Using the esophageal cancer stem cells (CSCs) for better understanding the tumor metastasis and metastasis-associated genes

doi:10.21203/rs.3.rs-1498297/v1

Download PDF

Research Article

Using the esophageal cancer stem cells (CSCs) for better understanding the tumor metastasis and metastasis-associated genes

https://doi.org/10.21203/rs.3.rs-1498297/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Understanding the metastasis and host–tumor cell interactions is needed for effective targeted therapy of metastasis. The aim of this study was to develop mouse model to mimic the late steps of the metastasis process using tail-vein injection of esophageal CSCs. Also, the expression of human metastasis-associated genes (SLUG, E-cad, and CTHRC1) were evaluated in primary tumors.

Material and Methods: The sphere formation assay was used to enrich CSCs from YM-1 cell line. For analysis of tumorigenicity, Adherent cells and enriched CSCs were injected into the nude mice. The expression of SLUG, E-cad, and CTHRC1 genes was examined by Real-Time qRT-PCR and immunohistochemistry (IHC) methods. Also, these cancer cells were injected into the tail vein of nude mice to investigate the metastatic potential of enriched CSCs and their adherent YM-1 cells. To verify metastasis, IHC staining for human p63 and p40 proteins were performed.

Results: Our findings showed the up-regulation of SLUG and down-regulation of E-cad in the esophageal CSC-derived tumors (ECSCTs) compared to adherent cells-derived tumors. There was no statistically significant difference between CTHRC1 gene expressions in both groups of tumors. IHC staining confirmed the higher expression of SLUG protein in ECSCTs compared to adherent cell-derived tumors. Enriched CSCs were able to metastasize to the lungs and livers, but, metastasis of adherent cells wasn't observed.

Conclusion: Our study suggests esophageal CSCs can migrate and metastasize to the lung and liver and this mouse model can provide a useful and relevant model for studying the metastasis in human esophageal cancer. Also, our findings showed the up-regulation of SLUG in the ECSCTs compared to esophageal adherent cells-derived tumors.

Esophageal cancer

Cancer stem cell (CSC)

SLUG

E-cad

CTHRC1

metastasis

Esophageal cancer (EC) is the sixth most common cause of cancer death in the world and its 5-year survival rate is less than 20%[1]. It has two main histological subtypes: Esophageal Adenocarcinoma (EAC) and Esophageal Squamous Cell Carcinoma (ESCC)[2]. EAC is the main histological type of esophageal cancer in Western countries, while the main type of histology in Asian countries is ESCC, which accounts for more than 90% of cases in high-risk regions of Asia such as Iran and China. [3]. Despite recent advancements in therapeutic strategies, cancer of the esophagus is one of the most fatal malignancies in the world because of high rates of local relapse and metastasis to distant organs[4]. Cancer stem cells (CSCs) are thought to be the main reason for tumor initiation, progression, failure in treatment strategies, cancer relapse, and metastasis [5]. These cells are endowed with innate mechanisms that render them more resistant to conventional therapies. Therefore, surviving CSCs can act as a dormant reservoir of tumor cells that potentially able to propagate into secondary tumors [6]. Understanding the molecular mechanisms involved in the aggressive behavior of CSCs enables us to develop targeted therapeutic strategies that prevent tumor recurrence and metastasis. [7]. Differential gene expression analysis of normal and tumor ESCC tissues reported dysregulation of metastatic regulator genes including SLUG, E-cad and CTHRC1 [8]. Changes in the expression or function of some genes can promote benign tumor cells to aggressive and metastatic states[9]. SLUG, a member of the Snail superfamily of zinc-finger transcription factors, was first described as a transcriptional repressor of E-cadherin (E-cad) during epithelial to mesenchymal transition (EMT)[10]. It is a key developmental transcription factor which regulates cell migration during embryogenesis process and its expression is in concomitant with low differentiated tumor pathology, poor prognosis, high cancer relapse and metastasis in several types of cancer[11]. SLUG up-regulation accelerates human glioblastoma cell proliferation and its down-regulation impede the growth of colorectal, prostate, and esophageal cell lines [12–15]. E-cadherin (E-cad) is an important Ca2⁺-dependent glycoprotein which functions as a cell to cell adhesion molecule in epithelial cells[16]. E-cad plays a critical role in epithelial tissue organization and cell polarity. It has been shown that in most cancers of epithelial origin, E-cad-mediated adhesion is lost which helps tumor progression and is a precursor of tumor invasion and metastasis[16]. The gene encoding E-cad is considered an important tumor suppressor gene and its deregulation involved in the initial steps of cancer progression and metastasis[17]. Collagen triple helix repeat containing 1 (CTHRC1) is involved in multidimensional activities such as wound repair, bone remodeling, hepatocytes fibrosis, adipose tissue formation, and its expression is associated with tumorigenesis, proliferation, invasion, and metastasis in many types of cancers[18]. CTHRC1 is expressed in invasive melanomas and inhibiting its expression decreases melanoma cancer cell migration [19]. In breast cancer, CTHRC1 expression is considerably higher than normal tissue and is correlated with the risk of bone metastasis[20]. The aim of this study was to evaluate the expression of human metastasis-associated genes (SLUG, E-cad, and CTHRC1) in primary tumors derived from esophageal adherent cancer cells and cancer stem cells (CSCs) and also, evaluation of CSCs to develop secondary tumors (metastasis).

