2.1 Drug
ZFCs were bought from the Teaching Hospital of TCM Research of Henan(Lot No. 20180901, Henan, China). Zhongfeng capsules (ZFCs) are composed of Panax Notoginseng, Hirudo, Red Ginseng, Eupolyphaga, Pangolin Scales, Rhubarb, and Radix Salvia Miltiorrhizae. It was identified by Institute of Traditional Chinese Medicine, and was produced by Affiliated Hospital of Henan Academy of Chinese Medicine. It weighs 0.5g per capsule, and contains 1.4245 g of the raw powders per capsule. dl-3-butylphthalide was purchased from CSPC NBP PHARMACE UTICAL CO, LTD(Lot No. 118190343, Hebei, China).
2.2 Experimental animals
SD male rats were weighed 200+20 g, and purchased from Gansu University of Chinese Medicine (Lanzhou, China, Certificate No.: SCXK (gan) 2015-0002). All animals were controlled by humidity and temperature, specific pathogen free grade animal room kept in 12 h cycle light or dark; animals ate freely, drunk freely. Animals were fasted 12 h before surgery, drinking freely.
2.3 Grouping and drug intervention
Sixty healthy SD male rats were andomized into sham control group (SHAM), ischemia reperfusion group(I/R), I/R+dl-3- butylphthalide(I/R+DBT) group(0.05g/kg); and I/R+ Zhongfeng capsule at high-dosage(I/R+ZFCH), middle-dosage(I/R+ZFCM), and low-dosage(I/R+ZFCL) groups (1.08g, 0.54g, and 0.27g/kg, respectively)six groups with 10 rats in each group: Dosages were calculated using the body surface area exchange algorithm[31]. The dosage of ZFCs for adult is 6 g/d, which can be converted into the dosage of rats with standard body weight: 6×0.018×5=0.54 g/d, this dose was used as the medium dose of intervention in rats. Therefore, the high-dosage, middle-dosage and low-dosage of ZFCs were 1.08, 0.54, and 0.27g/d. Rats in each group were given equal volume of saline and gavage administration, repectively for 10 consecutive days after operation.
2.4 Middle cerebral artery occlusion rat model
We performed modified a Zea-Longa method to induce CI/RI[32-33]. Briefly, all anesthetized rats were ligated the right carotid common artery (CCA), external carotid artery (ECA). Following this, at the CCA incision, we inserted nylon wire(0.285mm diameter) into the internal carotid artery(ICA), block the middle cerebral artery (MCA) for 2hour by moving abut 18mm through pulling forward. Reperfusion was established by pulling out the nylonwire. The SHAM rats were not blocked the MCA. The successfully establishment of MCAO rat was evaluated by zeal longa method 24 hours after operation. A score of 1-3 grades indicated that MCAO model rats are successfully established[15]. 24h after the MCAO surgery, I/R+ZFC treatment group dosages were determined to be 1.08g, 0.54g, and 0.27g/kg for the high, middle, and low groups, respectively. Rats in the interfered group were administered intragastrically by dl-3-butylphthalide or ZFC for 10 consecutive days after surgery[26,34], however, rats were infused normal saline in SHAM group and I/R group. The rats were executed after neurological evaluation, serum, brain tissue samples were collected. The sera was used for the ELISA, the brain tissue was used for the immunohistochemical stains, HE stains, TTC stains, TUNEL stains, RT-PCR, and WB assays.
2.5 Neurobehavioral deficit assessement
Neurological impairment[35] was assessed as previously described. The specific scoring criteria are as follows[15]; rats with unconscious, unable to stand and walk were scored 4 grades; rats with the flexion of the front paw, resistance to lateral pressure and a left turning were scored 3 grades; the flexion of the front paw resistant to lateral pressure without the turn were scored 2 grades; the opposite front paw not able to be fully extended were scored 1 grades; and no symptoms of nervous system injury were recorded as 0 grades.
