The sialidase NEU3 promotes pulmonary fibrosis in mice

doi:10.21203/rs.3.rs-1506689/v1

Download PDF

Research Article

The sialidase NEU3 promotes pulmonary fibrosis in mice

https://doi.org/10.21203/rs.3.rs-1506689/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background

Sialic acid is often the distal sugar on glycoconjugates, and sialidases are enzymes that remove this sugar. In fibrotic lesions in human and mouse lungs, there is extensive desialylation of glycoconjugates, and upregulation of sialidases including the extracellular sialidase NEU3. In the bleomycin model of pulmonary fibrosis, mice lacking NEU3 (Neu3^-/-) showed strongly attenuated bleomycin-induced weight loss, lung damage, inflammation, and fibrosis. This indicates that NEU3 is necessary for the full spectrum of bleomycin-induced pulmonary fibrosis.

Methods

To determine if NEU3 is sufficient to induce pulmonary fibrosis, recombinant murine NEU3 and a mutated inactive recombinant murine NEU3 protein were produced. Mice were given recombinant NEU3 proteins by oropharyngeal aspiration, either alone or 10 days after bleomycin challenge. Over the course of 21 days, mice were assessed for weight change, and after euthanasia, bronchoalveolar lavage fluid cells and lung tissue were assessed for inflammation and fibrosis.

Results

Aspiration of recombinant murine NEU3 caused inflammation and fibrosis in the lungs, while inactive NEU3 caused inflammation but not fibrosis. Mice were also treated with recombinant murine NEU3 starting 10 days after bleomycin. In male but not female mice, recombinant murine NEU3 increased inflammation and fibrosis. Inactive NEU3 did not enhance bleomycin-induced lung fibrosis.

Conclusion

These results suggest that NEU3 is sufficient to induce fibrosis in the lungs, that aspiration of NEU3 has a greater effect on male mice, and that this effect is mediated by NEU3’s enzymic activity.

Sialidase

NEU3

glycosylation

inflammation

fibrosis

lung

macrophage

bleomycin

Fibrosing diseases, such as idiopathic pulmonary fibrosis (IPF), cardiac fibrosis, liver cirrhosis, and end-stage kidney disease, involve the progressive formation of scar tissue in internal organs that replaces the normal tissue, and are an increasing burden for healthcare systems [1-4]. IPF is a chronic and fatal disease that affects ~3 million people worldwide, with an incidence of 1 in 200 > 65 years, and is characterized by fibrosis of the lungs and if untreated has a median survival of 3–5 years after initial diagnosis [5-7]. The only FDA-approved therapeutics, Nintedanib and Pirfenidone, slow but do not reverse the progression of the disease [6, 8].

Many secreted and cell-surface mammalian proteins are glycosylated, and many of the glycosylated structures have sialic acids as the monosaccharide at the end of the polysaccharide chain [9-11]. Sialidases, which are also called neuraminidases, remove the terminal sialic acid from these glycoconjugates [12, 13]. There are four known mammalian sialidases, NEU1, NEU2, NEU3, and NEU4, and each sialidase has different subcellular localizations and substrate specificities [12-14]. Of the four sialidases, only NEU3 is primarily extracellular [14-17]. This enzyme uses two tyrosines in the active site to remove sialic acid from glycoconjugates [13, 18].

The lungs from both preclinical models of lung fibrosis and patients with IPF have increased levels of sialidase activity in the bronchoalveolar lavage fluid (BALF), increased levels of NEU3 in the BAL, and increased levels of both NEU1 and NEU3 in the lung tissue [19-23]. Mice treated with NEU1 and NEU3 inhibitors, and Neu3^-/-knockout mice, show strongly attenuated inflammation and fibrosis after bleomycin challenge [22-26], suggesting that NEU3 is necessary for the full extent of bleomycin-induced inflammation and fibrosis.

In this report, we assessed whether NEU3 might be sufficient to induce fibrosis. We previously found that mice have low levels of NEU3 (~1.7 ng) in their BALF, while mice treated with bleomycin have ~15 ng of NEU3 in their BALF at day 21 [23]. We find that aspiration of 15 ng of murine NEU3 every other day for 20 days caused inflammation and fibrosis in the lungs at day 21, and that the fibrosis was not observed using a mutated and thus inactive NEU3 lacking the two key tyrosines in the active site. We also find that NEU3 potentiates bleomycin-induced inflammation and pulmonary fibrosis. These results suggest that NEU3 is sufficient to induce fibrosis.

