A novel splice site variant c.1183+1 G&gt;C in DFNA5 causing autosomal dominant nonsyndromic hearing loss in a Chinese Family

doi:10.21203/rs.3.rs-1461267/v1

PDF

Research Article

A novel splice site variant c.1183+1 G>C in DFNA5 causing autosomal dominant nonsyndromic hearing loss in a Chinese Family

https://doi.org/10.21203/rs.3.rs-1461267/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background

The major clinical manifestation of autosomal dominant nonsyndromic hearing loss (ADNSHL) is bilateral, symmetrical, postlingual progressive sensorineural hearing loss, which begins with impairment at high frequencies and eventually progresses to hearing loss at all frequencies. Autosomal dominant deafness-5 (DFNA5) is a subtype of ADNSHL caused by a heterozygous variant in the gasdermin E (GSDME, also known as DFNA5) gene.

Methods

Targeted genomic capture and sequencing were performed on the proband of a six-generation Chinese family with hearing loss. The co-segregation analysis between the hearing loss and the novel variant was analyzed by Sanger sequencing and pure-tone audiometry. The minigene splicing assay was performed to evaluate the potential effect of the variant on messenger RNA splicing in vitro.

Results

The family exhibited autosomal dominant, progressive, postlingual, nonsyndromic sensorineural hearing loss, which was similar to the previously reported DFNA5 families. A novel heterozygous splice site variant in GSDME gene intron 8 was identified as “Likely pathogenic” according to the American College of Medical Genetics and Genomics (ACMG) guidelines, which co-segregated with the hearing loss phenotype of the family. The variant caused skipping of exon 8 in the mutant transcript, leading to the direct linking of exon 7 and 9.

Conclusions

We identified a novel GSDME splice site variant c.1183+1 G>C in an extended Chinese family, which led to the skipping of exon 8, through targeted genomic capture and sequencing and co-segregation analysis. The results extended the pathogenic variant spectrum of the GSDME gene, provided further support for the “gain-of-function” mechanism of DFNA5, and afforded a molecular interpretation for these patients with ADNSHL.

DFNA5

exon skipping

GSDME

nonsyndromic hearing loss

RNA splicing

Hearing loss is one of the most common congenital sensory defects in humans. Estimates show 1–3 hearing-impaired children in every 1000 newborns[1]. More than 60% of deafness was attributable to genetic factors[2, 3]. Hereditary deafness can be categorized as follows: syndromic hearing loss and nonsyndromic hearing loss. Nonsyndromic hearing loss can be subdivided into autosomal dominant (DFNA), autosomal recessive (DFNB), X-linked (DFNX), and mitochondrial inheritance depending on the mode of inheritance. To date, 51 autosomal dominant, 78 autosomal recessive, 5 X-linked, and 2 mitochondrial genes have been identified (http://hereditaryhearingloss.org). The major clinical manifestation of autosomal dominant nonsyndromic hearing loss (ADNSHL) is postlingual, progressive, sensorineural hearing loss, which begins with impairment at high frequencies[4]. ADNSHL accounts for about 20% of nonsyndromic deafness and has a high degree of genetic heterogeneity, with different gene variants causing the same or similar phenotypes[5]. Because of the genetic heterogeneity, genetic diagnosis is an important approach to discover the cause of nonsyndromic deafness.

ADNSHL contains many different disease subtypes. Autosomal dominant deafness-5 (DFNA5, Phenotype MIM[6, 7]: 600994) is one of them. DFNA5 is caused by a heterozygous variant in the gasdermin E (GSDME, Gene/Locus MIM: 608798) gene. In 1995, GSDME was mapped to 7p15 by Van Camp et al. using linkage analysis in an extended Dutch family first[8]. In 1998, GSDME was first cloned and identified as a deafness gene[9]. The cDNA of GSDME, including 10 exons, encodes a polypeptide of 496 amino acids with a mass of about 55 kDa. The pathogenic variant of the GSDME gene results in a particular form of nonsyndromic, autosomal dominant, bilateral, symmetrical, postlingual onset, and high-frequency sensorineural hearing loss, which progresses further to hearing loss at all frequencies. It may be accompanied or not accompanied by tinnitus, without vertigo, balance disorders, and symptoms involving other vestibular systems.

To date, more than a dozen DFNA5 families have been reported worldwide (Table 2). Studies suggest that although the variant sites of these families are different at the genome level, they eventually cause the skipping of exon 8 at the mRNA level of GSDME, resulting in a frameshift variant that produced 41 abnormal amino acids and premature termination of translation and formation of a truncated protein without normal carboxyl-terminal fragment. In this study, we reported a novel c.1183 + 1 G > C splice site variant in the GSDME gene.