Cell culture

In the present study, The ESCC-cell line YM-1 was used [21]. Adherent YM-1 cells were cultured in DMEM-F12 medium supplemented with heat-inactivated 10 % fetal bovine serum (FBS) (GIBCO), 100 units/ml penicillin and 100 μg/ml streptomycin (BIOIDEA) and maintained in a humidified 5% CO2 incubator at 37 °C.

Sphere formation assay

To enrich CSCs, YM-1 adherent cells were cultured in in serum-free medium (SFM) consists of basal DMEM/F12 supplemented with 20 ng/ml human recombinant epidermal growth factor (hrEGF) (Royan institute, Tehran, Iran, RP-1102), 20 ng/ml human recombinant basic fibroblast growth factor (hrbFGF) (Royan institute, Tehran, Iran, RP-1112) and 2% B27 supplement (GIBCO) in low attachment Petri dishes at a density of 5000 cells/ml (See our previous article for more details[22]). The floating tumorspheres were collected before they reached 100 μm, then dissociated into single cells with trypsin-EDTA and pipetting. The resulting single cells with a density of 5000 cells/ml re-suspended in SFM allowed to re-form tumorspheres.

Quantitative real-time PCR

For qRT-PCR, total RNA was purified from the adherent YM-1 cells, enriched CSCs, and the tumor tissues derived from the adherent YM-1 cells and enriched CSCs using Trizol reagent (Invitrogen, USA). cDNA synthesis was performed by cDNA synthesis kit from 1 μg of total RNA according to the manufacturer's specifications (Yektatajhiz, YT4500). The resulting cDNAs were amplified using specific primers. The sequences of used primers were: 5'-TCATCGCACTTCTTCTGTGGA-3' and 5'-GCCAACCCAGATAGCAACATC-3' for CTHRC1[23], 5'-TCGGACCCACACATTACCTTG-3' and 5'- AAAAAGGCTTCTCCCCCGTGT-3' for SLUG[24], 5'- TGAGTGTCCCCCGGTATCTTC-3' and 5'- CAGTATCAGCCGCTTTCAGATTTT-3' for E-cad[25], 5'- AAGGTGAAGGTCGGAGTCAA-3' and 5'- AATGAAGGGGTCATTGATGG-3' for GAPDH[26], 5'- TACAGCATGTCCTACTCGCAG-3' and 5'- GAGGAAGAGGTAACCACAGGG -3' for SOX2[27], 5'- ATTCAGGACAGCCCTGATTCTTC-3' and 5'- TTTTTGCGACACTCTTCTCTGC-3' for NANOG[28]. All samples were run in duplicate and GAPDH selected as a reference gene to normalize gene expression. Expression of stemness-related genes (SOX2 and NANOG) were measured to evaluate the stemness potential of CSCs[29]. Expression of SLUG, E-cad, and CTHRC1 genes were examined in adherent YM-1 cells and enriched CSCs. Also, the Expression of SLUG, E-cad, and CTHRC1 genes were examined in the ECSCTs and adherent YM-1 cells-derived tumors.

Tumorigenicity assay

All nude mice experiments were performed at the Pasteur Institute of Iran, North Branch (Amol, Iran) with the approval of the ethics committee of Golestan University of Medical Sciences (ethics code: ir.goums.res.1396.275). For analysis of tumorigenicity, 1× 10⁶ Adherent YM-1 cells and enriched CSCs in a final volume of 300 μl of PBS/Matrigel mixture (1:1 volume) were injected subcutaneously into the dorsal flank of male athymic nude mice (8 weeks old) (please see our previous study for more detail[30]). Mice were palpated twice a week following the inocu lation of the cancer cells.

Analysis of tumorigenicity by Hematoxylin-eosin (H&E) staining and Immunohistochemistry (IHC)

Hematoxylin-eosin (H&E) staining and Immunohistochemical (IHC) studies of tumor tissues were conducted on formalin-fixed, paraffin-embedded sections isolated from the CSC-derived tumors and adherent cell-derived tumors. After deparaffinization using xylene and re-hydration by decreasing ethanol washes, tumor slides were stained with hematoxylin and eosin (HE) for histologic examination. Also, for IHC staining of the tumor xenografts, the slides were deparaffinized with xylene and re-hydrated with decreasing ethanol series. After antigen retrieval, the slides were incubated at 4°C with the primary mouse monoclonal antibody against SLUG (Santa Cruz Biotechnology Cat # sc-166476) diluted 1:50 and immunostained using mouse IgGκ light chain binding protein conjugated to horseradish peroxidase (m-IgGκBP-HRP, sc-516102) for 60 min in 37°C. Then, the chromogen solution (1 tablet of the diaminobenzidine substrate (DAB) (Sigma, cat. no. D9292) and 1 tablet of urea hydrogen peroxide (Sigma, cat. no. U1380) in 5 ml deionized water) was used for visualization. Finally, the slides were counterstained using hematoxylin. Slides were visualized with an Olympus BX53 light microscope equipped with an Olympus DP73 digital camera employ cellSens Standard 1.14 software.

