CRNDE interference inhibits colorectal cancer cell proliferation, migration, and invasion, and promotes apoptosis

doi:10.21203/rs.3.rs-1500784/v1

Download PDF

Research Article

CRNDE interference inhibits colorectal cancer cell proliferation, migration, and invasion, and promotes apoptosis

https://doi.org/10.21203/rs.3.rs-1500784/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

The aim of this study was to investigate the effect of colorectal neoplasia differentially expressed (CRNDE) interference on the proliferation, migration, invasion, and apoptosis of colorectal cancer (CRC) cells. Lovo, HCT-116, COLO 205, HT-29, SW480, and NCM460 cells were screened by quantitative reverse transcription polymerase chain reaction after transfection with CRNDE-interference vectors or miR-320a mimics. The levels of APPL1, Bax, Bcl-2, and cleaved caspase-3 were determined by western blotting. Cell proliferation was evaluated using Cell Counting Kit-8. Apoptosis was detected using flow cytometry and cell migration and invasion were assessed using a transwell assay. The relationships between CRNDE and miR-320a levels and between APPL1 and miR-320a levels were determined by luciferase reporter assay. The expression levels of CRNDE and APPL1 were significantly higher in HCT-116 cells than in Lovo, COLO 205, HT-29, SW480, or NCM460 cells (P < 0.05). miR-320a overexpression and CRNDE interference significantly decreased cell proliferation, migration, and invasion (P < 0.05), but significantly increased apoptosis (P < 0.05). miR-320a overexpression or CRNDE interference significantly increased the number of cells in the G0-G1 phase, compared to the control treatment and empty vector transfection, while decreasing the number of cells in the G2-M phase. miR-320a overexpression and CRNDE interference significantly increased the expression levels of apoptosis-related proteins (P < 0.05). miR-320a inhibited luciferase activity in HCT-116 cells transfected with the wild-type CRNDE 3′-UTR (P < 0.05) or the APPL1 3′-UTR (P < 0.05). Thus, CRNDE interference inhibited the proliferation, migration, and invasion of CRC cells and promoted apoptosis. The mechanism was related to the CRNDE/miR-320a/APPL1 axis.

CRNDE

proliferation

migration

invasion

apoptosis

Colorectal cancer (CRC) is one of the most common types of gastrointestinal malignancy worldwide. In 2020, there were 2,200,000 new cases of CRC and 1,100,000 cases of CRC-related deaths (1). Surgical resection, radiotherapy, and chemotherapy are currently the main treatment methods for CRC (2, 3), but the curative effect of these treatments is not ideal. Therefore, the identification of new diagnostic markers and therapeutic targets is of great significance for the clinical treatment and prevention of CRC.

Intrinsic mechanisms within cancer cells and extrinsic factors influence tumor development and aggressiveness. Long non-coding RNAs (lncRNAs) are an important part of the genome. They are longer than 200 nucleotides, but have no protein-encoding capacity (4). Previous studies have shown that lncRNAs play key roles in the development and progression of a variety of tumors (5). Ma et al. found that the lncRNA, XIST, regulates the miR-497/MACC1 axis and promotes the growth and invasion of gastric cancer cells (6). In CRC, the expression levels of linc-UBC1 are significantly higher in tumor tissues than in para-cancerous tissues, and high linc-UBC1 expression levels are significantly associated with shorter overall survival in CRC patients (7). Colorectal neoplasia differentially expressed (CRNDE) is a newly discovered lncRNA (8, 9) that is highly expressed during the pathogenesis of various tumors. Recently, Wang et al. found that lncRNAs can function as competitive endogenous RNAs (ceRNAs) that regulate miRNA expression, which, in turn, regulates specific miRNA target genes (10). CRNDE, for example, can act as a ceRNA by inhibiting the expression of miR-136 in CRC (11). Bioinformatic analysis has revealed that there are binding sites between CRNDE and miR-320a (Fig. S1), and miR-320a expression levels are significantly lower in breast, colon, and bladder cancers than in normal tissues (12–14). However, the effect of CRNDE on the expression of miR-320a has not been reported.