1. Family recruitment and clinical evaluations

The specific procedures in this part refer to my published literature[10]. The proband was a 30-year-old man with progressive hearing loss a decade ago. He visited the Department of Otolaryngology, Head and Neck Surgery, Xijing Hospital in 2020 due to nonsyndromic hereditary sensorineural hearing loss. The patient had a family history of hearing loss. The patient was part of a six-generation Chinese family with 55 members. The family had autosomal dominant, progressive, postlingual, nonsyndromic sensorineural hearing loss, and these features were consistent with ADNSHL. Nine members of this family participated in the present study, which included three affected and six unaffected relatives. Written informed consent was obtained from each participant, and the study was approved by the Medical Ethics Committee of the First Affiliated Hospital of the Air Force Medical University (approval number KY20212002‑C‑1).

The following information was obtained from each study participant: basic information, age of onset, disease progression, mother's pregnancy, study participant's delivery, noise exposure, ototoxic drug use, head trauma, infectious diseases, family history, and other relevant clinical manifestations. Nongenetic causes of hearing loss, such as noise exposure, ototoxic drugs, and head trauma, were excluded. Physical examinations suggested no syndromic deafness in the family. Audiometric evaluations and otological examinations were performed for the proband, including pure-tone audiometry (PTA), acoustic impedance, distortion-product otoacoustic emission (DPOAE), auditory brainstem response (ABR), and temporal bone computed tomography. The other family members were evaluated using PTA. The average values of the thresholds of air conduction were determined at 500, 1000, 2000, and 4000 Hz to determine the degree of hearing loss in the family. The condition of an individual's hearing loss was classified as mild (26–40 dB HL), moderate (41–60 dB HL), severe (60–80 dB HL), or profound hearing loss (≥ 81 dB HL).

2. Targeted genomic capture and variant analysis

Firstly, genomic DNA from members of this family was extracted from the peripheral blood leukocytes using a blood DNA extraction kit (cat. no. CW0544M, Kang Wei Century Blood Genome Non-column Extraction Kit). Secondly, the DNA library was preparated using Standard Library Building kit (MyGenostics GenCap Enrichment Technologies), included DNA fragmentation, end repair, adapter ligation, polymerase chain reaction (PCR) enrichment and pruduct purification. Thirdly, the qualified library was captured using a GenCap Deafness capture kit (MyGenostics GenCap Enrichment Technologies) and sequenced on an Illumina HiSeq X ten sequencer. The DNA probes were designed to tile along the exon regions of the deafness genes. Subsequently, the raw data obtained by sequencing were saved in FASTQ format, followed by the bioinformatics analysis. The Cutadapt (https://cutadapt.readthedocs.io/en/stable/) was used to preprocess data to remove low-quality reads. The clean reads were aligned to the UCSC hg19 human reference genome using BWA[11] (http://bio-bwa.sourceforge.net/). Duplicated reads were removed using Picard (http://broadinstitute.github.io/picard/) tools, and mapping reads were used for variant detection. The variants of SNP and InDel were detected and filtered using GATK[12] (https://www.broadinstitute.org/gatk/). The variants were further annotated using ANNOVAR[13] (http://annovar.openbioinformatics.org/en/latest/) and associated with multiple databases, such as 1000 Genomes databases[14] (http://browser.1000genomes.org/), ESP6500 (http://evs.gs.washington.edu/EVS/), dbSNP (https://www.ncbi.nlm.nih.gov/snp/), EXAC (http://exac.broadinstitute.org), and HGMD (http://www.hgmd.cf.ac.uk/), and predicted using SIFT (http://sift.jcvi.org/), PolyPhen-2 (http://genetics.bwh.harvard.edu/pph2/), MutationTaster (http://www.mutationtaster.org/), GERP++ (http://mendel.stanford.edu/SidowLab/downloads/gerp/index.html). And finally, the potential pathogenic variants were filtered based on the monogenic autosomal dominant trait.

3. Co-segregation analysis

The specific procedures in this part refer to my published literature[10]. Following exome sequencing, the segregation analysis of candidate variants was completed by PCR and Sanger sequencing. A GSDME gene fragment was amplified and sequenced with the primers 5'-TTCTTCTTCCCTGCCCTACA-3' and 5’-CTCTGTGTCCCCAGAAGCAT-3’. PCR was performed with 25 µL reaction mixtures containing 100 ng genomic DNA, 1 µl of the forward and reverse primers, and 22 µL of 1.1× Golden Star T6 Super PCR Mix (cat. no. TSE101, TsingKe Biological Technology). Thermocycling was performed using the following program: initial denaturation at 98˚C for 2 min, followed by 30 cycles of 98˚C for 10 s, 62˚C for 10 s, and 72˚C for 10 s, and then final extension at 72˚C for 1 min. PCR products were purified using a Cycle Pure kit (cat. no. D6492 OMEGA Bio‑Tek) and sequenced using an Applied Biosystems 3730 DNA Analyzer (Thermo Fisher Scientific, Inc.). All sequencing chromatograms were compared to the published sequence for GSDME.

