DOI: https://doi.org/10.21203/rs.2.24422/v1
Background: Toxoplasma gondii is an obligate intracellular protozoan parasite, which can infect almost all warm-blooded animals, including humans, leading to toxoplasmosis. Currently, the effective treatment for human toxoplasmosis is the combination of sulfadiazine and pyrimethamine. However, both drugs have serious side effects and toxicity in the host. Therefore, there is an urgent need for the discovery of new anti-Toxoplasma drugs with high potency and less or no side-effects.
Methods: The cytotoxicity of sulfadiazine and lumefantrine to Vero cells was evaluated by the methyl thiazolyl tetrazolium (MTT) assay. And MTT assay was also used to detect the inhibitory effects of lumefantrine on parasites invasion and proliferation. Flow cytometry was conducted to further verify parasites proliferation. qPCR was performed to evaluate the parasite load in the mice after lumefantrine treatment. In order to determine whether lumefantrine treatment enhances Th1 or Th2 cytokine response, IFN-γ, IL-4, and IL-10 levels in the serum of mice were determined.
Results: Our findings suggest that lumefantrine exerts activity against T. gondii by inhibiting its replication and invasion of Vero cells in vitro without being toxic to the cells. Furthermore, lumefantrine protected mice with acute toxoplasmosis from death to a certain extent and reduced the parasite burden in mouse tissues in vivo. In addition, a significant increase in IFN-γ production was observed in high dose lumefantrine-treated mice while IL-10 and IL-4 levels increased in low dose lumefantrine-treated mice.
Conclusions: The results of this study demonstrated that lumefantrine may be a promising agent to treat toxoplamosis, and more experiments on the protective mechanism of lumefantrine should be undertaken in further studies.
Key words: Toxoplasma gondii, Lumefantrine, anti-Toxoplasma gondii, Invasion, Proliferation
Toxoplasma gondii is an obligate intracellular protozoan parasite, which can infect almost all warm-blooded, including humans, leading to toxoplasmosis [1, 2, 3, 4, 5]. Approximately 30% of the world's population has serological evidence of Toxoplasma infection [6]. T. gondii is a potential threat to both human and animal health. Toxoplasmosis is normally innocuous in individuals with a good immune system, however, T. gondii is quite severe or even fatal for immunocompromised patients, such as those with AIDS, tumour and organ transplant recipients [7–9]. In women, primary infection during pregnancy can cause severe damage to fetus and newborns, including blindness, abortion, and stillbirth.
Several anti-T. gondii drugs, including sulphonamides and pyrimethamine to control toxoplasmosis [10]. Both sulphonamides and pyrimethamine prevent the synthesis of folate by inhibiting the dihydrofolate reductase (DHFR) and dihydropteroate synthase (DHPS) that are essential for the survival and multiplication of parasites [11, 12]. However, these drugs can not completely inactivate encysted bradyzoites or treat congenital toxoplasmosis, and their use is also limited by their side effects, including haematological toxicity (pyrimethamine), cutaneous rash, leukopenia and thrombocytopenia (sulphonamides) [13–16]. There is increasing evidence of treatment failures in patients affected by toxoplasmosis suggesting the existence of drug resistance in clinical therapy against sulphonamides and pyrimethamine [17].
Continuous efforts have been made to develop drugs for the treatment of toxoplasmosis. However, drug development is an expensive and lengthy process [18]. In an attempt to accelerate the process of drug discovery, older drugs, which are being tested and developed for new activities are making a comeback. Lumefantrine (LF), which was previously named benflumetol, is an antimalarial drug synthesized in 1970s in China [19]. Lumefantrine, which exhibits potent antimalarial activities, with a half-life of 2–4 days, is capable of eliminating the residual parasites that remain in the blood, thereby preventing recrudescence [20].
In Guyana, the combination of lumefantrine and artemisinin has shown a better treatment effect for plasmodium vivax [21]. Plasmodium is an apicomplexa intracellular protozoa, which has similar infection mechanisms to T. gondii. However, the effect of lumefantrine on T. gondii has never been studied. Currently, there is an urgent need for the discovery of new anti-Toxoplasma drugs with high potency and less or no side-effects. Therefore, the aim of this study was to evaluate the activity of Lumefantrine against T. gondii using cell culture and mice infected with T. gondii (RH strain) as in vitro and in vivo experimental models, respectively.
