Reagents
3-DSC (cat: JOT-10796) was purchased from Chengdu Pufei De Biotech Co., Ltd (Chengdu, China), acetylshikonin (cat: YRY134) was purchased from Chengdu Yirui Biotech Co., Ltd (Chengdu, China), Antibodies to detect total TOPK (cat: 4942), phosphorylated TOPK (cat: 4941), total ERKs (cat: 9102), phosphorylated ERKs (cat: 4370), caspase-3 (cat: 9662), caspase-7 (cat: 12827), cleaved caspase-3 (cat: 9664), cleaved caspase-7 (cat: 9491) and actin (cat: 3700) were purchased from Cell Signaling Technology (Beverly, MA, USA).
Cell culture
The human DLBCL cell lines (U2932, SUDHL-6 and OCI-Ly8) and normal B-cell line (WIL2S) were purchased from Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). The cells were cultured in RPMI 1640 medium with 10% fetal bovine serum (FBS). WIL2S cells were maintained in iscove's modified medium with 10% human serum (NABI Biopharmaceuticals, Boca Raton, FL, USA) and 2 mM L-glutamine (Invitrogen, Carlsbad, CA, USA). All cells were cultured with penicillin/streptomycin antibiotic mixture, penicillin (100 U.ml-1), streptomycin (100 μgml-1) at 37 °C in 5% CO2.
Bioinformatics analysis
Gene Expression Profiling Interactive Analysis (GEPIA, http://gepia.cancer-pku.cn/) software was used to analyze the expression of TOPK in DLBCL. First, enter TOPK and select boxplots. Then, select DLBC under datasets selection (cancer name) and click plot button.
Immunohistochemical (IHC) Staining
DLBCL tissue array (cat: LY800b) was purchase from Alenabio biotechnology Co., Ltd, containing 62 cases of DLBCL samples and 20 cases of normal control tissue samples. IHC staining was detected followed by the previous protocol[19], using TOPK antibody (1:200).
Western blot analysis
The protein samples were separated with SDS-PAGE electrophoresis, then transferred to polyvinylidene difluoride (PVDF) membranes (Bio-Rad, Hercules, CA, USA). Blocking with defatted milk, incubating with the first antibodies (1:1000), including TOPK, pTOPK, ERK, pERK, caspase 3, caspase 7, cleaved caspase 3, cleaved caspase 7 and actin, then incubating with the secondary antibodies. Images were captured with the Tanon-5200.
Lentiviral infection
Lentiviruses carrying TOPK-cDNA (accession number NM_018492.4), shTOPK.1 (ATTAGTGCATACAGAGAAGAGTT) and shTOPK.2 (GTCTGTGTCTTGCTATGGAAT) were from GenePharma Co. (Shanghai, China). For lentiviral infection, cells were infected with lentivirus (MOI=100), containing polybrene (5 μg/ml) for 1-3 days.
Cell proliferation assay
The cells were seeded (2 X 103 cells per well) in 96-well plates. After incubation for 24, 48, or 72h, cell proliferation was measured by MTS assay kit.
Apoptosis Detection
Flow cytometry was performed to observe the cell apoptosis with annexin V-FITC apoptosis detection kit (beyotime, C1062S). Cells were collected and washed with cold PBS. Added FITC annexin V and PI, incubated for 15 min at room temperature in the dark. Then analyzed by flow cytometry within 1 h.
Statistical analysis
Results were presented as the means ± standard deviation (SD) of 3 independent experiments, each dosage or treatment was tested in triplicate. Statistical analyses were performed with GraphPad Prism 6. Student’s t test were used to analyze the significant differences when the p value was less than 0.05.