4. Evolutionary conservation analysis

The target sequence for alignment contained amino acid residues encoded by exon 7–exon 10. Multiple sequence alignment was performed across 18 species using BLAT on the UCSC Genome Browser (https://genome.ucsc.edu).

5. Minigene splicing assay

A minigene splicing assay was performed to verify whether the variant affected splicing products. A partial sequence of the wild type and mutant type GSDME, including partial intron 6, exon 7, intron 7, exon 8, intron 8, exon 9, and partial intron 9 (5605 base pairs), was PCR amplified with gene-specific primers (F: TTATGGGGTACGGGATCACCAGAATTCgcatcgcagtcatgagactt and R: CGGGATCACCAGATATCTGGGATCCtggatgtctaccccctcatc) that contained EcoRI and BamHI restriction enzyme sites. After restriction enzyme digestion by EcoRI and BamHI, the PCR fragment was ligated into the pSPL3 vector and sequenced confirmed. PCR and Sanger sequencing were used to evaluate whether the wild type and mutant type expression vectors had been successfully constructed. Wild type or mutant type GSDME minigenes were transfected into COS7 cells (the kidney cells of the African green monkey). The cells were harvested 36−48 h after transfection. All cellular RNAs were extracted and used to produce cDNA. PCR amplification was performed using primer SD6-F (TCTGAGTCACCTGGACAACC) and SA2-R (ATCTCAGTGGTATTTGTGAGC). The PCR products were isolated after electrophoresis through 1.5% agarose gels and verified by Sanger sequencing.

1. Clinical characteristics

The pedigree of the family contained 55 members in six-generations and showed autosomal dominant inheritance (shown in Fig. 1). The family selected for the study had 11 individuals with hearing loss, 3 of whom (IV:1, V:2, and V:9) were still alive and willing to join this study. Pure‑tone audiograms of the three patients showed bilateral severe-to-profound sensorineural hearing loss (shown in Fig. 2A). Their hearing had begun to decline gradually at the age of 20 years, as mild loss, which then progressed to a severe loss. The three individuals were all diagnosed with autosomal dominant, progressive, postlingual, nonsyndromic sensorineural hearing loss. The remaining family members were unaffected relatives; of these, six members (IV:2, V:4, V:6, V:10, V:14, and VI:8) underwent PTA, and their hearing was normal (shown in Fig. 2B and Table 1). The physical examination of all individuals in this family was otherwise unremarkable.

2. Identification of the splice site variant (c.1183 + 1 G > C)

To identify the genetic cause of hearing loss, the genomic DNA of individual V:9 was subjected to targeted exome sequencing, including all known deafness genes or regions, to identify the genetic cause of hearing loss. According to the autosomal dominant inheritance pattern of the family, only a novel potentially splice site variant, c.1183 + 1 G > C, in the GSDME gene was likely to be pathogenic. According to the ACMG guidelines[15] and the evidence code combinations (PVS1 + PM2), the c.1183 + 1 G > C splice site variant was preliminarily identified as “Likely pathogenic.” PVS1 means that it is a splicing variant, which may result in the loss of gene function. PM2 means that the variant in the database of the normal population is a low-frequency variant. Further, the variant was not reported in the literature database, and the pathogenicity analysis results of the variant were nonexistent in the ClinVar database. The c.1183 + 1 G > C splice site variant in the GSDME gene was a novel pathogenic variant first discovered by us.

3. Co-segregation of genotype and phenotype

Sanger sequencing was performed to confirm whether the c.1183 + 1 G > C splice site variant in the GSDME gene segregated with the affected status in this family. This variant was detected in individuals IV:1, V:2, and IV:9, and all these family members were diagnosed with progressive hearing loss. The variant was not detected in individuals IV:2, V:4, III:14, V:10, V:14, and VI:8, who had a preferable hearing state (shown in Fig. 3). The Sanger sequencing result of all individuals in this family showed that this splice site variant precisely co-segregated with the progressive hearing loss phenotype in this family (Table 1).

4. Functional characterization of the c.1183 + 1 G > C splice site variant on GSDME in vitro

The potential impact of the c.1183 + 1 G > C splice site variant on mRNA splicing was examined with a minigene assay. Wild type or mutant type GSDME minigenes were transfected into COS7 cells, and total RNA was extracted for reverse transcription to obtain cDNA, which was amplified by PCR. Agarose gel electrophoresis and Sanger sequencing of PCR amplification products showed that wild type and mutant type produced different-size bands. This yielded a 658-bp fragment in wild type and a 465-bp fragment in mutant type (shown in Fig. 4A-B). Sanger sequencing showed skipping of exon 8 in the mutant type, which resulted in a direct connection of exon 7 to exon 9 (shown in Fig. 4A-C). This indicated that the c.1183 + 1 G > C splice site variant affected the normal splicing of exon 8, resulting in a range of abnormal transcripts. Wild type GSDME contained 10 exons and encoded a protein of 496 amino acids. The skipping of exon 8 in the mutant type (c.1183 + 1 G > C) GSDME resulted in a frameshift in coding sequences, which started from residuals 331–371 (41 amino acids), produced a stop codon at position 372, and led to the deletion of 125 amino acids in the reading frame. The target sequence was conserved throughout evolution, and the c.1183 + 1 G > C splice site variant led to the changes in the structure and function of the GSDME protein (shown in Fig. 5).

