Tick strains
An acaricide susceptible (Su) R. microplus tick strain, previously reported (21,22) and a multiple acaricide-resistant tick strain dubbed San Alfonso (SA)(23) were used in this study (Table 2). These strains have been maintained for many generations and used as reference for the tick acaricide resistance monitoring programs of the Mexican Federal Government. The SA strain was reared and maintained at Departamento de Ectoparásitos y Dípteros del Servicio Nacional de Sanidad, Inocuidad y Calidad Agroalimentaria (SENASICA- SADER) and the susceptible strain at Centro Nacional de Investigación Disciplinaria en Salud Animal e Inocuidad (CENID-SAI-INIFAP). Each reference strain was obtained by infesting a bovine with 1 × 104 fifteen days old larvae, engorged tick females were collected 19 to 20 days after infestation.
Table 2
Historical resistance of the San Alfonso strain.
Percentage of Mortality |
Organophosphorous | Pyrethroids | Amidines |
year | Coumaphos | Diazinon | Chlorpiriphos | Cypermetrine | Deltametrine | Flumetrine | Amitraz |
2001* | 98.6 | 58.6 | 99.7 | 37.5 | 30.8 | 14.5 | 0.025.2 |
2006** | 20 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 | 0.0 |
2012 | 100 | 90.58 | 99.10 | 0.0 | 0.0 | 0.0 | 0.0 |
2013 | 91.88 | 91.56 | 99.57 | 0.0 | 0.0 | 0.0 | 0.62 |
2016 | 73.24 | 100 | 100 | 0.0 | 0.0 | 0.0 | 10.76 |
* (23) |
** (37) |
Ovary dissection
Ovaries were dissected as described by Cossio et. al., 2015 (20). Briefly: pre-engorged female ticks were washed with distilled water previous to dissection. A transversal cut between the first and second leg pairs separating the whole anterior area. Organs, were extruded into Jan & Jan solution (NaCl 128 mM, KCl 2 mM, 4 mM MgCl2, Sucrose 36 mM, HEPES 5 mM pH = 7.3) without Ca2+ to avoid neurotransmitter depletion.
DNA extraction
10 dissected ovaries were frozen with liquid nitrogen in a ceramic mortar and finely grounded. The resulting frozen powder was resuspended in about 500 µl in 0.1 M sodium citrate, pH 8.5, 50 mM EDTA, 0.1% SDS and 1 mg/ml PCR grade proteinase K (Thermo Fisher). The tissue suspension was incubated for 2hrs at 60 °C, extracted three times with 50% phenol pH 7.0, 50% chloroform; then extracted once with 100% chloroform. The resulting extract was supplemented with a 10th of its volume with Sodium acetate 5M pH 5 and precipitated with 3 times its volume of absolute ethanol. Centrifuged for 5 minutes at 12,000 g, washed once with 70% ethanol, air dried and resuspended in 100 µl of molecular biology grade distilled water.
PCR amplification and SNPs determination
Oligonucleotides for the para-sodium channel relevant domains were synthetized accordingly to the ones reported in (13). PCR was performed using hotstart procedure as follows: 5 minutes at 95 °C before adding Taq DNApolymerase and the following amplification conditions, 30 seconds denaturation at 95 °C, 30 seconds annealing at 59 °C and 30 seconds polymerization at 72 °C for 35 cycles and a final extension cycle at 72 °C for 7 minutes.
The oligonucleotide sequences used were the following:
RmNaDomainIIF1; TACGTGTGTTCAAGCTAGCCAA
RmNaDomainIIR1; ACTTTCTTCGTAGTTCTTGCCAA
RmNaDomainIIIF1; AAGAGGACCAACCGGAATACG
RmNaDomainIIIR1; TCTTCTTTTGTTCATTGAAATTGT
PCR products were sequenced at the “Unidad de Síntesis y secuenciación de ADN del Instituto de Bitecnología” using the same oligonucleotides used for amplification
Acaricide discriminant doses Bioassays (DD)
Ticks were assayed and its toxicological profile was verified by acaricide discriminant doses Bioassays (18)(Table 2). Bioassays were performed with acaricides diluted in trichloro ethylene/ olive oil (2:1) at the following pesticide concentration: coumaphos 0.2%, diazinon 0.08%, chlorpiriphos 0.2%, cypermetrine 0.05%, deltametrine 0.09%, flumetrine 0.01%. 670 µl of each dilution was applied evenly to a 7.7 by 8.5 cm piece of filter paper. The trichloroethylene was evaporated from the filter paper in an extraction hood for 2 h. The treated papers were then folded in half and sealed on the sides with clips, forming a packet into which 100 larvae were placed, the packet was then sealed with another clip. Packets were kept at 28˚C (± 2.0 °C) 80–90% relative humidity for 24 hours, live and death larvae were counted and the data was reported as the percentage of mortality for each tick group each acaricide concentration.
Whole-mount preparation of contractile ovaries
Ovaries were dissected as described above in Jan & Jan solution (NaCl 128 mM, KCl 2 mM, 4 mM MgCl2, Sucrose 36 mM, HEPES 5 mM pH = 7.3) without Ca2+ to avoid neurotransmitter depletion during ovary dissection and preparation. Ovaries were loosely immobilized on a Sylgard plate in a perfusion chamber using stainless steel pins (Austerliz Insect Pins, minutiens 0.1 mm Fine Science tools); organs that may be involved in xenobiotic detoxification such as the fat body, the Malpigi tubules and the intestine were discarded. Mounted ovaries had the Jan & Jan Ca2+ free solution and were substituted with complete Jan & Jan solution (NaCl 128 mM, KCl 2 mM, 4 mM MgCl2, Sucrose 36 mM, 2 mM Ca2+, HEPES 5 mM pH = 7.3).
Videometric analysis of ovary response to cypermethrin
Ovary muscle contraction was videometrically recorded exactly as reported in (20). For each ovary, the ovary area average of the first 15 frames before cypermethrin addition was used as A0. Normalized ovary contraction index (NCI) is defined as the ovary area value of each frame Af normalized with A0 using the following formula:
Normalized contraction index = Af/A0 * 100. The addition of Ca2+ increased in ovary muscle tone reflecting tissue integrity and defining ovary initial area (A0). Normalized contraction index (NCI) is reported. NCI is defined as the area of the ovary at any moment divided by A0 and multiplied by 100. A NCI smaller than 100 means that the tissue has an increase in tone or contraction. A NCI bigger than 100 means that the tissue relaxes or loses tone. The effect of cypermethrin tested on muscle tone (A1) was measured for 70 s of exposure to treatment and averaged. Muscle contraction was induced by depolarization with 15 mM KCl. Final or maximal ovary contraction (A2) is defined as the average of the last 70 seconds after the addition of KCl. The samples were exposed to cypermethrine by perfusion with Jan & Jan solution supplemented with the corresponding cypermethrin concentrations tested (3, 5, 9 and 15 µM). Cypermetrin was dissolved in DMSO and its final concentration was 0.05% in all experiments. In all cases n = 9 contractile ovaries.
Time series statistical analysis
For each data point (frame) the normalized contraction index was averaged between samples of the same treatment (n = 9) and its standard deviation was calculated. Control time series were obtained with susceptible contractile ovaries in (0.05% DMSO in complete Jan & Jan solution without cypermethrin). Experimental time series were compared to controls using ANOVA followed by Dunnett´s multiple comparison test accordingly to Shumway(24). P values ≤ 0.01 were considered significative.