2.1 Asthma mouse model establishment
Six- to eight-week-old C57BL/6 mice were purchased from SLAC Laboratories (Shanghai, China). The mice were housed under standard conditions with a 12-h/12-h light/dark cycle at the Animal Center of Hunan Cancer Hospital (Changsha, China) and had free access to food and water. All animal experiments and procedures were performed according to the guidelines of the Center for Medical Ethics, Central South University.
A German CRE (B46, Blattella germanica)-induced asthma mouse model was conducted. In brief, mice were sensitized by intratracheal inhalation of 20 μg CRE in 50 μL of PBS under anesthesia using isoflurane (Sigma, USA) on days (D) 0–4. The mice were challenged by intratracheal instillation of the same amount of CRE on D10–D13. Control mice received the same volume of PBS during the sensitization and challenge phases. Mice were randomly assigned to the two treatment groups (n = 6 each) and were analyzed in a double-blind manner. On D14, the mice were sacrificed. The lung tissues were dissected for histological analyses, and bronchoalveolar lavage fluids (BALFs) were harvested to count total cells and inflammatory cells. A timeline of the mouse experiment is shown in Figure 1A.
2.2 Analysis of lung inflammation
Lung inflammation was assessed. Briefly, BALFs were centrifuged at 300 . g at 4°C for 10 min and washed with ice-cold PBS. Total cells and inflammatory cells including eosinophils (Eos), lymphocytes (Lym), macrophages (Mac), and neutrophils (Neu), were counted to evaluate the percentages of inflammatory cells in BALF by flow cytometry using a FACS Calibur cytometer (BD Biosystems).
IL-4, IL-5, and IL-13 in mouse BALFs were examined by ELISAs, using commercial kits (eBioscience, USA) according to the manufacturer’s recommendations. Serum CRE-specific IgE and IgG1 were examined by ELISAs.
2.3 Cell cultureand lentivirus infection
MSCs were cultured in α-minimum Eagle’s medium (Hyclone, USA) supplemented with 10% fetal calf serum (Hyclone), 100 mg/mL streptomycin (Gibco, USA), and 100 IU/mL penicillin (Gibco) in a humidified incubator with 5% CO2 at 37°C (Thermo Fisher, USA). Cells were passaged in tissue-culture flasks (Corning, USA) in medium containing 0.25% trypsin-EDTA (Gibco) until approximately 80% confluence. Detailed cell-culture procedures were reported in our previous study [47]. MSCs at passages below 8 were used in all experiments.
MiR-21, anti-miR-21, miR negative control (NC), and anti-miR-NC oligonucleotides (50 nM, RiboBio, Guangzhou, China) were transfected into MSCs using the riboFECT™ CP Transfection Kit (Ribo) according to the manufacturer’s protocol. The sequence of Pri-miR-21 was as follows: 5'- TCACAAGACATAAGGACCACAATTTTTGACTGCAAACCATGATGCTGGGTAATGTTTGAATGAAAACATTTGATATGG
ATGGTCAGATGAAAGATACCAAAATGTCAGACAGCCCATCGACTGCTGTTGCCATGAGATTCAACAGTCAACATCAGTCTGATAAGCTATCCGACAAGGTGGTACAGCCATGCG
ATGTCACGACCACGACAGGGGGCAAGCACGAGGTGCTCAGGCAGGGTTTAAAGCAAAGCAAACATCTCTGGTTTGCTGGGGCTT-3'. The miR-21 sequence was 5'-GTGCATTGCTGTTGCATTGC-3'. BM-MSCs were seeded in a six-well plate (Corning) at 1 × 105 cells/well and infected with lentiviral anti-miR-21 and miR-21 mimic, and miR-NC and anti-miR-NC as controls, in the presence of 10 mg/mL polybrene (Millipore, Germany).
Small interfering (si) RNA targeting the β-catenin gene (Ctnnb1) was synthesized at GenePharma (Shanghai, China). An unrelated sequence was used as a negative control, according to our previous report [48]. Briefly, siRNAs were transfected into BM-MSCs during the logarithmic growth phase using Lipofectamine 2000 (Invitrogen, USA) according to the manufacturer’s instructions. During the challenge period (D10–13), mice were intranasally administrated 2 × 106 infectious units (IFUs) of miR-21 lentivirus, and an equal amount of empty lentiviral vector was used as a control.
