Cell lines and culture conditions
HL-7702 hepatocytes were maintained in 1640 medium, supplemented with 10% heat-inactivated fetal bovine serum. All cell lines were cultured in humidified air with 5% CO2 at 37°C.
Reagents and antibodies
Rapamycin (Gene Operation, Ann Arbor, MI, USA) was dissolved in ethanol (Sigma-Aldrich, Inc., USA) to a stock concentration of 50 mg/ml and stored at -20°C, and was diluted to target final concentrations with culture medium before use. SC75741 (America Selleck Biotechnology Co., Ltd,Houston,Texas,USA) was dissolved in DMSO to a stock concentration of 50 mM, and was diluted to target final concentrations with culture medium before use. The concentration of ethanol in the final solution did not exceed 0.5% (v/v) in any experiment. The following primary antibodies were purchased from Cell Signaling Technology, Inc. (Beverley, MA, USA): anti-NF-κB p65, anti-phospho-NF-κB p65 (Ser536), anti-p-4EBP1 (Thr37/46), anti-p-S6 (Ser240/244), and anti-Raptor. anti-S6 primary antibody was purchased from Santa Cruz Biotechnology, Inc. (CA, USA). anti-4EBP1, anti-p-mTOR (Ser2448), and anti-mTOR were purchased from Abcam (plc 330 Cambridge Science Park, Cambridge, UK). Anti-β-actin primary antibodies were purchased from Sigma-Aldrich, Inc. (St. Louis, MO, USA). ECL Anti-Rabbit IgG-HRP and ECL Anti-Mouse IgG-HRP were obtained from GE Healthcare (Little Chalfont, Buckinghamshire, UK).
ELISA
HL-7702 cells were seeded in 6-well plates at 1×106 cells per well and were incubated until 80% confluence, respectively. To determine the intracellular concentrations of glutamate, oxaloacetate, α-ketoglutaric acid and aspartic acid, HL-7702 cells were cultured in serum-free medium for 13 hours, followed by amino acid starvation for 1 hour, and were then incubated in the presence of glutamate for 1 hour. During serum starvation, cells were pretreated with 100 nM rapamycin for 8 hours, or with 10 μM SC75741 for 12 h, respectively. To determin the intracellular concentrations of glutamate, oxaloacetate, α-ketoglutaric acid and aspartic acid, three groups—control, glutamate, and glutamate with rapamycin—were established. To determine the intracellular concentrations of AST, GDH, ODC, and GAD, HL-7702 cells were treated with rapamycin or SC75741 or were transfected with pRNAT-U6.1/Neo-shRaptor or pIRES2-EGFP-Rheb, respectively. Treated HL-7702 cells were harvested with trypsin and were centrifuged to remove cell culture supernatants. Cell lysates were prepared by 5 freeze–thaw cycles and standardized with the same protein concentration in control groups and treatment groups by adjusting the volume of the protein lysate. Equal volume of protein lysates were measured for glutamate, oxaloacetate, α-ketoglutaric acid and aspartic acid, or for AST, GDH, ODC, and GAD using enzyme-linked immunosorbent assay (ELISA) kits (Wuhan XiqidiBiological Technology Co. Ltd. Wuhan, China) according to the manufacturer’s instructions. Absorbance was measured at 450 nm and 630 nm on a Varioskan Flash Multimode Reader (Thermo Fisher Scientific, Pittsburgh, PA, USA). The absorbance values were measured three times per sample, and the mean value of the 3 independent measurements was used in the statistical analyses.
HPLC analysis
High-performance liquid chromatography (HPLC) was performed using an Agilent 1260 liquid chromatography system (Agilent Technologies Inc. Santa Clara, CA, USA) and DAD (Diode Array Detector). HL-7702 cells were cultured with serum-free medium for 13 hours, followed by amino acid starvation for 1 hour, and were then incubated with ornithine for 1 hour. During serum starvation, cells were pretreated with 100 nM rapamycin for 8 hours. Three groups–control, ornithine, and ornithine with rapamycin—were established. HL-7702 cells were collected and dissolved in 1 mL of lysis buffer, and protein concentration was determined.
For the analysis of putrescine, the protein samples were treated with n-hexane to remove lipids, and the mixture was extracted with N-butanol/trichloromethane (1:1 v/v ratio), which the extracting agent was removed by aspiration and evaporation to dryness under a stream of nitrogen at 40°C. Samples were then dissolved in 0.1 mM HCl for derivatization. For derivatization, the mixture was combined with dansyl chloride, which was then aspirated and evaporated to dryness under a stream of nitrogen at 40°C. Samples were then dissolved in 1 mL methanol for HPLC analysis with a C18 column (150 mm × 4.6 mm, 5 µm) at 30°C. The mobile phase contained A (methanol) and B (water), which was used according to the following program: 0 min, 55% A; 7 min, 65% A; 14 min, 70% A; 20 min, 70% A; 27 min, 90% A; 30 min, 100% A. The flow rate was 1.5 ml/min, and the injection volume was 20 μL. Putrescine was tentatively identified by comparing its retention time with that of authentic standards under identical analysis conditions at 254 nm.
For the detection of ornithine, 200 μL of each protein sample was mixed with 10 μL of 1.0 mg/mL norleucine, 100 μL of 1 mM triethylamine-acetonitrile solution, and 100 μL of 0.1 mM phenyl isothiocyanate-acetonitrile solution and let stand at room temperature for 1 hour. Next, 400 μL n-hexane was added, and the mixture was left standing for 10 min, and the lower clear solution was passed through a 0.45-μm filter. Next, 2.0 μL of each sample was injected into the HPLC system with a DIONEX Acclaim 120 C18 column (250 mm × 4.6 mm, 5 µm) at 40°C (Thermo Fisher Scientific Inc., Waltham, MA, USA). The mobile phase contained A (0.2 mM sodium acetate-acetonitrile solution, v/v = 93:7) and B (water-acetonitrile solution, v/v = 20:80), per the following program: 0 min, 0% B; 5 min, 3% B; 14 min, 11% B; 17 min, 21% B; 29 min, 34% B; 41 min, 100% B. The flow rate was 1.0 ml/min. Ornithine was tentatively identified by comparing its retention time with that of authentic standards under identical analysis conditions at 254 nm.