APPL1 (adaptor protein containing PH domain, PTB domain and leucine zipper motif 1) is a 709 amino acid connexin encoded by a gene located on chromosome 3p14.3-21.1. It binds directly to adiponectin receptors and plays an important role in cell proliferation, differentiation, and apoptosis. Through bioinformatic prediction, we previously found that APPL1 is a target gene of miR-320a (Fig. S2). However, it is not known whether CRNDE affects the expression of APPL1 via miR-320a and thus, promotes the occurrence of CRC.

In this study, we investigated the mechanism of the effects of CRNDE by exploring the effect of CRNDE interference and miR-320a overexpression on the proliferation, migration, invasion, and apoptosis of CRC cells. We aimed to provide novel ideas for the clinical treatment of CRC.

Patients and serum samples

CRC and para-carcinoma tissue samples were collected from seven patients diagnosed with primary CRC at the People's Hospital of Zhengzhou (Zhengzhou, China). The clinicopathological characteristics of the patients are presented in Table 1. The levels of CRNDE, miR-320a-5p, and APPL1 mRNA were determined by quantitative reverse transcription polymerase chain reaction (qRT-PCR). APPL1 protein expression levels were determined by western blotting. All samples were collected after receiving written informed consent and all procedures were performed with the approval of the internal review and ethics boards of the People's Hospital of Zhengzhou.

Construction of CRNDE-interference vector

CRNDE-interference vectors (5′-GATGTGTTTCAATCTAGATGC-3′) were constructed using pSicoR, following standard procedures for target gene identification, design, preparation and transfection of pcDNA3.1, and transfection using Lipofectamine® RNAiMAX (11668-027; Invitrogen, Carlsbad, CA, USA). Cells were divided into three groups: control, empty vector (EV [sh-CRNDE]), and short hairpin (sh)-CRNDE (interference vector [IV]). Transfection efficiency was determined by qRT-PCR.

miR-320a mimics were purchased from Hanbio Biotechnology Co., Ltd. (Shanghai, China). Cells were divided into three groups: control, empty vector (EV [miR-320a]), and miR-320a overexpression (OV). miR-320a expression levels were evaluated by qRT-PCR.

Cell culture

The human CRC cell lines, Lovo, HCT-116, COLO 205, HT-29, and SW480, and the normal colon epithelial cell line, NCM460, were purchased from the cell bank of the Chinese Academy of Sciences (Shanghai, China). The cells were cultured in RPMI 1640 medium (Gibco, Carlsbad, CA, USA) supplemented with 10% (v/v) fetal bovine serum (FBS), 10 U/mL penicillin, and 100 mg/mL streptomycin (Gibco) at 37°C with 5% CO₂. CRNDE expression levels were determined by qRT-PCR and the protein expression levels of APPL1 were determined by western blotting.

Cell Counting Kit-8

Cells were seeded in a 96-well plate at 5 × 10³ cells/mL in RPMI 1640 medium containing 10% FBS and were treated for 24, 48, or 72 h. To evaluate cell proliferation, 10 μL of Cell Counting Kit-8 solution was added to each well and the cells were cultured at 37°C for 4 h. Optical density was measured at 450 nm using a plate reader (Multiskan FC; Thermo Fisher Scientific, Waltham, MA, USA).

Transwell assays

Cells were cultured in serum-free smooth muscle cell medium (SMCM, 1101; ScienCell, Carlsbad, CA, USA) for 24 h before the experiment and were then resuspended in SMCM containing 1% FBS at 1 × 10⁵ cells/mL. The cells were then seeded into transwell chambers and 0.75 mL of SMCM containing 10% FBS was added to the lower chambers of the 24-well plate. After culturing the cells in 5% CO₂ at 37°C for 48 h, 1 mL of 4% formaldehyde was added to each well, and the plate was incubated at room temperature for 10 min for immobilization. After 30 min of incubation with 0.5% crystal violet (PAB180004; Bioswamp, Wuhan, China), the cells were observed under a microscope.