In 1966, Huizing et al. [16, 17] reported a five-generation Dutch family with 335 members and conducted clinical follow-up for about 20 years[18–20]. This family had autosomal dominant deafness, with the hearing loss occurring mostly before the age of 15 years, and the minimum age of onset was 5 years. The audiometric tests revealed bilateral symmetrical sensorineural hearing loss, and the lesion site was located in the cochlea. The hearing loss started at high frequencies and deteriorated rapidly in the first three decades. Besides hearing loss, no other distinctive clinical diseases were reported, suggesting nonsyndromic hearing loss. In 1995, Van Camp et al. located the pathogenic gene to the short arm of chromosome 7 by linkage analysis[8]. In 1998, Van Laer et al. finally determined that the family’s causal gene was GSDME c.990 + 503_990 + 1691delins132 using Southern blot and DNA sequencing[9]. The variant resulted in the skipping of exon 8 at the mRNA level and the formation of truncated GSDME protein.

Previously, 13 GSDME pathogenic variants and related deafness families were reported (Table 2). The phenotypes of the patients in these families were strikingly similar, being nonsyndromic, autosomal dominant, bilateral, symmetrical, postlingual onset, progressive, sensorineural hearing loss. It was accompanied or not accompanied by tinnitus, without vertigo, balance disorders, and symptoms involving other vestibular systems. Hearing loss usually occurred in the first decade, initially affecting at high frequencies and progressing to severe-to-profound deafness at all frequencies rapidly in the second and third decades. In the family of this study, the age of onset of hearing impairment was 18–25 years, which became more serious with age. None of the members had tinnitus or vertigo, and their intelligence and speech functions were normal. The results of PTA showed severe or profound deafness in all the patients. The degree of bilateral hearing loss was about the same, and the hearing loss was mainly at high frequencies with a descending curve, implying that the hearing loss was severer as the frequency became higher. Therefore, the clinical phenotype of this family was basically consistent with that of other DFNA5 families reported in the literature.

In this study, a novel splice site variant c.1183 + 1 G < C in intron 8 of the GSDME gene was identified by targeted genomic capture and sequencing in this family. The results of the minigene assay showed that the variant caused the skipping of exon 8 at the messenger (mRNA) level, leading to a direct linking of exon 7 and exon 9. This variant c.1183 + 1 G < C was present in all patients, but not detected in members with normal hearing in this family. The variant was confirmed to be co‑segregating with postlingual progressive ADNSHL. Based on this, we considered that the GSDME c.1183 + 1 G < C was the causal gene in the family.

The process from DNA to RNA to mature mRNA requires RNA splicing. It is highly conserved and strictly regulated by five small nuclear ribonucleoproteins (snRNPs), which form highly dynamic spliceosomes to complete the splicing reaction[21, 22]. The splicing of RNA is completed by the cooperation of internal and external signals. The internal signals provide binding regions for splicing factors and assist in removing intron regions. The recognition region is distributed between introns and exons and can promote or silence the splicing signal. When the splice site variant occurs, abnormal splicing of RNA may lead to exon skipping, intron retention, and false-exon production, which are the pathogenic mechanisms of many genetic diseases.

To date, 13 GSDME variants associated with hearing loss have been recognized; 6 of them are located in intron 7, 5 of them are in exon 8, and two of them are in intron 8 (shown in Fig. 6). The GSDME c.1183 + 1 G < C in this study was the third variant located in intron 8. Although these variants were different at the genomic DNA level, they all eventually caused the skipping of exon 8 during splicing at the mRNA level. We speculated that the c.1183 + 1 G < C variant in this study eliminated the splicing donor site on intron 8 of the GSDME gene, causing an abnormal splicing reaction between the intron 8 receptor site and the intron 7 donor site, which resulted in the missing transcription of exon 8. The skipping of exon 8 caused a frameshift in coding sequences. A total of 41 abnormal amino acids were translated, and a stop codon was produced at the 372–amino acid position, which eventually generated a truncated GSDME protein, missing the normal carboxyl-terminal fragment.

The molecular pathogenesis of hearing loss caused by the GSDME variant remains unclear. Currently, the reported pathogenic variants of GSDME cause exon 8 skipping at the mRNA level. A deletion or variation in other positions of GSDME did not cause hearing loss[23, 24], and the exon 8 knockout mice of GSDME had normal hearing[25]. It suggested that only the variant of GSDME causing exon 8 skipping could give rise to the deafness phenotype. Other studies showed that the mutant type GSDME could cause toxic effects such as abnormal cell morphology, cell cycle arrest, growth defects, and cell death in yeast and mammalian cells[26, 27]. These results indicated that the cytotoxicity induced by the mutant type GSDME might be because the truncated protein fragment expressed by exon 8 skipping acquired a new function that the wild type GSDME did not possess, and this variant might be a “gain-of-function variant.”