Recombinant murine NEU3 expression

Chinese hamster ovary (CHO-K1) cells were cultured in CDM4CHO medium with L-glutamine (Cat# SH30557.02, Hyclone/Cytiva, Marlborough, MA). Cells (1 × 10⁵) were mixed with 2 μg of 100 μg/ml of murine NEU3 expression plasmid (MR223297; Origene, Rockville, MD) in 100 μl PBS (GE Lifesciences, Marlborough, MA) and were transfected by electroporation using a 4D-Nucleofector System (Lonza, Walkersville, MD) following the manufacturer’s protocol. Before use, the plasmid was sequenced for verification as previously described[25, 27-29]. The transfected cells were kept at room temperature for 15 minutes for recovery, after which the CHO-K1 cells were cultured in 25 ml CDM4CHO mediumin a humidified incubator at 37°C with 5% CO₂. After 24 hours, 400 μg/ml of G418 (345812; Calbiochem EMD, San Diego, CA) was added to select for transfected cells. After 10 days, the cells were collected and lysed, and c-Myc–tagged recombinant murine NEU3 was purified using a Myc-Trap agarose kit (ytak-20; Chromotek, Hauppauge, NY) following the manufacturer’s protocol. Recombinant protein was checked for protein concentration by OD 260/280/320 using a Take3 micro-volume plate with a SynergyMX plate reader (BioTek, Winooski, VT, USA). NEU3 is 51 kDa, and was further purified by centrifugation at 10,000 xg for 5 minutes at 4^oC through an Amicon Ultra 0.5 ml 100 kDa cutoff spin filter (Millipore, Billerica, MA, USA). The NEU3 was analyzed for size and purity by PAGE on, and Coomassie staining of, 4–20% Tris/glycine gels (Bio-Rad, Hercules, CA, USA), as described previously [25, 27-29]. The NEU3 was stored in 50 μl of 10% glycerol, 100 mM glycine, and 25 mM Tris-HCl, pH 7.3, at 4°C.

Recombinant murine inactive NEU3 variant generation

Starting with the murine NEU3 expression plasmid MR223297, a variant mutated to change the tyrosines at positions 179 and 181 to phenylalanines was generated using a QuikChange II Site-Directed Mutagenesis Kit (#200523; Agilent, Santa Clara, CA) and the primer 5’ CATCCCCGCCTTCGCCTTCTATGTCTCACGTTGG 3′, with the underscored sequences representing the point mutation sites. Other workers found that these two mutations eliminate NEU3 sialidase activity [18]. The resulting plasmid was sequenced to confirm the point mutations and absence of other mutations.

Cell Isolation and Culture

Human peripheral blood was collected from healthy volunteers who gave written consent with specific approval from the Texas A&M University human subjects review board (IRB2009-0671D). All methods were performed in accordance with the relevant guidelines and regulations. Blood collection, isolation of peripheral blood mononuclear cells (PBMC), and cell culture were done as described previously [22, 23, 25, 30]. Murine spleen cells were isolated by forcing diced spleen fragments through a 100 μm cell strainer (BD Biosciences, San Jose, CA) using the plunger of a 1 ml syringe (BD Medical, Franklin Lakes, NJ) , as described previously [31]. To determine the activity of native and mutatedNEU3 we assayed the ability of NEU3 to induce extracellular accumulation of IL-6 from human PBMC and murine spleen cells [23, 25], using human (BioLegend) and murine (PeproTech, Cranbury, NJ) IL-6 ELISA kits following the manufacturers’ protocols.

Mouse models of pulmonary inflammation and fibrosis.

This study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was approved by Texas A&M University Animal Use and Care Committee (IACUC 2020-0272). All procedures were performed under 4% isoflurane in oxygen anesthesia, and all efforts were made to minimize suffering. Animals were housed with a 12-hour/12-hour light-dark cycle with free access to food and water, and all procedures were performed between 09:00 and noon. To induce inflammation and fibrosis, 7-8 week old 20-25 g male and female C57BL/6 mice (Jackson Laboratories, Bar Harbor, ME) were given an oropharyngeal aspiration of 3 U/kg (equivalent to 0.06 U/20g mouse) bleomycin (2246-10; BioVision Incorporated, Milpitas, CA) in 50 µl of 0.9% saline or oropharyngeal saline alone, as a control, as previously described [22, 23, 25, 32]. Starting 10 days after saline or bleomycin had been administered, some of the mice received an oropharyngeal aspiration of 15 ng of recombinant (rec) murine NEU3 or mutated NEU3 in 50 µl of 0.9% saline, or saline, every 48 hours. An additional cohort of mice received only 15 ng of recombinant murine NEU3, mutatedNEU3, or saline, every 48 hours over the course of 21 days. Independent sets of animal experiments were performed three times over the course of 6 months. Three male and three female mice that did not receive saline, bleomycin, or NEU3 were defined as naïve mice. All the mice were monitored twice daily to observe any sign of distress. At the indicated time points, mice were euthanized by CO₂ inhalation, and bronchoalveolar lavage fluid (BALF) and lung tissue was obtained and analyzed as described previously [22, 23, 25, 32, 33].