Metastatic tumor formation

To examine the metastasis potential of enriched CSCs, eight nude mice were inoculated via the tail vein. Mice were divided into two groups, mice that received the enriched CSCs and control mice that receive YM-1 adherent cells. After three months, the mice were sacrificed and lungs, liver, brain, spleen, and bone were removed and fixed in 10% neutral-buffered formalin, dehydrated, and embedded in paraffin according to standard protocol[31]. To verify possible metastasis, paraffin sections were analyzed using a Brightfield microscope (Nikon) after stained with hematoxylin and eosin (H&E).

The IHC staining of the p53-related protein p63 (TAp63 isoform, p63, and ΔNp63 isoform, p40) was assessed in lungs, liver, brain, spleen, and bone tissues for confirmation of metastasis.

Esophageal YM-1 cells could form non-adherent tumorspheres

Non-adherent floating tumorsphereswere developed after day 5. Figure 1 showed non-adherent tumorspheresformed by the YM-1cells. After one week, when the tumorspheres grew to about 100 μm, they were passaged and the single cell from tumorspheres could proliferate to form new tumorspheres again. This ability of tumorspheres to produce a new generation of spheres showed their self-renewal capability in vitro [32].

Sox2 and Nanog is expressed in tumorspheres

We examined the expression of Sox2 and Nanogin YM-1 adherent cells and enriched CSCs using Quantitative real-time PCR(qRT-PCR). As seen in Figure 1, the expression of Sox2 and Nanog stemness genes significantly increased in enriched CSCs (tumorspheres) compared to YM-1 adherent cells. This result suggests that in sphere formation assay where stem cell properties are disclosed, stemness genes such as Sox2 and Nanog are expressed.

Sphere cells exhibited higher tumorigenicity in vivo

To confirm that the sphere cells (enriched CSCs) exhibit greater tumor-initiating capability than adherent YM-1 cells as controls, athymic nude mice were transplanted subcutaneously with equal 1× 10⁶ cells. Both adherent YM-1 cells and enriched CSCs were able to generate primary tumors into the dorsal flank of nude mice, however, CSCs were able to develop tumors in a shorter time than the parental adherent YM-1 cells. The adherent parent YM-1 cells formed approximately 10 mm tumor 65 days after injection, while CSCs produced a tumor of the same size in 29 days (Fig.2). All esophageal adherent cells-derived tumors were Intramuscular moderately differentiated squamous cell carcinoma (G2) that characterized by sheets of moderately pleomorphic squamous cells with enlarged vesicular nuclei, prominent eosinophilic nucleoli, abundant eosinophilic cytoplasm, and much mitotic activity. The tumors were well circumscribed and didn’t have extended beyond the muscle (Fig.2). The esophageal cancer stem cell-derived tumors (ECSCTs) were poorly differentiated squamous cell carcinoma (G3) that characterized by sheets of marked pleomorphic epithelial cells with enlarged vesicular nuclei, much more prominent eosinophilic nucleoli, much mitotic activity, and eosinophilic cytoplasm. Also, atypical mitosis and bizarre cells present which indicate poor differentiation. There was also the extra muscular extension of tumor cells accompanied by infiltration of neutrophils and lymphoplasma cells. The extension of tumor cells beyond the muscle indicates the aggressive nature of the tumor-forming cells (Fig. 2). The results suggested that the tumorigenic efficacies of CSCs were enhanced compared with the parental adherent YM-1 cells.

Up-regulation of SLUG and Down-regulation of E-cad in the ECSCTs

To answer the question of whether metastasis-associated genes such as SLUG, E-cad, and CTHRC1 are different expression levels in the esophageal cancer stem cell-derived tumors (ECSCTs) compared to esophageal adherent cells-derived tumors in vivo, the Real-Time qRT-PCR analysis was used. Real-Time qRT-PCR analysis showed up-regulation of SLUG (P value=0.034) and down-regulation of E-cad (P value= 0.043) in the ECSCTs compared to esophageal adherent cells-derived tumors. There was no statistically significant difference between CTHRC1 gene expressions in both groups of tumors (P value=0.754) (Fig.3).

Up-regulation of SLUG protein in ECSCTs

To confirm the expression of SLUG at the protein level and to compare it in ECSCTs and esophageal adherent cells-derived tumors, IHC staining was used. As seen in Figure 3, IHC staining confirmed the higher expression of SLUG protein in ECSCTs compared to adherent cell-derived tumors.

Metastasis were observed in the mice injected by enriched CSCs

Histological examination showed no tumor involvement in brain, spleen, and bone samples. Mild pulmonary interstitial pneumonitis and mild periportitis (Triaditis) were observed in the lungs and liver of mice who received enriched CSCs via tail vein (Metastatic model). To verify metastasis, immunohistochemical stains for human p63 and p40 proteins were done. This staining revealed the micrometastasis in the liver and lungs of mice who received enriched CSCs (Fig.4, 5).

However, mild pulmonary interstitial pneumonitis and mild interstitial fibrosis were observed in the lungs of one mouse who received the adherent YM-1 cells, no metastasis was confirmed by IHC (staining of Human p63 and p40).