GSDME protein is a member of the gasdermin family, which is related to apoptosis. GSDME protein contains N- (exon 2–6) and C- (exon 7–10) terminal domains. The hinge region (exon 6–7) was between these two domains and connected them[28]. The apoptosis-inducing region is located in the N-terminal domain and has apoptosis-inducing activity. The C-terminal domain folds back and shields the apoptosis-inducing region of the N-terminal domain to avoid inappropriate apoptotic initiation. Active caspase-3 can cleave GSDME protein at Asp270 (D270) to generate an active GSDME protein N-terminal that targets the plasma membrane to induce secondary necrosis/pyroptosis[29]. Exon 8 skipping produces a truncated protein with the shortened C-terminal domain, uncovering the apoptosis-inducing region, which may have a similar biological function as caspase-3 cleavage of GSDME protein. However, whether the hearing loss caused by mutant type GSDME gene is related to secondary necrosis/pyroptosis of hearing cells needs further investigation [30].

Collectively, we reported a six-generation Chinese family with ADNSHL. In this family, a novel GSDME splice site variant c.1183 + 1 G > C leading to the skipping of exon 8 was identified through targeted genomic capture and sequencing and co-segregation analysis. This was the third variant in GSDME intron 8 related to hearing loss. This finding supported the pathogenicity of the splice site variant c.1183 + 1 G > C in the GSDME gene. The data presented in this study extended the pathogenic variant spectrum of the GSDME gene, provided an important molecular interpretation and diagnosis for these patients with ADNSHL, and promoted the development of genetic counseling for inherited deafness.

Acknowledgement

The authors wish to thank the patients and families for participating and understanding in the study. We are grateful to physicians for their cooperation and examination of patients.

Statement of Ethics

All methods in this study were performed in accordance with the relevant guidelines and regulations. This study has been performed in accordance with the Declaration of Helsinki and approved by the Medical Ethics Committee of the First Affiliated Hospital of the Air Force Medical University (approval number KY20212002-C-1), and informed consent was obtained from all the study participants.

Conflict of Interest Statement

The authors have no conflicts of interest to declare.

Funding Sources

This study was supported by the National Key Research and Development Project (2020YFC2005200), the National Natural Science Foundation of China (81870732, 82171161, and 81800918), the Shaanxi Provincial Science and Technology Key Project (2018PT‑01), the Shaanxi Province Key Industry Innovation Chain Project (2022ZDLSF02-10), the Shaanxi Province General Project (2022SF-534), the Xijing Boost‑Free Exploration Project (XJZT19MJ02).

Author Contributions

Dingjun Zha and Jun chen conceptualized and designed the study. Qiong Li, Shujuan Wang and Pengfei Liang researched the family history and recruited the family members. Shujuan Wang and Jian Wang performed PTA testing, disease diagnosis, and DNA extraction. Pengfei Liang and Wei Li completed PCR amplification and Sanger sequencing. Qiong Li, Bei Fan, Yang Yang, and Xiaogang An analyzed the WES data. Qiong Li performed the molecular genetic studies and the sequence alignment analysis. Qiong Li drafted the manuscript. Qiong Li and Shujuan Wang confirmed the authenticity of all the raw data. All authors read and approved the final manuscript.

Data Availability Statement

The datasets used and/or analyzed during the present study are available from the corresponding author on reasonable request. The sequencing dataset has been deposited in NCBI Sequence Read Archive, and the BioProject ID is PRJNA818115(https://www.ncbi.nlm.nih.gov/sra/PRJNA818115).