Cells were cultured in 25 cm2 culture flasks in DMEM medium (Macgene, China) supplemented with 100 U/mL penicillin, 100 µg/mL streptomycin (Macgene, China), and 10% heat-inactivated foetal bovine serum (FBS) (BI, Israel) at 37 °C in a 5% CO2 atmosphere. T. gondii tachyzoites (RH strain) were maintained in Vero cells cultured in DMEM medium supplemented with penicillin, streptomycin and 2% FBS at 37 °C and 5% CO2.
The cytotoxicity of sulfadiazine and lumefantrine (Sigma, USA) to Vero cells was evaluated by the methyl thiazolyl tetrazolium (MTT) assay[22, 23]. Vero cells (2 × 105 ) were seeded in 96-well plates and cultured in 10% FBS DMEM for 12 h to obtain a monolayer. Monolayer cells were washed and directly subjected to lumefantrine (dilution from 94.5 nmol/L to 2.9531 nmol/L) or sulfadiazine(dilution from 500 mg/L to 15.625 mg/L, from 100 mg/L to 3.125 mg/L, from 30 mg/L to 0.9375 mg/L, respectively), which were diluted with 10% FBS DMEM. The cells were subsequently cultured for 24 h and 48 h. As a control, cells were treated with 200 µL 10% FBS DMEM (Negative control) and 20 µL DMSO (1 µL/mL) (Sigma,USA) together with 180 µL 10% FBS DMEM (Solvent control/DMSO group). Supernatants were removed after culturing for 24 h or 48 h, and the plates were washed twice by PBS and pulsed by adding 10 µL of MTT (Solarbio, China) together with 90 µL 10% FBS DMEM for 4 h in the same culture conditions. The supernatants were removed gently with pipettes and 110 µL formazan was added to each well. The plates were vibrated on a low-speed oscillator, and optical density (OD) was measured at 490 nm by a microplate reader after 30 min (Tecan, Switzerland).
T. gondii tachyzoites (1 × 106) were separately pre-treated with sulfadiazine (10 µg/mL) (positive control), or lumefantrine (94.5 nmol/L, 17.7188 nmol/L or 2.9531 nmol/L) for 2 h. After treatment, tachyzoites were washed three times with PBS and added to Vero cells in a 96-well plate (200 µL/well) (parasites per host cell ratio = 5:1). After 2 h post-infection, extracellular parasites were washed away and then incubated with DMEM (2% FBS) containing sulfadiazine (10 µg/mL) or lumefantrine (94.5 nmol/L, 17.7188 nmol/L or 2.9531 nmol/L) for another 18 h. MTT assay was used to detect the inhibitory effect of lumefantrine on parasites invasion.
The anti-proliferation effect of lumefantrine on T. gondii was also detected using the MTT assay. Vero cell monolayers in 96-well plates were infected with 1 × 106 fresh RH tachyzoites per well and incubated for 2 h. Then, the cell monolayers were washed twice with PBS to remove extracellular tachyzoites and incubated with DMEM (2% FBS) containing different concentrations of lumefantrine (94.5 nmol/L, 17.7188 nmol/L, or 2.9531 nmol/L) for 24 h and 48 h. The sulfadiazine (10 µg/mL) was added as a positive control. Infected cells without drugs were used as a negative control. The MTT assay was carried out to evaluate parasite proliferation as previously described.
To further verify parasites proliferation, flow cytometry was conducted. In brief, Toxoplasma-infected cells were digested by trypsin without EDTA after culturing for 24 h, washed twice with PBS, stained with annexin V-FITC (Biolegend, USA) and Propidium Iodide (Biolegend, USA), and incubated at room temperature for 10–15 min without light. Parasite proliferation was measured using a flow cytometer (BD, USA) [24].