Staining of bronchoalveolar lavage fluid (BALF) cells

BALF cells were counted and processed to prepare cell spots as described previously [22, 23, 25, 32]. After air drying for 48 hours at room temperature, some of the cell spots were fixed and immunochemistry was performed as described previously [22, 23, 25, 32] using anti-CD3 (NB600-1441, rabbit clone SP7, Novus Biologicals, Centennial, CO) to detect T-cells, anti-CD11b (101202, clone M1/70, BioLegend, San Diego, CA) to detect blood and inflammatory macrophages, anti-CD11c (M100-3, clone 223H7, MBL International, Woburn, MA) to detect alveolar macrophages and dendritic cells, anti-CD45 (147702, clone I3/2.3, BioLegend) for total leukocytes, anti-Ly6g (127602, clone 1A8, BioLegend) to detect neutrophils, with isotype-matched irrelevant rat (BioLegend) and rabbit (Novus Biologicals) antibodies as controls. Using a 40x objective, at least 150 cells from each stained BALF spot were examined and the percent positive cells was recorded.

Lung histology

After collecting BALF, the lungs from the mice were harvested and inflated with Surgipath frozen section compound (#3801480, Leica, Buffalo Grove, IL), frozen on dry ice, and stored at -80°C. 10 μm cryosections of lungs were placed on Superfrost Plus glass slides (VWR) and were air dried for 48 hours. Immunohistochemistry was done as previously described [22, 23, 25, 32] using anti-CD3, anti-CD11b, anti-CD11c, anti-CD45, anti-Ly6g, or anti-Mac2 (clone M3/38; BioLegend) antibodies with isotype-matched irrelevant rat and rabbit as controls. Positively stained cells were counted from randomly selected fields, and presented as the number of positive cells per mm^2, as described previously [22, 23, 25, 32]. Lung sections were also stained with Sirius red to detect collagen and analyzed as previously described [23, 25, 34, 35]. Other investigators and ourselves have shown that histological analysis of fibrosis and collagen content by sirius red staining, correlates well with collagen content as measured by antibody staining and hyproxyproline and sirius red (Sircol) assays [23, 25, 34-38].

Statistical Analysis

Statistical analysis was performed using Prism Version 7.05 (GraphPad Software, La Jolla, CA). Statistical significance between two groups was determined by t test, or between multiple groups using analysis of variance (ANOVA) with Sidak’s post-test, and significance was defined as p<0.05.

Recombinant murine NEU3, but not mutated NEU3, has NEU3 activity

We previously observed that the BALF from fibrotic lungs, and fibrotic lesions from human and mouse lungs, have elevated levels of NEU3, that NEU3 inhibitors attenuate bleomycin-induced pulmonary fibrosis, and that Neu3^-/- knockout mice are resistant to bleomycin-induced inflammation and fibrosis [22, 23, 25]. To further elucidate the contribution of NEU3 to fibrosis, we generated recombinant murine NEU3 and a mutated recombinant murine NEU3 protein with two point mutations in the active site. NEU3 and mutated NEU3 were 51 kDa as assessed by PAGE and Coomassie staining (Fig. 1A). Recombinant human NEU3 induces the accumulation of IL-6 from human peripheral blood mononuclear cells (PBMC), and this is blocked by NEU3 inhibitors [22, 23, 25], indicating that the effect on IL-6 is dependent on NEU3 activity. The recombinant murine NEU3, but not the mutated NEU3, upregulated extracellular accumulation of IL-6 in both human and murine cells (Fig. 1B and C), indicating that the recombinant murine NEU3 has NEU3 activity and that the mutated NEU3 does not and is thus inactive.

Aspiration of NEU3 or inactive NEU3 induces inflammation

To determine if elevated levels of NEU3 protein in the lung, without any other exogenous insult, could induce inflammation and/or fibrosis, mice received 15 ng of either recombinant (rec) murine NEU3 or rec murine inactive NEU3 every 48 hours by oropharyngeal aspiration. This dose of NEU3 corresponds to the total amount of native mouse NEU3 in the BALF of mice at day 21 after bleomycin [23]. There was no discernable effect of rec NEU3 on the appearance or behavior of the mice, aspiration did not significantly affect body weight, or white fat, liver, kidney, spleen, heart, or brown fat weights as a percent of total body weight (AdditionalFig. S1A-C). Compared to naive controls, rec NEU3 aspiration increased BAL cell counts and BAL CD11b, CD11c and CD45 cell counts in male and female mice (Fig. 2). Compared to rec NEU3-treated mice, rec inactive NEU3-treated mice had lower BAL cell counts (Fig. 2A), and this trend was observed in both male and female mice (AdditionalFig. S2A). Compared to NEU3 aspiration, aspiration of inactive NEU3 caused a smaller increase in CD45 cells in the BAL (Fig. 2B), which was also due to the effect on female but not male mice (Additional Fig. S2B and S2C). There were no significant differences in BAL protein levels between naïve mice (1.2 ± 0.2 mg/ml: mean ± SEM, n = 6), NEU3 (1.8 ± 0.4 mg/ml; mean ± SEM, n = 6) and inactive NEU3 (1.4 ± 0.9 mg/ml; mean ± SEM, n = 6) treated mice.