Jecmenica J, Bajec-Opancina A, Jecmenica D: Genetic hearing impairment. Childs Nerv Syst 2015, 31(4):515–519.
Marazita ML, Ploughman LM, Rawlings B, Remington E, Arnos KS, Nance WE: Genetic epidemiological studies of early-onset deafness in the U.S. school-age population. Am J Med Genet 1993, 46(5):486–491.
Schrijver I: Hereditary non-syndromic sensorineural hearing loss: transforming silence to sound. J MOL DIAGN 2004, 6(4):275–284.
Shearer AE, Hildebrand MS, Smith R: Hereditary Hearing Loss and Deafness Overview. 1993.
Morton CC, Nance WE: Newborn hearing screening–a silent revolution. N Engl J Med 2006, 354(20):2151–2164.
Amberger JS, Bocchini CA, Schiettecatte F, Scott AF, Hamosh A: OMIM.org: Online Mendelian Inheritance in Man (OMIM(R)), an online catalog of human genes and genetic disorders. NUCLEIC ACIDS RES 2015, 43(Database issue):D789-D798.
Amberger JS, Bocchini CA, Scott AF, Hamosh A: OMIM.org: leveraging knowledge across phenotype-gene relationships. NUCLEIC ACIDS RES 2019, 47(D1):D1038-D1043.
van Camp G, Coucke P, Balemans W, van Velzen D, van de Bilt C, van Laer L, Smith RJ, Fukushima K, Padberg GW, Frants RR et al: Localization of a gene for non-syndromic hearing loss (DFNA5) to chromosome 7p15. HUM MOL GENET 1995, 4(11):2159–2163.
Van Laer L, Huizing EH, Verstreken M, van Zuijlen D, Wauters JG, Bossuyt PJ, Van de Heyning P, McGuirt WT, Smith RJ, Willems PJ et al: Nonsyndromic hearing impairment is associated with a mutation in DFNA5. NAT GENET 1998, 20(2):194–197.
Li Q, Liang P, Wang S, Li W, Wang J, Yang Y, An X, Chen J, Zha D: A novel KCNQ4 gene variant (c.857A > G; p.Tyr286Cys) in an extended family with nonsyndromic deafness 2A. MOL MED REP 2021, 23(6).
Li H, Durbin R: Fast and accurate short read alignment with Burrows-Wheeler transform. BIOINFORMATICS 2009, 25(14):1754–1760.
McKenna A, Hanna M, Banks E, Sivachenko A, Cibulskis K, Kernytsky A, Garimella K, Altshuler D, Gabriel S, Daly M et al: The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. GENOME RES 2010, 20(9):1297–1303.
Wang K, Li M, Hakonarson H: ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data. NUCLEIC ACIDS RES 2010, 38(16):e164.
Auton A, Brooks LD, Durbin RM, Garrison EP, Kang HM, Korbel JO, Marchini JL, McCarthy S, McVean GA, Abecasis GR: A global reference for human genetic variation. NATURE 2015, 526(7571):68–74.
Richards S, Aziz N, Bale S, Bick D, Das S, Gastier-Foster J, Grody WW, Hegde M, Lyon E, Spector E et al: Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. GENET MED 2015, 17(5):405–424.
Huizing EH, van Bolhuis AH, Odenthal DW: Studies on progressive hereditary perceptive deafness in a family of 335 members. I. Genetical and general audiological results. Acta Otolaryngol 1966, 61(1):35–41.
Huizing EH, van Bolhuis AH, Odenthal DW: Studies on progressive hereditary perceptive deafness in a family of 335 members. II. Characteristic pattern of hearing deterioration. Acta Otolaryngol 1966, 61(1):161–167.
Huizing EH, van den Wijngaart WS, Verschuure J: A follow-up study in a family with dominant progressive inner ear deafness. Acta Otolaryngol 1983, 95(5–6):620–626.
van den Wijngaart WS, Verschuure J, Brocaar MP, Huizing EH: Follow-up study in a family with dominant progressive hereditary sensorineural hearing impairment. I. Analysis of hearing deterioration. Audiology 1985, 24(4):233–240.
van den Wijngaart WS, Huizing EH, Niermeijer MF, Verschuure J, Brocaar MP, Blom W: Follow-up study in a family with dominant progressive hereditary sensorineural hearing impairment. II. Clinical aspects. Audiology 1985, 24(5):336–342.
Will CL, Luhrmann R: Spliceosome structure and function. Cold Spring Harb Perspect Biol 2011, 3(7).
Jurica MS, Moore MJ: Pre-mRNA splicing: awash in a sea of proteins. MOL CELL 2003, 12(1):5–14.
Van Laer L, Meyer NC, Malekpour M, Riazalhosseini Y, Moghannibashi M, Kahrizi K, Vandevelde A, Alasti F, Najmabadi H, Van Camp G et al: A novel DFNA5 mutation does not cause hearing loss in an Iranian family. J HUM GENET 2007, 52(6):549–552.