Cancer metastasis, which accounts for about 90% of cancer-related deaths[33], is the main cause of high mortality cancers such as esophageal cancer (EC) with aggressive growth and poor prognosis, and a lack of targeted therapies[34]. Metastasis is a highly complex and dynamic multi-step process that involves the local tumor cell invasion from the primary tumor, intravasation, arrest followed by the extravasation of the circulatory system, and colonization at a distant site[35]. Understanding the metastasis and host–tumor cell interactions is needed for effective targeted therapy of metastasis[36, 37]. The process of metastasis is still poorly understood, however, some reports suggest that metastatic CSCs may be the main cause of metastasis[38]. The sphere formation assay was used for the enriching of esophageal YM-1 CSCs in the curre

t study. The sphere formation assay is a marker-independent enriching method that cancer cells are exposed to particular stresses in serum-free media using ultra-low attachment surface plates[39]. In such low-attachment conditions, differentiated cancer cells undergo detachment-induced apoptosis (anoikis) but cancer stem-like cells can survive, proliferate and form three-dimensional spheres [40]. As mentioned above, the tumorspheres were singled and passaged in a serum-free medium. The single cells were able to divide and form new spheres again so they were able to maintain the undifferentiated state after many rounds of cell division which showed their self-renewal ability. In the current study, Real-Time qRT-PCR analysis showed that the expression of Sox2 and Nanog was increased in the YM-1 tumorsphere cells compared to adherent YM-1 cells. The expression of Sox2 and Nanog have been reported in some tumorsphere cells, indicating that they may be involved in self-renewal and tumorigenesis [22, 29, 41].

Self-renewal and multilineage differentiation potential are key characteristics of any stem cell. The gold standard method that accomplishes these two important criteria is transplantation in animal models[42]. In present study, adherent YM-1 cells and enriched CSCs were able to generate primary tumors into the dorsal flank of nude mice, but CSCs were able to develop tumors in a shorter time than the adherent YM-1 cells. Therefore, enriched CSCs were more tumorigenic and showed stem cell features in practice. Metastasis is a multistep process in which cancer cells detach from the tumor and invade into surrounding parenchyma, enter the bloodstream or lymphatic vessels and after survival in the circulation, they extravasate into the target organ and proliferate in the new tissue .These steps are not only dependent on the cancer cells's properties but also the existing microenvironment in the tumor site and the one these cells encounter after extravasation into the target organ [43]. Cancer cells must overcome many factors in the bloodstream to reach a new organ, including caspase-dependent apoptosis (anoikis) due to Loss of adhesion and escape from the host cell immune system[44]. Studies show that micrometastasis may be missed during the pathology examination [45]. Therefore, the need to use immunohistochemistry with the help of anti-human antibodies can be a great help in confirming the presence of metastasis. In the current study we used adherent YM-1 cells and enriched CSCs for modeling metastasis via tail vein injection After three months, the mice were sacrificed and Mild pulmonary interstitial pneumonitis and mild periportitis were observed in the lungs and liver of mice who received enriched CSCs via tail vein (Metastatic model). To verify metastasis, immunohistochemical stains for human p63 and p40 proteins were performed and showed the infiltration of metastatic enriched CSCs into lungs and liver parenchyma (Fig. 4,5). Micrometastatsis was observed in the lungs and liver of three mice from the ten mice received adherent YM-1 cells and enriched CSCs. Therefore, these data show the ability of enriched CSCs to survive in the bloodstream and extravasate into the liver and lung parenchyma, and proliferate in the new environment. Charlotte Kuperwasser et al. in 2005 injected PC-3, MDA-MB-231, SUM159, and SUM149 cell lines in mice through the caudal vein to model the metastasis of breast cancer. They used human pan-cytokeratin as a marker to confirm metastases and reported that micrometastases were present in the lungs of mice [46]. In a 2010 study by Kumar et al., 4T1 mouse breast cancer cells were inoculated into BALB /c mice with the aim of establishing an animal model of breast cancer metastasis. They found that 4T1 mouse breast cancer cells were able to migrate to the liver and metastasize[47]. In 2022, Shirley Liu and colleagues established the first SBBC model to evaluate metastatic breast cancer cells. They found that the majority of micrometastases often occurred in the lungs of mice and originated from primary tumors [48]. Previous studies have shown that different cancer cell lines show different potency for metastasis in mouse models. Tetsuhiro Nakano et al. in a study on the metastatic ability of two human lung cancer cell lines, PC14 and PC14HM, reported that one of five mice that received PC14 cells showed lung and bone metastasis, but all five mice received PC14HM cell showed metastasis to lung, lymph nodes, bone, and adrenal glands [49]. In another study on the metastatic potential of colon cancer cell line, SW480, Chaoyu Ma et al. reported that only nine mice from twenty mice showed metastatic nodules in the lung [50]. Although cancer cells are able to get trapped in lung capillaries, most of them die from apoptosis and only less than 1% remain to exit from the vessel and colonize and proliferate in the lungs which indicates metastasis is a process with very low efficiency [44] Therefore, cancer cells must be able to activate and express genes that ensure their survival in the bloodstream and target organs, and maintain their ability to move and invade. Dysregulation of metastatic regulator genes such as SLUG, E-cad, and CTHRC1 has been reported on a differential gene expression analysis of normal and tumor ESCC tissues [8].

