria immitis detection
Prior to screening for D. immitis infection from mosquitoes, DNA from individual mosquito samples was extracted using a commercially available kit (QIAGEN, DNeasy Blood & Tissue Kit) and quality was confirmed using a nanodrop machine. All blood fed (infected and uninfected blood) mosquito samples were screened for D. immitis infection irrespective of whether they were fed on infected or uninfected blood by amplifying the COI gene (656bp) of the D. immitis mitochondrial DNA (Murata et al., 2003). Briefly, a 25µl reaction was set up comprising 1µl each of the COI-Forward (5’–TGATTGGTGGTTTTGGTAA–3’) and COI-Reverse (5’–ATAAGTACGAGTATCAATATC–3’) primers, 12.5µl of 2X mastermix (New England Biolabs), 2.5 µl DNA template and 8.5 µl of nuclease free water. For each cycle that was run, a D. immitis infected blood sample and nuclease free water were simultaneously included as positive and negative controls respectively. The PCR cycle comprises of an initial denaturation step at 940C for 5 minutes and 40 cycles of 940C for 1 minute, annealing at 500C for 2 minutes and extension at 720C for 3 minutes. A final extension at 720C for 5 minutes and an infinite hold at 40C.
Confirmation of amplification was done by loading the PCR products in a SYBR safe stained gel. Briefly, 2% gel was made by autoclaving a solution of 1X TAE buffer and molecular grade agar. SYBR safe stain (1 µl SYBR safe: 10 mL TAE buffer) was added to the agar solution, poured into a precast gel tray and allowed to cool. To load the samples onto the gel, 6 µl of PCR product was mixed with 4 µl of 6X dye and pipetted into the wells. Lastly, 5 µl of a low molecular weight DNA ladder was loaded onto the gel and the gel could run for 45 minutes at 100 V. Amplified PCR products were viewed using a Chemidoc gel imager (Supplementary Figure 1).
16S rRNA library preparation and sequencing
Six individual mosquito genomic DNA were pooled to make one biological replicate and five biological replicates each of D. immitis infected and uninfected pools were prepared for metagenomic analysis. The hypervariable V1-V3 region of the 16S rRNA gene was PCR amplified using the forward primer 27F; 5’- AGRGTTTGATCMTGGCTCAG-3’, and reverse primer 519R; 5’ – GTNTTACNGCGGCKGCTG - 3’ as outlined by the 16S Illumina’s MiSeq protocol (www.mrdnalab.com, Shallowater, TX, USA). Briefly, PCR was performed using the HotStarTaq Plus Master Mix Kit (Qiagen, USA) under the following conditions: 94°C for 3 min, followed by 30-35 cycles of 94°C for 30 s, 53°C for 40 s and 72°C for 1 min, after which a final elongation step at 72°C for 5 min was performed. After amplification, PCR products were electrophoresed in 2% agarose gel to determine the success of amplification and the relative intensity of bands. Multiple samples are pooled together in equal proportions based on their molecular weight and DNA concentrations. Pooled samples are purified using calibrated Ampure XP beads. Then the pooled and purified PCR product is used to prepare Illumina DNA library. Sequencing was performed at MR DNA (www.mrdnalab.com, Shallowater, TX, USA) on a MiSeq following the manufacturer’s guidelines.
Sequence analysis
Sequence analysis was done using the Quantitative Insights into Microbial Ecology (QIIME 2), unless stated otherwise. Briefly, processing of raw fastq files were demultiplexed. The Atacama soil microbiome pipeline was incorporated for quality control of demultiplexed paired-end reads (Supplementary Figure 2) using the DADA2 plugin as previously described (Callahan et al., 2016). Sequence alignment and subsequent construction of phylogenetic tree from representative sequences was done using the MAFFT v7 and FasTree v2.1 plugin (Price at al., 2010). Operational taxonomic assignment was done using the qiime2 feature-classifier plugin v7.0 which was previously trained against the SILVA 132 database preclustered at 99%. Tables representing operational taxonomic units (OTUs) and representative taxonomy were exported from R and used for diversity metric analysis using the Microbiome Analyst web-based interface (Chong et al., 2020; Dhariwal et al., 2017). Raw data from this analysis were submitted deposited and assigned the GenBank BioProject number #PRJNA606536.
Alpha diversity
To establish whether alpha diversity differs across mosquito samples, reads were transformed and low abundance OTUs were filtered from the datasets. The Observed OTU metric was used to estimate specie richness by identifying unique OTUs present across the tick groups, while the Shannon index were used to estimate both richness and evenness. The Mann-Whitney/Kruskal-Wallis was used to determine statistical significance of alpha diversity.
Beta diversity
To compare the differences in the microbiome between mosquito groups, based on measures of distance or dissimilarity, dissimilarity matrix were generated from log-transformed sequence data and ordination of the plots were visualized using both the Principal Coordinates Analysis (PCoA) and the Nonmetric Multidimensional Scaling (NMDS). The matrix used in calculating beta diversity includes the Bray_Curtis and unweighted UniFrac distance matrix. The Permutational MANOVA (PERMANOVA) was used to test for statistical significance of the dissimilarity measures.