Flow cytometry

HCT-116 cells (5 × 10⁴cells/mL) were washed twice with phosphate-buffered saline (PBS). For apoptosis experiments, cells were resuspended in 200 μL of binding buffer and incubated with 10 μL of annexin V-FITC and 10 μL of propidium iodide (PI) for 30 min at 4℃ in the dark. This was followed by incubation with 300 μL of binging buffer. For cell cycle experiments, cells were fixed with 700 μL of anhydrous ethanol for 24 h and incubated with 400 μL of PI for 10 min. Data were analyzed using CytExpert software (Beckman Coulter, Brea, CA, USA).

qRT-PCR

Cells were extracted using TRIzol reagent according to the manufacturer’s instructions and cDNA was synthesized using a reverse transcriptase kit (639505; TAKARA, Osaka, Japan). qRT-PCR was performed with a real-time PCR system (CFX-Connect 96; BIO-RAD, Hercules, CA, USA) using a SYBR Green PCR Kit (KM4101; KAPA Biosystems, Wilmington, MA, USA). Each PCR reaction was performed in duplicate using the following conditions: denaturation at 95°C for 3 min; 39 cycles of 95°C for 5 s, 56°C for 10 s, and 72°C for 25 s; 65°C for 5 s; and 95°C for 50 s. The results were analyzed using the 2^-^△△^Ct method. The PCR primers were designed by Nanjing Kingsy Biotechnology Co., Ltd. (Nanjing, China) and the sequences are listed in Table 2.

Western blotting

Protein extracts (20 μg) were prepared from lung tissue, separated by 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and transferred to polyvinylidene fluoride membranes (IPVH00010; Millipore, Burlington, MA, USA). Membranes were blocked with 5% milk in Tris-buffered saline (pH 7.6) containing 0.1% Tween 20 and incubated overnight at 4°C with specific primary antibodies against the following proteins: APPL1 (1:1,000, PAB33847, Bioswamp), Bax (1:1,000, PAB30040, Bioswamp), Bcl-2 (1:1,000, PAB30041, Bioswamp), cleaved caspase-3 (1:500, ab32042; Abcam, Cambridge, UK), and GAPDH (1:2,000, PAB36264, Bioswamp). After three washes with PBS/Tween 20, the membranes were incubated with horseradish peroxidase-conjugated secondary goat anti-rabbit IgG (1:20,000, PAB160011, Bioswamp) for 2 h at room temperature. Protein bands were visualized by enhanced chemiluminescence color detection (Tanon-5200; TANON, Shanghai, China) and analyzed using AlphaEase FC gel image analysis software (Alpha Innotech, San Leandro, CA, USA).

Luciferase reporter assay

HCT-116 cells were co-transfected with 50 nM miR-320a mimics and 200 ng of wild-type (WT) or mutant FOXO4-3′-UTR or 200 ng of WT or mutant APPL1-3′-UTR using Lipofectamine 2000 (Invitrogen) following the manufacturer’s instructions. After 48 h, the cells were processed using a Dual-Luciferase Reporter Assay System (Promega, Madison, WI, USA), and luciferase activity was measured using a GloMax20/20 Luminometer (Promega). Luciferase activity in HCT-116 cells was normalized to the Renilla/firefly luciferase signal.

Statistical analysis

Data are expressed as the mean ± standard deviation. Data between groups were compared using a Student’s t-test or one-way analysis of variance using SPSS 22 statistical software 9IBM, Armonk, NY, USA). P < 0.05 was considered statistically significant.

Expression of CRNDE, miR-320a, and APPL1 in CRC and para-carcinoma tissues

As shown in Fig. 1, CRNDE and APPL1 expression levels were significantly higher in CRC compared with para-carcinoma tissues (P < 0.05), whereas miR-320a levels were significantly lower (P < 0.05). This suggests that CRNDE and APPL1 are significantly upregulated, while miR-320a is significantly downregulated, during the pathogenesis of CRC.

Expression of CRNDE, miR-320a, and APPL in CRC cell lines

As shown in Fig. 2A, the expression levels of CRNDE were significantly higher in Lovo, HCT-116, COLO205, HT-29, and SW480 cells than in NCM460 cells (P < 0.05), with HCT-116 cells showing the highest expression levels. HCT-116 cells showed the lowest levels of miR-320a expression (P < 0.05). APPL1 protein expression levels showed a similar trend to CRNDE levels (Fig. 2B). Based on these results, we used HCT-116 cells for subsequent experiments.

miR-320a overexpression and CRNDE interference

The expression levels of miR-320a in the control, EV, and OV groups were determined to confirm the successful transfection of the miR-320a overexpression vector. The results showed that the expression levels of miR-320a were significantly higher in the OV group than in the control and EV (miR-320a) groups (P < 0.05), thus verifying that miR-320a was successfully overexpressed in HCT-116 cells (Fig. 3A). CRNDE expression levels were much lower in the IV group than that in the control and EV (sh-CRNDE) groups (P < 0.05), indicating that CRNDE expression levels were successfully reduced in HCT-116 cells (Fig. 3B).