In the present study, the expression of SLUG, CTHRC1, and E-cad genes was compared between the esophageal cancer stem cell-derived tumors (ECSCTs) compared to esophageal adherent cells-derived tumors.Our findings showed overexpression of SLUG in the ECSCTs compared to esophageal adherent cells-derived tumors. Therefore, the present study suggests a role of metastasis regulator for SLUG in esophageal cancer. However, further studies are needed.SLUG is the transcriptional repressor of E-cad that results in EMT, a process which mediates invasion and metastasis of tumor cells[51]. Epithelial cells undergoing EMT lose polarity and intercellular adhesion and become more motile and invasive[52]. SLUG beyond its role as the transcriptional repressor of E-cad preserves stem-like phenotype in cancer cells that results in cancer cells resistance to common chemo- and radiotherapies in many types of cancers[53]. Immunohistochemical staining confirmed significantly higher SLUG protein expression in the ECSCTs compared to esophageal adherent cells-derived tumors, in current study. There is evidence supporting SLUG function in stemness, for example, Sarah Phillips et al showed SLUG absence results in unusual mammary tissue hemostasis and lack of stem cell activity required for renewing the tissue and cancer initiation[54]. Alfonso Catalano et al. reported that the Stem Cell Factor/c-Kit/SLUG signal transduction is involved in multidrug resistance of Malignant Mesothelioma (MM) and c-kit or SLUG knockdown results in increased sensitivity of MM cells in response to chemotherapeutics including doxorubicin, paclitaxel, and vincristine[55].Here, we observed CSCs were able to develop tumors in a shorter time than the adherent YM-1 cells highlighting the more tumorigenic potential of the CSCs which had higher SLUG levels. Real-Time qRT-PCR analysis showed down-regulation of E-cad in parallel to SLUG increase which may indicate the inhibitory effect of SLUG on E-cad expression. There was no statistically significant difference between CTHRC1 gene expressions in both groups. However, CTHRC1 is elevated in several types of cancers.Interestingly, in this study, the spearman correlation test indicated a significant direct relation between SLUG and CTHRC1 genes (P value: 0.003, R: 0.723). According to the previous studies, there are mechanisms which explain this direct correlation. Yuan-hui Lai et al. reported that CTHRC1 can inhibit GSK3- β by ser-9 phosphorylation leading to β-catenin accumulation in the nucleus[56]. It has been demonstrated that β-catenin can directly upregulate the SLUG gene transcription [57]. Furthermore, Shih-Han Kao et al. showed that GSK-3β can phosphorylate SLUG directly, marking it for ubiquitination and degradation. They observed that phosphorylated GSK-3β in ser-9 is associated with the increased expression of SLUG in non-small cell lung cancer[58]. Concordantly, Jianpeng Liu et al. reported that the CTHRC1 knockdown in glioblastoma cells results in SLUG downregulation [59]. These studies show a direct regulatory effect of CTHRC1 on SLUG expression.

In summary, the current study suggests esophageal CSCs can migrate and metastasize to the lung and liver and this mouse model can provide a useful and relevant model for studying the metastasis in human esophageal cancer. Also, our findings showed up-regulation of SLUG in the ECSCTs compared to esophageal adherent cells-derived tumors. The metastatic regulators (SLUG and E-cad) are associated with esophageal CSC tumorigenicity. Also, we observed a direct correlation between SLUG and CTHRC1 genes.

Esophageal Cancer (EC)

Esophageal Adenocarcinoma (EAC)

Esophageal Squamous Cell Carcinoma (ESCC).

Cancer Ctem Cells (CSCs)

E-cadherin (E-cad)

Epithelial to Mesenchymal Transition (EMT)

Collagen Triple Helix Repeat Containing 1 (CTHRC1)

Hematoxylin-Eosin (H&E)

Immunohistochemical (IHC)

Esophageal Cancer Stem Cell-derived Tumors (ECSCTs)

Funding This study was extracted from a master thesis and supported by Golestan University of Medical Sciences (Grant number: 960413074).

AcknowledgementsWe would like to thank Dr. Amir Reza Jalilian Nosrati (Anatomical clinical Pathologist) and Dr. Fatemeh Alipour (Ph.D. of anatomy) for their help and guidance on histological examinations.

Author contributionJ.A. and A.Kh. contributed in study conception design. F.K. carried out all the experiments. A.Kh and M.S.J contributed in cell culture experiments and data analysis. The first draft of the manuscript was written by F.K and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.

Conflict of interest There are no conflicts to declare.

Ethical approval This study was approved by the ethical committee of Golestan University of Medical Sciences (approval code: ir.goums.res.1396.275).

Statements and Declarations

We authors of the above-titled paper hereby declare that the work included in the above paper is original and is an outcome of the research carried out by the authors indicated in it. Further, we authors declare that the work submitted to the journal of Molecular Biology Reports has not been published already or is under consideration for publication in any Journals. We, also, confirm that the manuscript has been read and approved by all named authors and the order of authors listed in the manuscript has been approved by all of us.