2.6 Infract size in brain tissues measurement
The rats were killed with the injection of sodium pentobarbital (100mg/kg) in abdominal cavity, the brain tissues were collected and frozen. Then, each brain tissue was sectioned coronally and cut into 5 pieces. All sections were soaked with TTC solution (Sangon Biotech, Shanghai, China), and they were photographed for 10-15 min at 37 ℃. The infract size expressed as infarct area percentage(%) was calculated using Adobe Photoshop CS6 (Adobe Systems Inc., USA)[36].
2.7 Haematoxylin-eosin staining for brain histopathology
Rats were administered general anesthesia and the extracted brain tissue fixed by 4% paraformaldehyde. Next, it was dehydrated, embedded, sliced, stained for 5 min and 5-10 min respectively using hematoxylin and 1% eosin. Finally, All sections were photographed by inverted microscope(BX53, Olympus, Tokyo, Japan). The cell-damaging was observed in 5 high power fields of ischemic cortex(×20), its evaluation criteria are as follows, the cell arrangement was disorderly and irregular and hyperchromic, pyknosis or eosinophilic degeneration appeared, intercellular space was enlarged, interstitial edema was obvious, and capillary lumen was collapsed[37].
2.8 Cerebral water content
The cerebral tissue was removed and dried to a constant weight ( 100 ℃ for 72h). The cerebral water content were measured with the wet-dry method[38].
2.9 ELISA for inflammatory cytokines
Serum was isolated from the blood by centrifuging the blood and stored at -80 ℃. ELISA with the Multiskan Sky Microplate Spectrometer (Beijing Haonuos Technology Co. Ltd., Beijing, China) was checked the IL-1β, IL-6, TNF-α levels.
2.10 TUNEL Staining for neuronal apoptosis
After behavioral evaluation, the rats were anesthetized and sacrificed by femoral artery blood collection, the cerebral tissue was quickly dissected and fixed by 4% paraformaldehyde, paraffin embedding. sections of brain tissue were randomly selected. TUNEL method was applied to detect cells of apoptosis according to the instructions of TUNEL kit(Yeasen Biotech Co. Ltd., Shanghai, China). After TUNEL dyeing, anti fluorescence quenching agent was added dropwise for sealing, neuronal apoptosis was observed by fluorescence microscope (IX73-A12FL/PH, Olympus, Japan). Two sections of each sample were taken to acquire data from different five fields of view in ischemic area at high power magnification(20×), the numbers of TUNEL positive staining cells (green represents the positive cells) were analyzed by pathological image analysis system, and calculate the neuronal apoptosis rate[39].
2.11 RT-PCR analysis for gene expression
The brains of the anesthetized rats were removed and were quickly frozen at -80 ℃ for analyzing in the next step. PCR primers pairs were as follows: for GAPDH (sense, 5′AGTGCCAGCCTCGTCTCATA3′, anti-sense, 5′TTGTCACAAGAGAAGGCAG C3′), IL-1β (sense, 5′TGACCCATGTGAGCTGAAAG3′, anti-sense, 5′CGTTGCT TGTCTCTCCTTGTA3′), IL-6 (sense, 5′CTTCACAAGTCGGAGGCTTAAT′, anti- sense, 5′GCATCATCGCTGTTCATACAATC3′), TNF-α (sense, 5′ACCTTATCTA CTCCCAGGTTCT3′, anti-sense, 5′GGCTGACTTTCTCCTGGTATG′), TLR4 (sense, 5′CCGCTCTGGCATCATCTTCA3′, anti-sense, 5′CTCCCACTCGAGGTAGGTG T3′), NF-κB p65 (sense, 5′TGCCGAGTAAACCGGAACTC3′, anti-sense, 5′CAGC CAGGTCCCGTGAAATA3′), Bcl-2 (sense, 5′AGCATGCGACCTCTGTTTG A3′, anti-sense, 5′TCACTTGTGGCCCAGGTATG3′), Bax(sense, 5′GGGTTTCATCCA GGATCGAGCA3′, anti-sense, 5′ACACTCGCTCAGCTTCTTGGT3′), Caspase-3 (sense, 5′GAGCTTGGAACGCGAAGAAA3′, anti-sense, 5′AGTCCATCGACTTGC TTCCA3′). RNA in brain was extracted by Trizol method(Yeasen Biotech, Shanghai, China), RNA concentration was determined using an ultramicro ultraviolet-visible spectrophotometer (Q5000, Quawell Technology Inc., San Jose, CA, USA). Reverse- transcription kit (Yeasen Biotech, Shanghai, China) was used for cDNA synthesis, then the target gene was amplified by PCR(7500, fluorescence quantitative PCR, Foster City, CA, USA). The condition of RT-PCR amplified reaction was 95℃ preheat for 2minutes, 95℃ degeneration for 40seconds, 58℃ annealing for 50 seconds, 60℃ extension for 2minutes, which were cycled for 42 times. The GAPDH gene served as the control gene, and the relative quantity of objective gene was detected by 2−△△Ct formula[40].