Effect of miR-320a overexpression and CRNDE interference on cell proliferation, migration, and invasion

To investigate the effect of miR-320a overexpression and CRNDE interference on the biological properties of HCT-116 cells, we examined their proliferation, migration, and invasion (Fig. 4A). Compared to cells in the control and EV groups, those with miR-320a overexpression or CRNDE interference showed significantly decreased cell proliferation (P < 0.05) in a time-dependent manner. As shown in Fig. 4B and 4C, we observed that the number of migrating and invading cells in the OV overexpression and IV groups was significantly decreased (P < 0.05).

Effect of miR-320a overexpression and CRNDE interference on apoptosis

Compared with cells in the control and EV groups, those with miR-320a overexpression or CRNDE interference showed significantly increased apoptosis (P < 0.05, Fig. 5A). As shown in Fig. 5B, the proportion of cells in the G0-G1 phase was significantly higher in the OV or IV groups than in the control and EV groups, whereas the number of cells in the G2-M phase was significantly lower in the OV and IV groups. We further showed that the levels of the apoptosis-related proteins, Bax and cleaved caspase-3, were upregulated in the OV and IV groups compared to the control and EV groups (P < 0.05), while Bcl-2 levels were downregulated (P < 0.05, Fig. 5C).

Relationships between miR-320a and CRNDE and between miR-320a and APPL1

To study the relationship between miR-320a and CRNDE, a dual-luciferase reporter assay was performed. The luciferase reporter vectors, pmir-GLO-CRNDE 3′-UTR and mutant reporter vectors carrying point mutations in putative miR-320a binding sites were co-transfected with miR-320a mimics or a mimic negative control. The results showed that miR-320a inhibited luciferase activity in wild-type CRNDE 3′-UTR-transfected HCT-116 cells (P < 0.05, Fig. 6A). We also demonstrated specific binding between miR-320a and APPL1 (P < 0.05, Fig. 6B).

The occurrence and development of malignant tumors are related to cell proliferation, apoptosis, invasion, and metastasis. Studies have found that abnormal expression of lncRNAs can influence these biological processes and play critical roles in tumorigenesis (15). CRNDE is transcribed from chromosome 16 on the opposite strand of a region adjacent to the IRX5 gene. It is involved in a variety of normal physiological activities, such as neural differentiation and embryonic development, and its abnormal expression is closely related to malignant cell transformation (16). To study the role of CRNDE in the development of CRC, we first determined the expression levels of CRNDE in CRC and para-cancerous tissues. CRNDE was found to be highly expressed in CRC tissues, suggesting that it may be a tumor-promoting gene. To further study the role of CRNDE in the pathogenesis of CRC, we used siRNA technology to inhibit the expression of CRNDE in the CRC cell line, HCT-116. The results showed that CRNDE interference significantly inhibited the proliferation, migration, and invasion of HCT-116 cells. Moreover, CRNDE interference was associated with basal downregulation of apoptosis and G1/S arrest. We then measured the protein levels of Bcl-2, Bax, and cleaved caspase-3, which are closely related to apoptosis, and the results supported these conclusions.

miR-320a is a member of the miR-320 family, members of which bind completely or partially to the 3'-UTR region of their target mRNAs in the cytoplasm. It plays a post-transcriptional regulatory role by degrading target mRNAs or inhibiting protein translation. It can also enter the nucleus to regulate target gene expression at the transcriptional level. Zhang et al. showed that miR-320 is expressed at low levels in the highly metastatic CRC cell lines, SW620 and Lovo, and that its expression significantly decreases during the liver metastasis of colon cancer (17). Patients exhibiting high levels of miR-320a expression have a longer average survival time (18). Therefore, miR-320a is an effective marker of the recurrence, metastasis, and prognosis of CRC. The mRNA encoding the vascular endothelial growth factor (VEGF) co-receptor, neuropilin-1, is a direct target of miR-320a, and miR-320a can inhibit the migration and invasion of colon cancer cells by downregulating the expression levels of VEGF (17). Sun et al. demonstrated that miR-320a inhibits the growth of colon cancer cells by the targeted knockdown of β-catenin (19). In the colon cancer cell line, SW620, miR-320a inhibits epithelial-mesenchymal transition by upregulating the levels of the epithelial cell marker, E-cadherin, and downregulating the levels of the stromal cell marker, vimentin. In addition, Rac1, a member of the Ras superfamily, regulates numerous tumor-associated phenotypes, and miR-320a inhibits tumor cell proliferation, by targeting Rac1, to induce G0/G1 arrest in colon cancer cells (20). In the present study, miR-320a overexpression inhibited the proliferation, migration, and invasion of HCT-116 cells; promoted apoptosis; and caused G0/G1 arrest.