Globocan (2018) World Health Organisation. Globocan 2018: Estimated cancer incidence, mortality and prevalence worldwide in 2018
Bird-Lieberman E, Fitzgerald R (2009) Early diagnosis of oesophageal cancer. Br J Cancer 101(1):1
Torre LA, Bray F, Siegel RL, Ferlay J, Lortet-Tieulent J, Jemal A (2015) Global cancer statistics, 2012. Cancer J Clin 65(2):87–108
Wobst A, Audisio R, Colleoni M, Geraghty J (1998) Oesophageal cancer treatment: studies, strategies and facts. Ann Oncol 9(9):951–962
Morata-Tarifa C, Jiménez G, García MA, Entrena JM, Griñán-Lisón C, Aguilera M, Picon-Ruiz M, Marchal JA (2016) Low adherent cancer cell subpopulations are enriched in tumorigenic and metastatic epithelial-to-mesenchymal transition-induced cancer stem-like cells. Sci Rep 6:18772
O’Brien CA, Pollett A, Gallinger S, Dick JE (2007) A human colon cancer cell capable of initiating tumour growth in immunodeficient mice. Nature 445(7123):106
Mladinich M, Ruan D, Chan C-H (2016) Tackling cancer stem cells via inhibition of EMT transcription factors. Stem cells international 2016
Su H, Hu N, Yang HH, Wang C, Takikita M, Wang Q-H, Giffen C, Clifford RJ, Hewitt SM, Shou J-Z (2011) Global gene expression profiling and validation in esophageal squamous cell carcinoma (ESCC) and its association with clinical phenotypes.Clinical Cancer Research:clincanres. 2724.2010
Fares J, Fares MY, Khachfe HH, Salhab HA, Fares Y (2020) Molecular principles of metastasis: a hallmark of cancer revisited. Signal Transduct Target therapy 5(1):1–17
Hajra KM, Chen DY, Fearon ER (2002) The SLUG zinc-finger protein represses E-cadherin in breast cancer. Cancer Res 62(6):1613–1618
Wang Y, Shi J, Chai K, Ying X, Zhou BP (2013) The Role of Snail in EMT and Tumorigenesis. Curr Cancer Drug Targets 13(9):963–972
Baygi ME, Soheili Z-S, Essmann F, Deezagi A, Engers R, Goering W, Schulz WA (2010) Slug/SNAI2 regulates cell proliferation and invasiveness of metastatic prostate cancer cell lines. Tumor Biology 31(4):297–307
Qian J, Liu H, Chen W, Wen K, Lu W, Huang C, Fu Z (2013) Knockdown of Slug by RNAi inhibits the proliferation and invasion of HCT116 colorectal cancer cells. Mol Med Rep 8(4):1055–1059. doi:10.3892/mmr.2013.1604
Yang HW, Menon LG, Black PM, Carroll RS, Johnson MD (2010) SNAI2/Slug promotes growth and invasion in human gliomas. BMC Cancer 10(1):301
Zhang K, Zhang S, Jiao X, Wang H, Zhang D, Niu Z, Shen Y, Lv L, Zhou Y (2011) Slug regulates proliferation and invasiveness of esophageal adenocarcinoma cells in vitro and in vivo. Med Oncol (Northwood Lond Engl) 28(4):1089–1100. doi:10.1007/s12032-010-9652-7
Cavallaro U, Christofori G (2004) Cell adhesion and signalling by cadherins and Ig-CAMs in cancer. Nat Rev Cancer 4(2):118–132
Weinberg RA (2013) The biology of cancer. Garland science
Jiang N, Cui Y, Liu J, Zhu X, Wu H, Yang Z, Ke Z (2016) Multidimensional Roles of Collagen Triple Helix Repeat Containing 1 (CTHRC1) in Malignant Cancers. J Cancer 7(15):2213–2220. doi:10.7150/jca.16539
Tang L, Dai DL, Su M, Martinka M, Li G, Zhou Y (2006) Aberrant expression of collagen triple helix repeat containing 1 in human solid cancers. Clin cancer research: official J Am Association Cancer Res 12(12):3716–3722. doi:10.1158/1078-0432.ccr-06-0030
Kharaishvili G, Cizkova M, Bouchalova K, Mgebrishvili G, Kolar Z, Bouchal J (2011) Collagen triple helix repeat containing 1 protein, periostin and versican in primary and metastatic breast cancer: an immunohistochemical study. Journal of clinical pathology:jclinpath-2011-200106
Ayyoob K, Masoud K, Vahideh K, Jahanbakhsh A (2016) Authentication of newly established human esophageal squamous cell carcinoma cell line (YM-1) using short tandem repeat (STR) profiling method. Tumor Biology 37(3):3197–3204
Sadeghzadeh Z, Khosravi A, Jazi MS, Asadi J (2020) Upregulation of Fucosyltransferase 3, 8 and protein O-Fucosyltransferase 1, 2 genes in esophageal cancer stem-like cells (CSLCs).Glycoconjugate Journal:1–9
Qin S, Zheng J-h, Xia Z-h, Qian J, Deng C-l, Yang S-l (2019) CTHRC1 promotes wound repair by increasing M2 macrophages via regulating the TGF-β and notch pathways. Biomed Pharmacother 113:108594