Duno M, Hove H, Kirchhoff M, Devriendt K, Schwartz M: Mapping genomic deletions down to the base: a quantitative copy number scanning approach used to characterise and clone the breakpoints of a recurrent 7p14.2p15.3 deletion. HUM GENET 2004, 115(6):459–467.
Van Laer L, Pfister M, Thys S, Vrijens K, Mueller M, Umans L, Serneels L, Van Nassauw L, Kooy F, Smith RJ et al: Mice lacking Dfna5 show a diverging number of cochlear fourth row outer hair cells. NEUROBIOL DIS 2005, 19(3):386–399.
Van Laer L, Vrijens K, Thys S, Van Tendeloo VF, Smith RJ, Van Bockstaele DR, Timmermans JP, Van Camp G: DFNA5: hearing impairment exon instead of hearing impairment gene? J MED GENET 2004, 41(6):401–406.
Gregan J, Van Laer L, Lieto LD, Van Camp G, Kearsey SE: A yeast model for the study of human DFNA5, a gene mutated in nonsyndromic hearing impairment. Biochim Biophys Acta 2003, 1638(2):179–186.
Shi J, Zhao Y, Wang K, Shi X, Wang Y, Huang H, Zhuang Y, Cai T, Wang F, Shao F: Cleavage of GSDMD by inflammatory caspases determines pyroptotic cell death. NATURE 2015, 526(7575):660–665.
Rogers C, Fernandes-Alnemri T, Mayes L, Alnemri D, Cingolani G, Alnemri ES: Cleavage of DFNA5 by caspase-3 during apoptosis mediates progression to secondary necrotic/pyroptotic cell death. NAT COMMUN 2017, 8:14128.
Qiu S, Liu J, Xing F: 'Hints' in the killer protein gasdermin D: unveiling the secrets of gasdermins driving cell death. CELL DEATH DIFFER 2017, 24(4):588–596.
Yu C, Meng X, Zhang S, Zhao G, Hu L, Kong X: A 3-nucleotide deletion in the polypyrimidine tract of intron 7 of the DFNA5 gene causes nonsyndromic hearing impairment in a Chinese family. GENOMICS 2003, 82(5):575–579.
Bischoff AM, Luijendijk MW, Huygen PL, van Duijnhoven G, De Leenheer EM, Oudesluijs GG, Van Laer L, Cremers FP, Cremers CW, Kremer H: A novel mutation identified in the DFNA5 gene in a Dutch family: a clinical and genetic evaluation. Audiol Neurootol 2004, 9(1):34–46.
Wang H, Guan J, Guan L, Yang J, Wu K, Lin Q, Xiong W, Lan L, Zhao C, Xie L et al: Further evidence for "gain-of-function" mechanism of DFNA5 related hearing loss. Sci Rep 2018, 8(1):8424.
Chai Y, Chen D, Wang X, Wu H, Yang T: A novel splice site mutation in DFNA5 causes late-onset progressive non-syndromic hearing loss in a Chinese family. Int J Pediatr Otorhinolaryngol 2014, 78(8):1265–1268.
Booth KT, Azaiez H, Kahrizi K, Wang D, Zhang Y, Frees K, Nishimura C, Najmabadi H, Smith RJ: Exonic mutations and exon skipping: Lessons learned from DFNA5. HUM MUTAT 2018, 39(3):433–440.
Chen X, Jia BL, Li MH, Lyu Y, Liu CX: Case Report: Novel Heterozygous DFNA5 Splicing Variant Responsible for Autosomal Dominant Non-syndromic Hearing Loss in a Chinese Family. FRONT GENET 2020, 11:569284.
Yuan Y, Li Q, Su Y, Lin Q, Gao X, Liu H, Huang S, Kang D, Todd NW, Mattox D et al: Comprehensive genetic testing of Chinese SNHL patients and variants interpretation using ACMG guidelines and ethnically matched normal controls. EUR J HUM GENET 2020, 28(2):231–243.
Ji H, Lu J, Wang J, Li H, Lin X: Combined examination of sequence and copy number variations in human deafness genes improves diagnosis for cases of genetic deafness. BMC Ear Nose Throat Disord 2014, 14:9.
Morgan A, Lenarduzzi S, Cappellani S, Pecile V, Morgutti M, Orzan E, Ghiselli S, Ambrosetti U, Brumat M, Gajendrarao P et al: Genomic Studies in a Large Cohort of Hearing Impaired Italian Patients Revealed Several New Alleles, a Rare Case of Uniparental Disomy (UPD) and the Importance to Search for Copy Number Variations. FRONT GENET 2018, 9:681.
Chen S, Dong C, Wang Q, Zhong Z, Qi Y, Ke X, Liu Y: Targeted Next-Generation Sequencing Successfully Detects Causative Genes in Chinese Patients with Hereditary Hearing Loss. Genet Test Mol Biomarkers 2016, 20(11):660–665.
Li-Yang MN, Shen XF, Wei QJ, Yao J, Lu YJ, Cao X, Xing GQ: IVS8 + 1 DelG, a Novel Splice Site Mutation Causing DFNA5 Deafness in a Chinese Family. Chin Med J (Engl) 2015, 128(18):2510–2515.
Cheng J, Han DY, Dai P, Sun HJ, Tao R, Sun Q, Yan D, Qin W, Wang HY, Ouyang XM et al: A novel DFNA5 mutation, IVS8 + 4 A > G, in the splice donor site of intron 8 causes late-onset non-syndromic hearing loss in a Chinese family. CLIN GENET 2007, 72(5):471–477.