APPL1 contains three multifunctional domains: the amino-terminal BAR domain, the PH domain, and the carboxy-terminal PTB domain (21). APPL1 interacts with various receptors and intracellular signaling proteins through its PTB domain in combination with phosphorylated tyrosine-binding or non- phosphorylation-dependent tyrosine-binding pathways. It plays important roles in tumor cell survival, proliferation, differentiation, and apoptosis. APPL1 levels are significantly upregulated in CRC, promoting the occurrence of CRC and affecting patient survival (22). Through bioinformatics prediction, we identified a targeted binding relationship between miR-320a and APPL1. We examined this binding relationship and showed that miR-320a specifically bound to WT APPL1, suggesting that miR-320a overexpression can inhibit APPL1 and suppress the proliferation, migration, and invasion of tumor cells. We further investigated the relationship between CRNDE and miR-320a using a dual luciferase assay and showed that WT CRNDE was specifically bound to miR-320a, suggesting that CRNDE exerts its effects by inhibiting the expression of miR-320a. Thus, the inhibition of CRNDE activity can increase miR-320a expression levels, thereby inhibiting CRC cell proliferation, migration, and invasion and promoting apoptosis.

In conclusion, CRNDE interference inhibited CRC cell proliferation, migration, and invasion and promoted apoptosis. The mechanism may be that CRNDE interference promoted the expression of miR-320a, thereby inhibiting the activity of APPL1.

Ethical Approval and Consent to participate

The experimental protocol does not involve animal or human testing.

Consent for publication

Not applicable.

Availability of supporting data

Data used to support the findings of this study are available from the corresponding author upon request.

Competing interests

The authors declare that they have no competing interests.

Funding

Not applicable.

Authors' contributions

LW were responsible for project design.XW, QXW, KYC, and LW preformed experiment and data analysis. XW drafted the manuscript. LW revised the manuscript.

Acknowledgements

Not applicable.