Liu X, Chen L, Huang H, Lv J-M, Chen M, Qu F-J, Pan X-W, Li L, Yin L, Cui X-G (2017) High expression of PDLIM5 facilitates cell tumorigenesis and migration by maintaining AMPK activation in prostate cancer. Oncotarget 8(58):98117
Vinciguerra M, Carrozzino F, Peyrou M, Carlone S, Montesano R, Benelli R, Foti M (2009) Unsaturated fatty acids promote hepatoma proliferation and progression through downregulation of the tumor suppressor PTEN. J Hepatol 50(6):1132–1141
Bray A, Cevallos R, Gazarian K, Lamas M (2014) Human dental pulp stem cells respond to cues from the rat retina and differentiate to express the retinal neuronal marker rhodopsin. Neuroscience 280:142–155
Gao X, Liu X, Lu Y, Wang Y, Cao W, Liu X, Hu H, Wang H (2019) PIM1 is responsible for IL-6-induced breast cancer cell EMT and stemness via c-myc activation. Breast Cancer 26(5):663–671
Hoshino Y, Nishida J, Katsuno Y, Koinuma D, Aoki T, Kokudo N, Miyazono K, Ehata S (2015) Smad4 decreases the population of pancreatic cancer–initiating cells through transcriptional repression of ALDH1A1. Am J Pathol 185(5):1457–1470
Khosravi A, Jafari SM, Asadi J (2020) Knockdown of TAZ decrease the cancer stem properties of ESCC cell line YM-1 by modulation of Nanog, OCT-4 and SOX2. Gene:145207
Khosravi A, Kokabi F, Behzadi R, Asadi J (2019) Tumorigenicity of Esophageal Cancer Stem Cells (ECSCs) in nude mouse xenograft model. Jorjani Biomed J 7(3):4–10
Cardiff RD, Miller CH, Munn RJ (2014) Manual hematoxylin and eosin staining of mouse tissue sections. Cold Spring Harbor Protocols 2014 (6):pdb. prot073411
Gaviraghi M, Tunici P, Valensin S, Rossi M, Giordano C, Magnoni L, Dandrea M, Montagna L, Ritelli R, Scarpa A (2011) Pancreatic cancer spheres are more than just aggregates of stem marker-positive cells. Biosci Rep 31(1):45–55
Obenauf AC, Massagué J (2015) Surviving at a distance: organ-specific metastasis. Trends in cancer 1(1):76–91
Bhat AA, Nisar S, Maacha S, Carneiro-Lobo TC, Akhtar S, Siveen KS, Wani NA, Rizwan A, Bagga P, Singh M (2021) Cytokine-chemokine network driven metastasis in esophageal cancer; promising avenue for targeted therapy. Mol Cancer 20(1):1–20
Valastyan S, Weinberg RA (2011) Tumor metastasis: molecular insights and evolving paradigms. Cell 147(2):275–292
Stoletov K, Beatty PH, Lewis JD (2020) Novel therapeutic targets for cancer metastasis. Expert Rev Anticancer Ther 20(2):97–109
Kudo-Saito C, Ozaki Y, Imazeki H, Hayashi H, Masuda J, Ozawa H, Ogiwara Y (2021) Targeting Oncoimmune Drivers of Cancer Metastasis. Cancers 2021, 13, 554. s Note: MDPI stays neutral with regard to jurisdictional claims in published &#8230
Afify SM, Hassan G, Osman A, Calle AS, Nawara HM, Zahra MH, El-Ghlban S, Mansour H, Alam MJ, Abu Quora HA (2019) Metastasis of cancer stem cells developed in the microenvironment of hepatocellular carcinoma. Bioengineering 6(3):73
Dobbin ZC, Landen CN (2013) Isolation and characterization of potential cancer stem cells from solid human tumors—potential applications. Curr protocols Pharmacol 63(1):1428 11-14.28. 19
Dontu G, Abdallah WM, Foley JM, Jackson KW, Clarke MF, Kawamura MJ, Wicha MS (2003) In vitro propagation and transcriptional profiling of human mammary stem/progenitor cells. Genes Dev 17(10):1253–1270
Wang F, Tang C, Xu D, Tang Y, Jiang Y, Gao X, Xu J (2020) LncRNA ADAMTS9-AS2 suppresses the proliferation of gastric cancer cells and the tumorigenicity of cancer stem cells through regulating SPOP. J Cell Mol Med 24(8):4830–4838
Griessinger E, Andreeff M (2018) NSG-S mice for acute myeloid leukemia, yes. For myelodysplastic syndrome. no. Haematologica
Steeg PS (2006) Tumor metastasis: mechanistic insights and clinical challenges. Nat Med 12(8):895–904
Gupta GP, Massagué J (2006) Cancer metastasis: building a framework. Cell 127(4):679–695
Bacou M, Rajasekaran V, Thomson A, Sjöstrand S, Kaczmarek K, Ochocka-Fox AM, Gerrard AD, Moug S, Jansson T, Mulvana H (2022) Development of preclinical ultrasound imaging techniques to identify and image sentinel lymph nodes in a cancerous animal model. Cancers 14(3):561