Table 1

Phenotype and genotype of individual family members
Family member	Age (year)	Nucleotide change	PTA-Right (dB HL)	PTA-Left (dB HL)	Age of onset (years)	Noise exposure	Ototoxic drugs	Head trauma
IV:1	67	c.1183 + 1 G༞C	85	72.5	25	No	No	No
IV:2	66	Wild type	16.25	17.5	/	No	No	No
V:2	40	c.1183 + 1 G༞C	76.25	70	18	No	No	No
V:4	35	Wild type	6.25	12.5	/	No	No	No
V:6	31	Wild type	6.25	8.75	/	No	No	No
V:9	30	c.1183 + 1 G༞C	62.5	63.75	20	No	No	No
V:10	29	Wild type	16.25	16.25	/	No	No	No
V:14	30	Wild type	17.5	20	/	No	No	No
VI:8	3	Wild type	7.5	6.25	/	No	No	No

Table 2

Summary of all reported *GSDME* variants leading to hearing loss
Variant DNA	Chromosomal location	Location	Effect of variant	ACMG Pathogenicity classification	Age of onset (year)	Hearing impairment	Ethnicity	References
c.990 + 503_990 + 1691del1189ins132	chr7:24746055-24747243delins	Intron 7	Skipping of exon 8	Pathogenic (PVS1, PS4, PM2)	5–15	High-all frequency	Dutch	Van Laer et al., 1998[9]
c.991 − 15_991-13delTTC	chr7:24746007–24746010	Intron 7	Skipping of exon 8	Likely pathogenic (PS4, PM2)	7–30	High frequency	Chinese	Yu et al, 2003[31]
c.991-6 C > G	chr7:24746001	Intron 7	Skipping of exon 8	Likely pathogenic (PS4, PM2)	0–40	High-all frequency	Dutch	Bischoff et al., 2004[32]
c.991-3 C > A	chr7:24745998	Intron 7	Skipping of exon 8	Likely pathogenic (PS4, PM2)	20–39	High-all frequency	Chinese	Wang et al., 2018[33]
c.991-2 A > G	chr7:24745997	Intron 7	Skipping of exon 8	Pathogenic (PVS1, PS4, PM2)	8–18	High frequency	Chinese	Chai et al., 2014[34]
c.991-2 A > G	chr7:24745997	Intron 7	Skipping of exon 8	Pathogenic (PVS1, PS4, PM2)	10	High-all frequency	European	Booth et al., 2018[35]
c.991-1 G > C	chr7:24745996	Intron 7	Skipping of exon 8	Likely pathogenic (PVS1, PM2)	10–40	High-all frequency	Chinese	Chen et al., 2020[36], Yuan et al, 2020[37]
c.1102 C > G	chr7:24745884	Exon 8	Skipping of exon 8	Likely pathogenic (PS4, PM2, BP4)	10	High frequency	European	Booth et al., 2018[35]
c.1154 C > T	chr7:24745832	Exon 8	Skipping of exon 8	Likely pathogenic (PS4, PM2, BP4)	10	High frequency	Iranian	Booth et al., 2018[35]
c.1158_1161delCTAC	chr7:24745824–24745828	Exon 8	Skipping of exon 8	Pathogenic (PVS1, PS4, PM2)	/	/	Chinese, Italians	Ji et al, 2014[38], Morgan et al., 2018[39]
c.1183 G > A	chr7:24745803	Exon 8	Skipping of exon 8	Pathogenic (PS4, PM1, PM2, PM5, BP4)	10	High frequency	East Asian	Booth et al., 2018[35]
c.1183 G > C	chr7:24745803	Exon 8	Skipping of exon 8	Pathogenic (PS4, PM1, PM2, PM5, BP4)	/	/	Chinese	Chen et al., 2016[40]
c.1183 + 1 delG	chr7:24745801–24745802	Intron 8	Skipping of exon 8	Pathogenic (PVS1, PS4, PM2)	8–30	High-all frequency	Chinese	Li-Yang et al., 2015[41]
c.1183 + 1 G > C	chr7:24745802	Intron 8	Skipping of exon 8	Likely pathogenic (PVS1, PM2)	18–25	High-all frequency	Chinese	This study
c.1183 + 4 A > G	chr7:24745799	Intron 8	Skipping of exon 8	Likely pathogenic (PS4, PM2)	11–50	High-all frequency	Chinese	Cheng et al., 2007[42]

No competing interests reported.

Supplementarymaterial.pdf

PDF

Editorial decision: Major revision
21 Apr, 2022
Reviews received at journal
18 Apr, 2022
Reviewers agreed at journal
13 Apr, 2022
Reviewers agreed at journal
04 Apr, 2022
Reviewers invited by journal
04 Apr, 2022
Editor assigned by journal
31 Mar, 2022
Editor invited by journal
24 Mar, 2022
Submission checks completed at journal
24 Mar, 2022
First submitted to journal
17 Mar, 2022

You are reading this latest preprint version

A novel splice site variant c.1183+1 G>C in DFNA5 causing autosomal dominant nonsyndromic hearing loss in a Chinese Family

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

Conclusion

Declarations

References

Tables

Competing Interests

Supplementary Files

Status:

Version 1