Kunming mice were purchased from Liaoning Changsheng Biotecnology Company, China. Ninety female mice (4–6 weeks, weighing 18–20 g) were divided into 6 treatment groups (15 mice per group). All the mice except the blank control group were infected with fresh T. gondii (100 tachyzoites/mice). After 24 h post-infection, the mice were injected intragastrically with sulfadiazine (10 µg/mL) or lumefantrine(94.5 nmol/L, 17.7188 nmol/L or 2.9531 nmol/L)every two days. Mice in both the blank and parasite control groups were injected intragastrically with the equal amounts of PBS. Mice were observed daily to record the death time and rate. All mice were humanely killed by cervical dislocation to collect blood at 11 days post-infection. Liver, heart, spleen, and lung tissues were collected and stored in liquid nitrogen for RNA extraction.
Tissue RNAs in different groups were extracted using Trizol ((Invitrogen, USA), and the extracted RNAs were treated with DNase I (TaKaRa, China) to completely remove the genomic DNA. The mRNA was reverse transcribed from Oligo (dT) and used as templates for quantitative RT-PCR.
Specific primers (F: TCCGGCTTGGCTGCTTT, R: TTCAATTCTCTCCGCCATCAC) were designed according to the gene sequence of Toxoplasma repeat region (AF146527.1). Quantitative RT-PCR was performed on an ABI PRISM 7500 Real-Time PCR System (Applied Biosystems) using the SYBR Premix Ex Taq kit (TaKaRa, China). Experiment was repeated three times, and transcription levels were represented by the mean values of the three parallel experiments.
The changes of IL-4, IL-10 and IFN-γin mice treated with lumefantrine or sulfadiazine were evaluated using the cytokine ELISA kits (Beyotime, China) according to the manufacturer's instructions. Sera of different treatment groups were used to detect the changes of cytokine levels through three independent experiments. Absorbance at 450 nm was measured by a microplate reader (Tecan, Switzerland).
Data were analyzed using SPSS (ver18.0) computer software (SPSS for Windows, SPSS Inc., 2009). All values are expressed as the mean ± S.D.. Statistical analysis was performed using ANOVA. Differences were considered statistically significant when P-values were ≤ 0.05.
The MTT assay revealed that different concentrations of both lumefantrine and sulfadiazine had no cytotoxicity compared with the negative control cells (Fig. 1a and 1b). Thus, different concentrations of lumefantrine (high 94.5 nmol/L, medium 17.7188 nmol/L, and low 2.9531 nmol/L) and sulfadiazine (10 µg/mL) were used to carry out further experiments against T. gondii in vitro.
Vero cell counts using the MTT assay showed that pre-treatment with 94.5 nmol/L, 17.7188 nmol/L and 2.9531 nmol/L lumefantrine reduced tachyzoites invasion by 7.12%, 7.08%, and 6.72% for 18 h, respectively (Fig. 2A). Sulfadiazine caused a 4.15% reduction after 18 h treatment (Fig. 2A). The invasion ability of pre-treated tachyzoites with different concentrations of lumefantrine and sulfadiazine were significantly reduced compared with the untreated group at 18 h (Toxoplasma group) (P ≤ 0.01).
Further evaluation of the ability of lumefantrine and sulfadiazine to inhibit the intracellular tachyzoite replication within Vero cells was examined using the MTT assay at 24 h and 48 h post-treatment (Fig. 2B). Post-treatment with 94.5 nmol/L, 17.7188 nmol/L or 2.9531 nmol/L lumefantrine reduced the proliferation of tachyzoites by 27.31%, 22.79%, and 20.85% at 24 h and 47.18%, 42.34% and 42.48% at 48 h, respectively (Fig. 2B). A 21.12% reduction at 24 h and 41.2% reduction at 48 h for tachyzoite post-treatment with sulfadiazine were observed (Fig. 2B). This was an indication that lumefantrine could significantly inhibit tachyzoite proliferation compared with the Toxoplasma group (P ≤ 0.01).