After removing BAL, lung sections were stained to detect immune cells that were not removed by lavage. Compared to naive mice, NEU3 increased the number of CD11b, CD11c, CD45, Mac2, and Ly6g positive cells in the lung tissue (Fig. 3). In male mice, compared to naive mice, NEU3 increased the number of CD3, CD11b, CD45, and Mac2 positive cells in the lungs (AdditionalFig. S3A-F). In female mice, NEU3 decreased CD3 positive cells and increased Mac2 and Ly6g positive cells (AdditionalFig. S3E and S3F). Compared to NEU3 aspiration, aspiration of inactive NEU3 did not significantly affect counts of cells expressing any of the 6 markers (Fig. 3 and Additional Fig S3). Together, the data indicate that aspiration of either form of NEU3 induces inflammation in the lungs of mice.

Aspiration of NEU3 but not inactive NEU3 induces fibrosis

Lung sections were also stained with picrosirius red to detect total collagen (Fig. 4A-F). In male and female mice, aspiration of NEU3 but not inactive NEU3 caused an increase in picrosirius red staining (Fig. 4G). These data suggest that NEU3 induces fibrosis, and that the effect is dependent on NEU3 activity.

Following bleomycin, aspiration of NEU3 but not inactive NEU3 increases inflammation in male mice

Bleomycin aspiration is a standard way to increase inflammation and fibrosis in the lungs of mice [39, 40], and we found that this also increases levels of NEU3 in the lungs [22, 23, 25]. To determine if further increasing levels of NEU3 in the lungs would alter inflammation and fibrosis after aspiration of bleomycin, male and female mice were treated with saline or bleomycin at day 0, and then from days 10 to 20 received 15 ng of either NEU3, inactive NEU3, or saline control every 2 days by oropharyngeal aspiration. As observed previously [41, 42], male mice that received bleomycin have a drop in body weight between days 3 and 10, but there was no significant weight loss in the female mice (Fig. 5A and B). Aspiration of NEU3 or inactive NEU3 did not significantly alter the weights of the mice (Fig. 5A and B). As previously observed, compared to saline controls, bleomycin instillation led to an increase in the number of cells recovered from the BALF in both male and female mice at day 21 (Fig. 5C and 5D). In the lungs of male mice that received bleomycin, NEU3 aspiration had significantly higher BAL cell counts compared to saline or inactive NEU3 treated mice (Fig. 5C). In female mice that received either saline or bleomycin, NEU3 aspiration did not significantly alter BAL cell counts (Fig. 5D). In bleomycin-treated male but not female mice, aspiration of NEU3 but not inactive NEU3 increased the number of CD11c and CD45 positive cells in the BAL at day 21 (Fig. 6A).

In the lung tissue of bleomycin-treated mice after BAL, NEU3 aspiration, but not aspiration of inactive NEU3, increased the numbers of CD11c and CD45 positive cells (Fig. 7), which was due to the effect on male but not female mice (AdditionalFig. S4A and S4B). Together, the results suggest that in male but not female mice, increasing levels of NEU3 starting at day 10 after bleomycin causes a further increase in inflammation.

Aspiration of NEU3 but not inactive NEU3 for 10 days increases fibrosis

Lung sections were also stained with picrosirius red to detect total collagen (Fig. 8A-8L). In saline treated male and female mice, aspiration of NEU3, but not inactive NEU3, from day 10-20 increased picrosirius red staining (Fig. 8M and Additional Fig S5A and S5B). In bleomycin treated mice, NEU3 aspiration increased picrosirius red staining (Fig. 8M), which was due to the effect on male but not female mice (Additional Fig. S5A). In mice treated with bleomycin, compared to aspiration of NEU3, aspiration of inactive NEU3 reduced picrosirius red staining (Fig. 8M and Additional Fig. S5A and S5B). These data suggest that increasing NEU3 can increase fibrosis, and that this effect requires NEU3 activity.

In this report, we observed that the murine sialidase NEU3, but not enzyme inactive murine NEU3, can induce IL-6 production from human and murine cells as observed previously for human NEU3 [23, 43]. We also observed that NEU3 treatment increased the number of immune cells in the BAL and lung tissue both alone and after instillation of bleomycin, compared to naïve and saline treated mice respectively. Inactive NEU3 did increase the number of cells in the BAL compared to naïve mice, but the response was less than that of enzyme active NEU3. We also observed that in male mice, NEU3 augmented the number of cells in the BAL following bleomycin, and that inactive NEU3 did not augment the inflammatory response compared to active NEU3. NEU3 treatment also upregulated the fibrotic response in both male and female mice when given alone, but only NEU3, and not inactive NEU3, augmented the fibrotic response after bleomycin challenge.