Kuperwasser C, Dessain S, Bierbaum BE, Garnet D, Sperandio K, Gauvin GP, Naber SP, Weinberg RA, Rosenblatt M (2005) A mouse model of human breast cancer metastasis to human bone. Cancer Res 65(14):6130–6138
Kumar SS, Radhakrishnan A, Cheong S (2010) Rapid metastasis of breast cancer cells from primary tumour to liver. Pakistan J Biol sciences: PJBS 13(7):303–315
Liu S, Nyström NN, Kelly JJ, Hamilton AM, Fu Y, Ronald JA (2022) Molecular imaging reveals a high degree of cross-seeding of spontaneous metastases in a novel mouse model of synchronous bilateral breast cancer. Mol Imaging Biology 24(1):104–114
Nakano T, Shimizu K, Kawashima O, Kamiyoshihara M, Kakegawa S, Sugano M, Ibe T, Nagashima T, Kaira K, Sunaga N (2012) Establishment of a human lung cancer cell line with high metastatic potential to multiple organs: gene expression associated with metastatic potential in human lung cancer. Oncol Rep 28(5):1727–1735
Ma C, Rong Y, Radiloff DR, Datto MB, Centeno B, Bao S, Cheng AWM, Lin F, Jiang S, Yeatman TJ (2008) Extracellular matrix protein βig-h3/TGFBI promotes metastasis of colon cancer by enhancing cell extravasation. Genes Dev 22(3):308–321
Mistry DS, Chen Y, Wang Y, Zhang K, Sen GL (2014) SNAI2 controls the undifferentiated state of human epidermal progenitor cells. Stem Cells 32(12):3209–3218
Kim M, Jang K, Miller P, Picon-Ruiz M, Yeasky T, El-Ashry D, Slingerland J (2017) VEGFA links self-renewal and metastasis by inducing Sox2 to repress miR-452, driving Slug. Oncogene 36(36):5199
Kurrey NK, Jalgaonkar SP, Joglekar AV, Ghanate AD, Chaskar PD, Doiphode RY, Bapat SA (2009) Snail and slug mediate radioresistance and chemoresistance by antagonizing p53-mediated apoptosis and acquiring a stem‐like phenotype in ovarian cancer cells. Stem Cells 27(9):2059–2068
Phillips S, Prat A, Sedic M, Proia T, Wronski A, Mazumdar S, Skibinski A, Shirley SH, Perou CM, Gill G (2014) Cell-state transitions regulated by SLUG are critical for tissue regeneration and tumor initiation. Stem cell reports 2(5):633–647
Catalano A, Rodilossi S, Rippo MR, Caprari P, Procopio A (2004) Induction of stem cell factor/c-Kit/slug signal transduction in multidrug-resistant malignant mesothelioma cells. J Biol Chem 279(45):46706–46714
Lai Y-h, Chen J, Wang X-p, Wu Y-q, Peng H-t, Lin X-h, Wang W-j (2017) Collagen triple helix repeat containing-1 negatively regulated by microRNA-30c promotes cell proliferation and metastasis and indicates poor prognosis in breast cancer. J Experimental Clin Cancer Res 36(1):92
Sakai D, Tanaka Y, Endo Y, Osumi N, Okamoto H, Wakamatsu Y (2005) Regulation of Slug transcription in embryonic ectoderm by beta-catenin-Lef/Tcf and BMP-Smad signaling. Dev Growth Differ 47(7):471–482. doi:10.1111/j.1440-169X.2005.00821.x
Kao S-H, Wang W-L, Chen C-Y, Chang Y-L, Wu Y-Y, Wang Y-T, Wang S-P, Nesvizhskii AI, Chen Y-J, Hong T-M (2014) GSK3β controls epithelial–mesenchymal transition and tumor metastasis by CHIP-mediated degradation of Slug. Oncogene 33(24):3172
Liu J, Li W, Liu S, Zheng X, Shi L, Zhang W, Yang H (2017) Knockdown of Collagen Triple Helix Repeat Containing 1 (CTHRC1) Inhibits Epithelial-Mesenchymal Transition and Cellular Migration in Glioblastoma Cells. Oncol Res 25(2):225–232. doi:10.3727/096504016x14732772150587

Download PDF

Version 1

posted

You are reading this latest preprint version

Using the esophageal cancer stem cells (CSCs) for better understanding the tumor metastasis and metastasis-associated genes

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Cell culture

Sphere formation assay

Quantitative real-time PCR

Tumorigenicity assay

Analysis of tumorigenicity by Hematoxylin-eosin (H&E) staining and Immunohistochemistry (IHC)

Metastatic tumor formation

Results

Esophageal YM-1 cells could form non-adherent tumorspheres

Sox2 and Nanog is expressed in tumorspheres

Sphere cells exhibited higher tumorigenicity in vivo

Up-regulation of SLUG and Down-regulation of E-cad in the ECSCTs

Up-regulation of SLUG protein in ECSCTs

Discussion

Abbreviations

Declarations

References

Status:

Version 1