The anti-proliferation activity of lumefantrine was further examined using flow cytometry. Samples were stained with annexin V-FITC and Propidium Iodide after treatment with lumefantrine and sulfadiazine for 24 h. Different quadrants represent different states of the cells (Q1:Necrotic and damaged cells. Q2: Late apoptotic cells. Q3: Living cells. Q4: Early apoptotic cells). The more living cells in Q3 quadrant, reflects the good effect of lumefantrine on anti-parasite proliferation (Fig. 3a). These results indicated that different concentrations of lumefantrine could inhibit the proliferation of T. gondii by flow cytometry in Fig. 3a and 3b.
Mice were observed daily and survival time was recorded at 11 days post-treatment. Compared with the Toxoplasma group, mice started to die at 6 days post-treatment. However, mice treated with 94.5 nmol/L, 17.7188 nmol/L, and 2.9531 nmol/L lumefantrine started to die at day 7, 8, and 9 post-treatemt, respectively. The positive group (sulfadiazine group) started to die at day 7 post-treatment. After 11 days, 80%, 66.7% and 53.3% of mice treated with 94.5 nmol/L, 17.7188 nmol/L, 2.9531 nmol/L lumefantrine, respectively had survived, while only 46.7% living mice treated with 10 µg/mL sulfadiazine had survived (Fig. 4).
To further evaluate the parasite load in the mice after lumefantrine treatment, liver, heart, spleen, and lung samples from infected mice were determined by qPCR, and the results are shown in Fig. 5. Treatment with different concentrations of lumefantrine significantly (**p ≤ 0.01 and *p ≤ 0.05) reduced the parasite load in the liver, heart, spleen and lung tissues compared with the Toxoplasma group (PBS group). The parasite load in different tissues except the liver was also reduced in the positive control group (sulfadiazine group).
In order to determine whether lumefantrine treatment enhances Th1 or Th2 cytokine response, IFN-γ, IL-4, and IL-10 levels in the serum of mice were determined in Fig. 6. Significantly higher levels of IFN-γ were observed in mice treated with a high concentration lumefantrine compared to the control groups (p ≤ 0.01). In addition, IL-4 and IL-10 were significantly produced in mice treated with a low concentration lumefantrine compared to the control groups (p ≤ 0.01).
Lumefantrine has been shown to have a prominent inhibition effect on P. vivax (sexual and asexual stages) in China [21, 25]. Lumefantrine can reduce gametocyte rates in blood and inhibit the development of gametocyte in mosquitoes [21, 25]. T. gondii is an apicomplexa intracellular protozoa, which has a similar infection mechanism to Plasmodium. However, studies that have shown successful treatment for toxoplasmosis patients are limited, indicating the urgent need to identify and develop new therapies [26]. In addition, data about the inhibition of T. gondii using lumefantrine is not available. Therefore, in this study, we evaluated the effect of lumefantrine treatment on T. gondii infection in vivo and in vitro .
Cytotoxicity assays showed that lumefantrine was not cytotoxic to Vero cells. Anti-invasion assay showed that the invasion inhibition rate of lumefantrine was about 7% at 18 h post-treatment (p ≥ 0.05), and anti-proliferation assay showed that a 21.12% reduction at 24 h and a 41.2% reduction at 48 h post-treatment with lumefantrine were recorded (p ≤ 0.01). These results indicated that lumefantrine could significantly inhibit the proliferation of T. gondii, which was also verified by Flow cytometry.