Siegel RL, Miller KD, Goding SA, et al. Colorectal Cancer Statistics, 2020. CA Cancer J Clin, 2020, 70: 145–164.
Peng SL, Thomas M, Ruszkiewicz A, et al. Conventional adverse features do not predict response to adjuvant chemotherapy in stage II colon cancer. Anz J Surg, 2014, 84(11): 837–841.
Prados J, Melguizo C, Ortiz R, et al. Colon cancer therapy: recent developments in nanomedicine to improve the efficacy of conventional chemotherapeutic drugs. Anticancer Agents Med Chem, 2013, 13(8):1204–1216.
Young RS, Ponting CP. Identification and function of long non-coding RNAs. Essays Biochem, 2013, 54(54):113–126.
Batista PJ, Chang HY. Long noncoding RNAs: cellular address codes in development and disease. Cell, 2013, 152(6):1298–307.
Ma L, Zhou Y, Luo X, et al. Long non-coding RNA XIST promotes cell growth and invasion through regulating miR-497/MACC1 axis in gastric cancer. Oncotarget, 2017, 8(3): 4125.
Gao X, Wen J, Gao P, et al. Overexpression of the long non-coding RNA, linc-UBC1, is associated with poor prognosis and facilitates cell proliferation, migration, and invasion in colorectal cancer. Onco Targets Ther, 2017,10:1017–1026.
Graham LD, Pedersen SK, Brown GS, et al. Colorectal neoplasia differentially expressed (CRNDE), a novel gene with elevated expression in colorectal adenomas and adenocarcinomas. Genes Cancer, 2011, 2:829–840.
Ellis BC, Molloy PL, Graham LD. CRNDE: a long non-coding RNA involved in cancer, neurobiology, and development. Front Genet, 2012, 3:270.
Wang W, Zhuang Q, Ji K, et al. Identification of miRNA, lncRNA and mRNA-associated ceRNA networks and potential biomarker for MELAS with mitochondrial DNA A3243G mutation. Sci Rep, 2017, 7:41639.
Gao H, Song X, Kang T, et al. Long noncoding RNA CRNDE functions as a competing endogenous RNA to promote metastasis and oxaliplatin resistance by sponging miR-136 in colorectal cancer. Onco Targets Ther. 2017;10:205–216.
Wang B, Yang Z, Wang H, et al. MicroRNA-320a inhibits proliferation and invasion of breast cancer cells by targeting RAB11A. Am J Cancer Res, 2015, 5(9):2719.
Sun JY, Huang Y, Li JP, et al. MicroRNA-320a suppresses human colon cancer cell proliferation by directly targeting β-catenin. Biochem Biophys Res Commun, 2012, 420(4):787–792.
Shang C, Zhang H, Guo Y, et al. MiR-320a down-regulation mediates bladder carcinoma invasion by targeting ITGB3. Mol Biol Rep, 2014, 41(4):2521.
Shi D, Zhang Y, Lu R, et al. The long non-coding RNA MALAT1 interacted with miï¼²-218 modulates choriocarcinoma growth by targeting Fbxw8. Biomed Pharmacother, 2017, 97(1):543–550.
Liu T, Zhang X, Gao S, et al. Exosomal long noncoding RNA CRNDE-h as a novel serum-based biomarker for diagnosis and prognosis of colorectal cancer. Oncotarget, 2016, 7 (51): 85551–85563.
Zhang Y, He X, Liu Y, et al. micro RNA-320a inhibits tumor invasion by targeting neuropilin 1 and is associated with liver metastasis in colorectal cancer. Oncol Rep, 2012, 27(3): 685–694.
Schepeler T, Reinert JT, Ostenfeld MS, et al. Diagnostic and prognostic micro RNAs in stage II colon cancer. Cancer Res, 2008, 68(15): 6416–6424.
Sun JY, Huang Y, Li JP, et al. MicroRNA-320a suppresses human colon cancer cell proliferation by directly targeting β-catenin. Biochem Bioph Res Co, 2012, 420(4): 787–792.
Zhao H, Dong T, Zhou H, et al. miR-320a suppresses colorectal cancer progression by targeting Rac1. Carcinogenesis, 2014, 35(4): 886–895.
Mitsuuchi Y, Johnson SW, Sonoda G, et al. Identification of a chromosome 3p14.3-21.1 gene, APPL, encoding an adaptor molecule that interacts with the oncoprotein-serine/threonine kinase AKT2. Oncogene, 1999, 18(35):4891.
Zhang Y, Song M, Chen XF, et al. Relationship between APPL1 expression and the development of colorectal cancer. World Chin J Dig, 2012(3): 253–258.

Table 1 Clinicopathological characteristics of 7 CRC patients

Characteristics	No. of patients
Age
<55	3
≥55	4
Gender
Male	5
Female	2
Histology/differentiation
Poor	1
Poor-Moderate	4
Moderate-well	2
TNM stage
Ⅰ, Ⅱ	3
Ⅲ, Ⅳ	4

Table 2 Primer sequences

Primer	Sequence (5’-3’)
CRNDE-F	ATTCATCCCAAGGCTG
CRNDE-R	CAAAGACCAACGGCTG
miR-320a-5P-RT	CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGGAAGAAC
miR-320a-5P-F	GGGGCCTTCTCTTCCCG
miR-320a-5P-R	AACTGGTGTCGTGGAGTCGGC
GAPDH-F	CCACTCCTCCACCTTTG
GAPDH-R	CACCACCCTGTTGCTGT
U6-F	CTCGCTTCGGCAGCACA
U6-R	CTCGCTTCGGCAGCACA

No competing interests reported.

floatimage7.png
Fig. S1 Bioinformatics analysis of CRNDE and miR-320a.
floatimage8.png
Fig. S2 Bioinformatics analysis of APPL1 and miR-320a.

Download PDF

Version 1

posted

You are reading this latest preprint version

CRNDE interference inhibits colorectal cancer cell proliferation, migration, and invasion, and promotes apoptosis

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

Conclusions

Declarations

References

Tables

Additional Declarations

Supplementary Files

Status:

Version 1