Western blot analysis
Cells were harvested with trypsin, washed with cold phosphate-buffered saline, and lysed in cell lysis buffer. The cells were then placed on ice for 10 min and centrifuged at 10625 g RCF at 4°C for 10 min. Lysate protein concentrations were determined using the Bradford assay (Bio-Rad Laboratories, USA). Equal amounts (40 μg) of protein were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE; 10% gels (w/v)), transferred to polyvinylidene fluoride (PVDF) membranes, and incubated with the primary antibody overnight at 4°C. Membranes were then incubated with the peroxidase-conjugated secondary antibody for 1 hour at room temperature. Enhanced chemiluminescence (ECL) reagent (Amersham) was used with the Western Blotting System (GE Healthcare Bio-Sciences, Pittsburgh, PA, USA) to detect proteins of interest. Protein bands were quantified on a Gel-Pro Analyzer 4.0 (Media Cybernetics, USA).
RT-qPCR analysis
Reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR) was used to determine mRNA levels of AST, GDH, ODC, and GAD and the Raptor, Rheb in HL-7702 cells of treatment and control groups. Total RNA from the untreated and treated cells was reverse-transcribed with an oligo (dT)12–18 primer using the AMV 1st Strand cDNA Synthesis Kit (Takara Co. Ltd., China). cDNA sequences were amplified with the primers shown in Table S1. The reactions were run using the KAPA SYBP® FAST qPCR Kit optimized for LightCycler® 480 (KAPA BIOSYSTEMS, Inc, Boston, Massachusetts, USA) according to the manufacturer’s instructions. One microliter of cDNA was amplified in a 25-μL reaction that contained 10 μM forward primer (0.5 μL), 10 μM reverse primer (0.5 μL), SYBR Premix Ex Taq (12.5 μL), and nuclease-free water (10.5 μL). Cycling conditions consisted of an initial denaturation step at 95°C for 5 min, then 40 cycles at 95°C for 5 sec, 54°C for 30 sec, and 72°C for 20 sec, followed by a final extension at 72°C for 10 min. Three technical replicates were performed per sample. 2-ΔΔCT values were calculated to determine expression levels, and the qPCR results were analyzed by student’s t-test to compare expression levels between untreated and treated groups. 3 independent experiments were performed.
Table S1 the primers for amplifying cDNA sequences of target genes
Gene Name Gene ID Forward primer (5'-3') Reverse primer (5'-3')
|
|
|
AST
|
26503
|
CCTTCGTATGCTGGTATCCT
|
TTGTACTTCACCTTTGGCG
|
GDH
GAD
|
2746
|
GCTGGAGGAGTGACAGTATCTT
|
TGGAACTCTGCCGTGGGTA
|
2571
|
GGCAATCCTCCAAGAACCT
|
TGATGAAAGTCCAGCACCT
|
ODC
|
4953
|
TGTGGGTGATTGGATGCTC
|
GGCTGCTCTGTGGCGTTT
|
Rheb
|
6009
|
GTTGGTTGGGAATAAGAAAGAC
|
CACATCACCGAGCATGAAGACT
|
Raptor
|
57521
|
GAGCAGGTGACTAAGGAAGAC
|
CAGGTGCCGAGAGTGAAG
|
|
|
|
|
|
|
|
DNA Constructs
Short hairpin (shRNA) Raptor RNA-silencing constructs (shRaptor) with the sequence 5′-aaGCTCTGCACGTCCTTACGTTTCAAGAGAACGTAAGGACGTGCAGAGCtt-3′ were designed and synthesized to construct pRNAT-U6.1/Neo-shRaptor. Rheb cDNA was amplified using the forward primer 5'-GTTGGTTGGGAATAAGAAAGAC-3' and the reverse primer 5'-CACATCACCGAGCATGAAGACT-3', which were based on the human Rheb sequence (GenBank Accession number NM_005614). The Rheb PCR fragment was inserted into pIRES2-EGFP (Clontech Laboratories, Inc., Mountain View, CA, USA) to construct pIRES2-EGFP-Rheb.
In vitro transfection
The plasmids pRNAT-U6.1/Neo-shRaptor and pIRES2-EGFP-Rheb were transfected into HL-7702 cells using Lipofectamine TM2000 (Invitrogen, Carlsbad, New Mexico, USA) per the manufacturer’s instructions. Transfectants were selected by culturing cells in the presence of G418 (Hyclone Laboratories, Inc. Logan, Utah, USA) for 48 hours and were imaged using a ZEISS AX10 fluorescence microscope (Carl Zeiss Microscopy, Thornwood, NY, USA), and then cells were collected. For ELISA assay, cell lysates were prepared by 5 freeze–thaw cycles; for western blot analysis, cells lysates were prepared by lysed in cell lysis buffer.
Statistical Analyses
Statistical analyses were conducted using SPSS PASW Statistics for Windows, v18.0 (SPSS Inc., Chicago, IL, USA). Data were analyzed using standard parametric statistics, one-way ANOVA, followed by Tukey’s method. Data are expressed as mean ± SD. Results are presented as the average of at least 3 independent experiments unless stated otherwise. Statistical significance was accepted when p≤0.05.