Evaluation of anti-T. gondii effects of lumefantrine in mice acutely infected by the RH strain of T. gondii revealed 80%, 66.7%, and 53.3% of mice treated with 94.5 nmol/L, 17.7188 nmol/L, 2.9531 nmol/L lumefantrine, respectively had survived at 11 days post-treatment, and only 46.7% living mice treated with 10 µg/mL sulfadiazine had survived. Furthermore, the parasite burdens in the liver, heart, spleen, and lung after lumefantrine treatment were significantly decreased compared with those in the parasite control group, indicating that lumefantrine exerts an inhibitory effect on T. gondii, partially provides protection against death due to T. gondii infection, and reduces the parasite burden in the tissues of mice. High levels of Th1 (IFN-γ) and Th2 (IL-4, IL-10) cytokines were detected in lumefantrine-treated mice. IFN-γ was the key cytokine in resistance against T. gondii infection [27]. IFN-γ can inhibit the replication of T. gondii in infected cells through various mechanisms, including induction of the inhibitory protein guanamine 2,3-dioxygenase (IDO), inducible nitric oxide synthase (iNOS), the effector proteins immunity-related GTPases (IRGs), and guanylate binding proteins (GBPs) [28]. In the present study, a significant increase in IFN-γ production in mice treated with a high dose lumefantrineimproved mouse survival. These results indicate that lumefantrine can trigger an increased IFN-γ production and contribute to the prevention of acute T. gondii infection. Meanwhile, an increase in IL-10 and IL-4 levels was also observed in mice, which received a low dose of lumefantrine. IL-10 has a central role in limiting inflammation and inhibiting CD4 + T cell-mediated severe immunopathology [29], and IL-4 functions to enhance IFN-γ production in the late stage of infection [30].
In conclusion, our findings suggest that lumefantrine exerts activity against T. gondii by inhibiting its replication and invasion in vitro in the absence of host toxicity in this study. Furthermore, lumefantrine protected mice with acute toxoplasmosis from death to a certain extent and decreased parasite burden in mice tissues in vivo. Therefore, our results clearly demonstrate that lumefantrine may be a promising agent to treat toxoplamosis in the future, However, more experiments on the protective and therapeutic mechanisms of lumefantrine should be undertaken to fully understand the effects of lumefantrine on Toxoplasma gondii.
AIDS: acquired immune deficiency syndrome; DHFR: dihydrofolate reductase; DHPS: dihydropteroate synthase; LF: Lumefantrine; DMEM: Dulbecco's modified Eagle's medium; FBS: foetal bovine serum; MTT: methyl thiazolyl tetrazolium; DMSO: dimethylsulfoxide; OD: optical density; EDTA: Ethylene Diamine Tetraacetic Acid; annexin V-FITC: annexin V fluorescein isothiocyanate; RT-PCR: reverse transcription polymerase chain reaction; qPCR: Quantitative real-time PCR; SYBR: Synergy Brands; FCM: Flow cytometry; IL-4: interleukin-4; IL-10: interleukin-10; IFN-γ: gamma interferon; ANOVA: analysis of variance; IDO: inhibitory protein guanamine 2,3-dioxygenase; iNOS: inducible nitric oxide synthase; IRGs: immunity-related GTPases; GBPs: guanylate binding proteins.
Acknowledgements
Not applicable.
Authors’ contributions
The study was designed by NY. Experiments were performed by DW. The manuscript was revised by El-Ashram S. Data were analyzed by MX, YD, XS, YF, RC, XW, NJ, QC. Manuscript was written by NY and DW. All authors have read and approved the final manuscript.
Funding
This research was supported by grants of the National Key Research and Development Program of China (2017YFD0500400), the National Natural Science Foundation of China (Grant Numbers 31672546) and LiaoNing Revitalization Talents Program (XLYC1907091).
Availability of data and materials
Data supporting the conclusions of this article are included within the article.
Ethics approval and consent to participate
The experiments were performed in strict according to the recommendations of the Guide for the Care and Use of Laboratory Animals of the Ministry of Science and Technology of China. All experimental animal procedures and protocols were approved by the Institutional Animal Care and Use Committee of Shenyang Agricultural University.
Consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
Author details
1Key Laboratory of Livestock Infectious Diseases in Northeast China, Ministry of Education, Key Laboratory of Zoonosis, College of Animal Science and Veterinary Medicine, Shenyang Agricultural University, Dongling Road 120, 110866, Shengyang, China. 2College of Food Science, Shenyang Agricultural University, Dongling Road 120, 110866, Shengyang, China. 3College of Life Science and Engineering, Foshan University, 18 Jiangwan Street, Foshan, 528231, Guangdong Province, China. 4Department of Parasitology, Faculty of Veterinary Medicine, Beni-Suef University, Beni-Suef 62511, Egypt.