Elevated NEU3 levels are found during inflammation and fibrosis in many organ systems, Neu3^-/-knockout mice show an attenuated inflammatory and fibrotic response, and NEU3 inhibitors reduce these responses in wild type mice [19-26, 44-47]. We observed that the instillation of exogenous active NEU3, but not the inactive NEU3, augmented bleomycin-induced lung inflammation in male mice, and fibrosis in male and female mice. This suggests that the observed effects of NEU3 on inflammation and fibrosis are due to the enzymatic activity of NEU3 rather than the presence of the NEU3 protein itself. Other investigators, and this report, observed that compared to male mice, female mice have a reduced fibrotic response to bleomycin ([41, 42] and Fig. 8). We observed in this report that female mice have a reduced fibrotic response to aspirated NEU3 following bleomycin. This suggests that compared to male mice, female mice may have a reduced sensitivity to NEU3. Despite these sex differences, our results indicate that NEU3 potentiates pulmonary fibrosis.

We demonstrated for the first time that physiologically relevant levels of exogenous NEU3 when inhaled into the lung of can induce fibrosis in the absence of any other insult. We also observed that compared to male mice, female mice may have a reduced sensitivity to NEU3. Our findings suggest that elevated levels of NEU3 in the lung are sufficient to induce lung inflammation and fibrosis.

ANOVA: analysis of variance

BAL: Bronchoalveolar lavage

BALF: Bronchoalveolar lavage fluid

CHO-K1: Chinese hamster ovary K1 cells

IPF: Idiopathic pulmonary fibrosis

PBMC: peripheral blood mononuclear cells

Rec: recombinant

Ethics approval and consent to participate

Human peripheral blood was collected from healthy volunteers who gave written consent with specific approval from the Texas A&M University human subjects review board (IRB2009-0671D). Animal experiments were carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was approved by Texas A&M University Animal Use and Care Committee (IACUC 2020-0272).

Consent for publication

Not applicable.

Availability of data and materials

The data that support the findings of this study are available from the corresponding authors upon reasonable request.

Competing interests

RHG is a scientific founder of Prosia Therapies an early stage company developing NEU3 inhibitors as therapeutics for pulmonary fibrosis. Texas A&M University has published patent applications on the use of sialidase inhibitors (United States Patent Application 20190201485) to regulate fibrosis. DP and RHG are inventors on pending patent applications for the use of sialidase inhibitors as anti-inflammatory and/or anti-obesity compounds.

Funding

This work was supported by National Institutes of Health National Heart, Lung, and Blood Institute [Grant R01 HL132919]. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Authors' contributions

DP, TRK, and RHG conceived and designed research; DP, KS, TRK, and WC performed experiments; DP, KS, WC and RHG analyzed data; DP and WC prepared figures; DP and RHG drafted manuscript; DP, WC, and RHG edited and revised the manuscript; all authors read and approved the final manuscript.

Acknowledgements

We thank the LARR (Laboratory Animal Resources and Research) staff at Texas A&M University for animal care.