2.12 Immunohistochemical staining measure for inflammatory cytokines
The cerebral ischemia tissue of animals were embedded in paraffin and dried. The slices were inactivated with 3% hydrogen peroxide solution. After antigen repair and 5% serum blocking for 1h, the slices were cultured with antibodies IL-1β (1:400, Bioss, Beijing, China), IL-6 (1:500, Genetex, San Antonio, USA), TNF-α (1:300, Genetex, San Antonio, USA) throughout the night, washed with PBS for 3 times, then dropped into the secondary antibody, then the sections were washed by PBS and colored by DAB. Hematoxylin counterstaining was used. After sealing, three visual fields were randomly selected for observation. The cell was investigated, photographed with a microscope(BX43+sc50, Olympus, Japan). The cell was positive cells, which they were stained brown. Using image Plus 6.0 software(Media Cybernetics, Rockville, MD, USA) to measure the positive cells of each visual field, and the IHC scores was calculated[41].
2.13 Western blot analysis
50 mg ischemic brain tissue was plused 500 μl lysis buffer (Solarbio, Beijing, China), and the total protein of ischemic brain tissue was prepared. Using an ultramicro ultraviolet-visible spectrophotometer to select for protein content(50 μg/μl). Then, total protein(10 μl/sample) was loaded and ran on 10–15% polyacrylamide gels, PAGE gel area was selected to conduct trarsmembrane according to relative molecular weight of target protein. Five percent skimmed milk was applied for the closure steps. Western blotting analyses were performed with antibodies against PI3K (1:1000, Affinity, Shanghai, China), p-PI3K (1:1000, Immunoway, Plano, USA), Akt (1:1000, Immunoway, Plano, USA), p-Akt (1:1000, Genetex, San Antonio, USA), NF-κB p65 and I-κBα(1:1000, Immunoway, Plano, USA), Bcl-2 (1:1000, Genetex, San Antonio, USA), Bax (1:1000, Genetex, San Antonio, USA), Caspase-3 (1:1000, Immunoway, Plano, USA), and GAPDH (1:2000, Immunoway, Plano, USA). These antibodies were applied in cold storage all night. Next day, the membrane was incubated by secondary antibody IgG(1:10000, Immunoway, Plano, USA) for 1 h. Objective protein were expressed after a reaction with ECL reagent (Yeasen Biotech Co. Ltd., Shanghai, China) and exposured in darkroom. Using image J software to analyze the target protein's gray value of mixed protein band[39].
2.14 Data analysis
Data analysis was presented as the mean ± STDEV, and using one-way ANOVA of SPSS 20.0 software to tanalyzed data. The LSD method was used for homogeneous variance and tamhane's method was used for heterogeneous variance in group comparison. The criterion of significant difference was p < 0.05.