2.4 BM-MSC migration assays in vivo and in vitro
To verify whether exogenous BM-MSCs can migrate to the lungs in asthmatic mice, 5 × 106 GFP+ BM-MSCs in 0.2 mL of PBS were injected via the tail vein, and the same amount of PBS was injected as a control. To assay MSC migration in vitro, BM-MSCs (1 × 105) were transfected with a plasmid expressing miR-21, anti-miR-21, and β-catenin using Lipofectamine 2000 (Invitrogen) in serum-free minimum Eagle’s medium at 37°C in a 5% CO2 atmosphere for 48 h. Then, the cells were added to the upper chambers of Transwell inserts with 8.0-µm pores in serum-free medium, while normal growth medium was placed in the lower chambers. After incubation for 24 h, the MSCs were fixed and stained with 20% methanol violet (Beyotime, China) and 0.1% crystal violet (Beyotime, China), and counted under a microscope.
2.5 Quantitative reverse-transcription (q-RT) PCR
To evaluate the expression of miR-21 and Ctnnb1 in BM-MSCs, total RNA was isolated from BM-MSCs using TRIzol reagent (Invitrogen, USA). The RNA was treated with RNase-free DNase I (Roche, Basel, Switzerland). cDNA was synthesized using the All-in-OneTM First Strand cDNA Synthesis Kit (AORT-0050, Genecopoeia, USA) and miRNA First Strand cDNA Synthesis Kit (AMRT-0050, Genecopoeia). RT-qPCRs were run using the All-in-OneTM qPCR mix (Genecopoeia) and All-in-OneTM miRNA qRT-PCR Detection Kit (Genecopoeia) on an ABI 7300HT real-time PCR system (Applied Biosystems, USA). Primers for miR-21, Ctnnb1, Gapdh, and U6 were synthesized at Genecopoeia. Relative expression levels of miR-21 and Ctnnb1 were evaluated using the 2–∆∆CT method [49, 50]. U6 was used as an endogenous control for miR-21, and Gapdh was used as an internal control for Ctnnb1.
2.6 Western blotting
Lung tissues and BM-MSCs from the different treatment groups were collected and homogenized in RIPA lysis buffer (Beyotime, China) supplemented with 1 mM phenylmethylsulfonyl fluoride (Beyotime). Protein concentrations were determined using a BCA Protein Assay Kit (Beyotime), and 25 μg protein was loaded per lane. Western blotting was conducted as described previously [48]. The primary antibodies used were anti-β-catenin (D10A8, CST, 1: 1000) and anti-GAPDH (14C10, CST, 1: 1000), and goat anti-rabbit IgG (Invitrogen) was used as the secondary antibody. Immunoreactive bands were visualized with enhanced chemiluminescence reagent (Bio-Rad, USA), using a Tanon-4500 digital image system (Tanon Science & Technology, China).
2.7 Immunostaining and immunofluorescence
For the histological assessment of lung inflammation, mouse lungs were collected and soaked in 10 mL of ice-cold PBS. The samples were fixed in 4% formaldehyde (Sangon Biotech, Shanghai, China), and 5-μm sections were cut and stained with hematoxylin and eosin (HE) or with periodic acid Schiff reagent (Sigma). The sections were examined and photographed under a microscope (Nikon, Japan). Detailed immunostaining procedures for lung histology were described in our previous report [48].
For immunofluorescence, lung sections were blocked with protein-blocking serum-free solution (Dako, Denmark), permeabilized with 0.1% Triton X-100 for 10 min, and blocked in 1% BSA at room temperature for 30 min. The sections were incubated with primary antibody against β-catenin (1:100 dilution) at 4 °C overnight. The sections were washed and incubated with specific secondary antibody in PBS (1:100 dilution) for 60 min. Nuclei were stained with DAPI (Beyotime) at room temperature for 10 min. Immunofluorescence was evaluated under a confocal microscope (Leica Microsystems, Germany). The intensity of co-staining was determined using image acquisition and analysis software (Image J), and the values are presented as mean fluorescence intensity per square micro.
2.8 TOPFlash reporter gene assay
To evaluate the signaling downstream of miR-21, we used a pair of TOPFlash/FOPFlash luciferase reporter constructs (Upstate Biotechnology, USA). BM-MSCs were seeded in a 24-well plate (Corning) at 1 × 105 cells/well and allowed to settle for 24 h. TOPFlash or FOPFlash plasmid (500 ng), pRL-TK Renilla luciferase plasmid (150 ng; Promega, USA), and miR-21 mimic (50 nM) or miR-NC (50 nM) were cotransfected into the BM-MSCs. After 24 h of incubation, the cells were stimulated with 50 ng/mL recombinant murine Wnt3a (PeproTech, USA) for another 24 h. Then, the cells were harvested and luciferase reporter activity was measured in the reporter lysis buffer of the Luciferase Assay System (Promega). TOPFlash and FOPFlash signals were normalized to Renilla luciferase activity, and data are represented as normalized TOPFlash/FOPFlash activity values.
2.9 Statistical analysis
Data are reported as the mean ± SD derived from at least three independent experiments. Means were compared using a two-tailed paired Student’s t-test or using the Chi-square test for categorical variables. P < 0.05 was considered statistically significant.