Barnes PJ, Anderson GP, Fagerås M, Belvisi MG: Chronic lung diseases: prospects for regeneration and repair. European Respiratory Review2021, 30:200213.
Raimundo K, Chang E, Broder MS, Alexander K, Zazzali J, Swigris JJ: Clinical and economic burden of idiopathic pulmonary fibrosis: a retrospective cohort study. BMC Pulm Med2016, 16:2.
Sgalla G, Kulkarni T, Antin-Ozerkis D, Thannickal VJ, Richeldi L: Update in Pulmonary Fibrosis 2018. American Journal of Respiratory and Critical Care Medicine2019, 200:292-300.
Schattenberg JM, Lazarus JV, Newsome PN, Serfaty L, Aghemo A, Augustin S, Tsochatzis E, de Ledinghen V, Bugianesi E, Romero-Gomez M, et al: Disease burden and economic impact of diagnosed non-alcoholic steatohepatitis (nash) in five european countries in 2018: A cost-of-illness analysis. Liver Int2021.
Raghu G, Rochwerg B, Zhang Y, Garcia CA, Azuma A, Behr J, Brozek JL, Collard HR, Cunningham W, Homma S, et al: An Official ATS/ERS/JRS/ALAT Clinical Practice Guideline: Treatment of Idiopathic Pulmonary Fibrosis. An Update of the 2011 Clinical Practice Guideline. Am J Respir Crit Care Med2015, 192:e3-19.
Lederer DJ, Martinez FJ: Idiopathic Pulmonary Fibrosis. New England Journal of Medicine2018, 378:1811-1823.
Cottin V, Spagnolo P, Bonniaud P, Nolin M, Dalon F, Kirchgässler K-U, Kamath TV, Van Ganse E, Belhassen M: Mortality and Respiratory-Related Hospitalizations in Idiopathic Pulmonary Fibrosis Not Treated With Antifibrotics. Frontiers in Medicine2021, 8.
Raghu G, Selman M: Nintedanib and Pirfenidone. New Antifibrotic Treatments Indicated for Idiopathic Pulmonary Fibrosis Offer Hopes and Raises Questions. American Journal of Respiratory and Critical Care Medicine2015, 191:252-254.
Schwab I, Nimmerjahn F: Intravenous immunoglobulin therapy: how does IgG modulate the immune system? Nat Rev Immunol2013, 13:176-189.
Freire-de-Lima L, Oliveira IA, Neves JL, Penha LL, Alisson-Silva F, Dias WB, Todeschini AR: Sialic acid: a sweet swing between mammalian host and Trypanosoma cruzi. Front Immunol2012, 3:356.
Varki A, Gagneux P: Multifarious roles of sialic acids in immunity. Ann N Y Acad Sci2012, 1253:16-36.
Monti E, Miyagi T: Structure and Function of Mammalian Sialidases. Top Curr Chem2015, 366:183-208.
Smutova V, Albohy A, Pan X, Korchagina E, Miyagi T, Bovin N, Cairo CW, Pshezhetsky AV: Structural Basis for Substrate Specificity of Mammalian Neuraminidases. PLoS ONE2014, 9:e106320.
Miyagi T, Yamaguchi K: Mammalian sialidases: Physiological and pathological roles in cellular functions. Glycobiology2012, 22:880-896.
Zanchetti G, Colombi P, Manzoni M, Anastasia L, Caimi L, Borsani G, Venerando B, Tettamanti G, Preti A, Monti E, Bresciani R: Sialidase NEU3 is a peripheral membrane protein localized on the cell surface and in endosomal structures. Biochemical Journal2007, 408:211-219.
Cirillo F, Ghiroldi A, Fania C, Piccoli M, Torretta E, Tettamanti G, Gelfi C, Anastasia L: NEU3 Sialidase Protein Interactors in the Plasma Membrane and in the Endosomes. J Biol Chem2016, 291:10615-10624.
Rodriguez-Walker M, Daniotti JL: Human Sialidase Neu3 is S-Acylated and Behaves Like an Integral Membrane Protein. Sci Rep2017, 7:4167.
Albohy A, Li MD, Zheng RB, Zou C, Cairo CW: Insight into substrate recognition and catalysis by the human neuraminidase 3 (NEU3) through molecular modeling and site-directed mutagenesis. Glycobiology2010, 20:1127-1138.
Lambré CR, Pilatte Y, Le Maho S, Greffard A, De Crémoux H, Bignon J: Sialidase activity and antibodies to sialidase-treated autologous erythrocytes in bronchoalveolar lavages from patients with idiopathic pulmonary fibrosis or sarcoidosis. Clin Exp Immunol1988, 73:230-235.
Lillehoj EP, Hyun SW, Feng C, Zhang L, Liu A, Guang W, Nguyen C, Sun W, Luzina IG, Webb TJ, et al: Human airway epithelia express catalytically active NEU3 sialidase. Am J Physiol Lung Cell Mol Physiol2014, 306:L876-886.
Luzina IG, Lockatell V, Hyun SW, Kopach P, Kang PH, Noor Z, Liu A, Lillehoj EP, Lee C, Miranda-Ribera A, et al: Elevated expression of NEU1 sialidase in idiopathic pulmonary fibrosis provokes pulmonary collagen deposition, lymphocytosis, and fibrosis. Am J Physiol Lung Cell Mol Physiol2016, 310:L940-954.
Karhadkar TR, Pilling D, Cox N, Gomer RH: Sialidase inhibitors attenuate pulmonary fibrosis in a mouse model. Scientific Reports2017, 7:15069.
Karhadkar TR, Chen W, Gomer RH: Attenuated pulmonary fibrosis in sialidase-3 knockout (Neu3(-/-)) mice. Am J Physiol Lung Cell Mol Physiol2020, 318:L165-l179.
Hyun SW, Liu A, Liu Z, Cross AS, Verceles AC, Magesh S, Kommagalla Y, Kona C, Ando H, Luzina IG, et al: The NEU1-selective sialidase inhibitor, C9-butyl-amide-DANA, blocks sialidase activity and NEU1-mediated bioactivities in human lung in vitro and murine lung in vivo. Glycobiology2016, 26:834-849.
Karhadkar TR, Meek TD, Gomer RH: Inhibiting sialidase-induced TGF-β1 activation attenuates pulmonary fibrosis in mice. J Pharmacol Exp Ther2020.
Luzina IG, Lillehoj EP, Lockatell V, Hyun SW, Lugkey KN, Imamura A, Ishida H, Cairo CW, Atamas SP, Goldblum SE: Therapeutic Effect of Neuraminidase-1–Selective Inhibition in Mouse Models of Bleomycin-Induced Pulmonary Inflammation and Fibrosis. Journal of Pharmacology and Experimental Therapeutics2021, 376:136.
Crawford JR, Pilling D, Gomer RH: FcγRI mediates serum amyloid P inhibition of fibrocyte differentiation. Journal of Leukocyte Biology2012, 92:699-711.
Cox N, Pilling D, Gomer RH: Distinct Fcγ Receptors Mediate the Effect of Serum Amyloid P on Neutrophil Adhesion and Fibrocyte Differentiation. The Journal of Immunology2014, 193:1701-1708.
Cox N, Pilling, D., Gomer, R. H.: DC-SIGN activation mediates the differential effects of SAP and CRP on the innate immune system and inhibits fibrosis in miceProceedings of the National Academy of Sciences2015, 112:8385-8390.
Pilling D, Fan T, Huang D, Kaul B, Gomer RH: Identification of markers that distinguish monocyte-derived fibrocytes from monocytes, macrophages, and fibroblasts. PLoS ONE2009, 4:e7475.
Crawford JR, Pilling D, Gomer RH: Improved serum-free culture conditions for spleen-derived murine fibrocytes. Journal Of Immunological Methods2010, 363:9-20.
Pilling D, Gomer RH: Persistent Lung Inflammation and Fibrosis in Serum Amyloid P Component (Apcs -/-) Knockout Mice. PLoS ONE2014, 9:e93730.
Daubeuf F, Frossard N: Performing Bronchoalveolar Lavage in the Mouse. In Current Protocols in Mouse Biology. John Wiley & Sons, Inc.; 2012: 167–175.
Pilling D, Roife D, Wang M, Ronkainen SD, Crawford JR, Travis EL, Gomer RH: Reduction of bleomycin-induced pulmonary fibrosis by serum amyloid P. The Journal of Immunology2007, 179:4035-4044.
Pilling D, Zheng Z, Vakil V, Gomer RH: Fibroblasts secrete Slit2 to inhibit fibrocyte differentiation and fibrosis. Proc Natl Acad Sci U S A2014, 111:18291-18296.
Haston CK, Amos CI, King TM, Travis EL: Inheritance of susceptibility to bleomycin-induced pulmonary fibrosis in the mouse. Cancer Res1996, 56:2596-2601.
Kumar RK: Morphological methods for assessment of fibrosis. Methods MolMed2005, 117:179-188.
Hubner RH, Gitter W, El Mokhtari NE, Mathiak M, Both M, Bolte H, Freitag-Wolf S, Bewig B: Standardized quantification of pulmonary fibrosis in histological samples. Biotechniques2008, 44:507-511, 514-507.
Tashiro J, Rubio GA, Limper AH, Williams K, Elliot SJ, Ninou I, Aidinis V, Tzouvelekis A, Glassberg MK: Exploring Animal Models That Resemble Idiopathic Pulmonary Fibrosis. Frontiers in Medicine2017, 4.
Moore BB, Hogaboam CM: Murine models of pulmonary fibrosis. Am J Physiol Lung Cell Mol Physiol2008, 294:L152-160.
Redente EF, Jacobsen KM, Solomon JJ, Lara AR, Faubel S, Keith RC, Henson PM, Downey GP, Riches DW: Age and sex dimorphisms contribute to the severity of bleomycin-induced lung injury and fibrosis. Am J Physiol Lung Cell Mol Physiol2011, 301:L510-518.
Voltz JW, Card JW, Carey MA, Degraff LM, Ferguson CD, Flake GP, Bonner JC, Korach KS, Zeldin DC: Male sex hormones exacerbate lung function impairment after bleomycin-induced pulmonary fibrosis. Am J Respir Cell Mol Biol2008, 39:45-52.
Sundararaj K, Rodgers JI, Marimuthu S, Siskind LJ, Bruner E, Nowling TK: Neuraminidase activity mediates IL-6 production by activated lupus-prone mesangial cells. American Journal of Physiology-Renal Physiology2017, 314:F630-F642.
Pilling D, Karhadkar TR, Gomer RH: High-fat diet-induced adipose tissue and liver inflammation and steatosis in mice are reduced by inhibiting sialidases. The American Journal of Pathology2020, 191:131-143.
Pilling D, Karhadkar TR, Gomer RH: A CD209 ligand and a sialidase inhibitor differentially modulate adipose tissue and liver macrophage populations and steatosis in mice on the Methionine and Choline-Deficient (MCD) diet. PLOS ONE2020, 15:e0244762.
Yang WH, Westman JS, Heithoff DM, Sperandio M, Cho JW, Mahan MJ, Marth JD: Neu3 neuraminidase induction triggers intestinal inflammation and colitis in a model of recurrent human food-poisoning. Proc Natl Acad Sci U S A2021, 118.
Yang WH, Heithoff DM, Aziz PV, Haslund-Gourley B, Westman JS, Narisawa S, Pinkerton AB, Millán JL, Nizet V, Mahan MJ, Marth JD: Accelerated Aging and Clearance of Host Anti-inflammatory Enzymes by Discrete Pathogens Fuels Sepsis. Cell Host Microbe2018, 24:500-513.e505.

Competing interest reported. RHG is a scientific founder of Prosia Therapies an early stage company developing NEU3 inhibitors as therapeutics for pulmonary fibrosis. Texas A&M University has published patent applications on the use of sialidase inhibitors (United States Patent Application 20190201485) to regulate fibrosis. DP and RHG are inventors on pending patent applications for the use of sialidase inhibitors as anti-inflammatory and/or anti-obesity compounds.

AdditionalFigS1.tif
Additional Fig S1. Aspiration of recombinant murine NEU3 or inactive NEU3 had no significant effect on body weight or organ weights. Percent change in body weight of A) male and B) female naïve mice, or mice after aspiration of recombinant (rec) murine NEU3 or inactive NEU3 for every 48 hours for 20 days. C) Weights of white fat, liver, kidneys, spleen, heart, and brown fat as percentage of total bodyweight at day 21. Values are mean ± SEM, n=6 (3 male and 3 female mice). There were no significant changes as determined by t test or one-way ANOVA, Sidak’s test.
AdditionalFigS2.tif
Additional Fig S2: NEU3 treated male and female mice have increased numbers of bronchoalveolar lavage (BAL) cells. A) The total number of cells in mouse BAL after the indicated treatment from male and female mice. Values are mean ± SEM, n= 3 male and 3 female mice per group. B-C) BAL cell spots at day 21 were stained for the markers CD3, CD11b, CD11c, CD45, and Ly6g, and the percent of cells stained was determined, and the percentage was multiplied by the total number of BAL cells for that mouse to obtain the total number of BAL cells staining for the marker. Values are mean ± SEM., n =3 male and 3 female mice. *p < 0.05; **p < 0.01, *** p < 0.001 (one-way ANOVA, Sidak’s test).
AdditionalFigS3.tif
Additional Fig S3: Increase in immune cells in lungs post-BAL of NEU3 treated male and female mice. Cryosections of male and female mouse lungs were stained for A) CD3 B) CD11b, C) CD11c, D) CD45, E) Mac2 and F) Ly6g and counts were converted to the number of positive cells per mm². Values are mean ± SEM, n = 3 male and 3 female mice. *p < 0.05; ** p < 0.01 (one-way ANOVA, Sidak’s test).
AdditionalFigS4.tif
Additional Fig S4: NEU3, but not inactive NEU3, treated male and female mice have increased numbers of inflammatory cells in lung tissue following bleomycin aspiration. Cryosections of A) male and B) female mouse lungs were stained for CD3, CD11b, CD11c, CD45, Mac2, and Ly6g, and counts were converted to the number of positive cells per mm². Values are mean ± SEM, n = 3 male and 3 female mice. *p < 0.05; (one-way ANOVA, Sidak’s test).
AdditionalFigS5.tif
Additional Fig S5: Enhanced fibrotic response in NEU3 treated male and female mice following bleomycin. Sections of lung tissue from male and female mice treated with saline or bleomycin (Bleo) aspiration at day 0, and NEU3 or inactive NEU3 treatment from days 10 to 20, were stained with picrosirius red to show collagen content. Picrosirius red quantification of A) male and B) female mice. Values are mean ± SEM, n=3 male and n=3 female mice. *p < 0.05; **p < 0.01 ***p <0.001 (one-way ANOVA, Sidak’s test).

Download PDF

Editorial decision: Major revision
15 May, 2022
Reviewers agreed at journal
05 May, 2022
Reviews received at journal
22 Apr, 2022
Reviewers agreed at journal
11 Apr, 2022
Reviewers invited by journal
09 Apr, 2022
Editor assigned by journal
01 Apr, 2022
Submission checks completed at journal
01 Apr, 2022
First submitted to journal
30 Mar, 2022

You are reading this latest preprint version

The sialidase NEU3 promotes pulmonary fibrosis in mice

Status:

Version 1

Abstract

Figures

Background

Methods

Recombinant murine NEU3 expression

Recombinant murine inactive NEU3 variant generation

Cell Isolation and Culture

Mouse models of pulmonary inflammation and fibrosis.

Staining of bronchoalveolar lavage fluid (BALF) cells

Lung histology

Statistical Analysis

Results

Recombinant murine NEU3, but not mutated NEU3, has NEU3 activity

Aspiration of NEU3 or inactive NEU3 induces inflammation

Aspiration of NEU3 but not inactive NEU3 induces fibrosis

Following bleomycin, aspiration of NEU3 but not inactive NEU3 increases inflammation in male mice

Aspiration of NEU3 but not inactive NEU3 for 10 days increases fibrosis

Discussion

Conclusions

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1