Antibiotic resistance and carriage class I integron in clinical isolates of Acinetobacter baumannii from Al muthanna, Iraq

doi:10.21203/rs.3.rs-1508287/v1

PDF

Research Article

Antibiotic resistance and carriage class I integron in clinical isolates of Acinetobacter baumannii from Al muthanna, Iraq

https://doi.org/10.21203/rs.3.rs-1508287/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted 04 Apr, 2022

You are reading this latest preprint version

Background: In long-term hospitalized patients suffering from a urinary tract infection or skin burn, Acinetobacter baumannii has emerged as a significant pathogen with substantial morbidity and death. Aminoglycosides, fluoroquinolone monobactam carbapenemases, cephalosporin antibiotics, and integrons are the main DNA elements involved in the emergence of multidrug-resistant A. baumannii.

Objectives: The goal of this work was to systematically characterize and detect class 1, 2, and 3 integrons with many antibiotic resistance A. baumannii strains collected from a clinical environment in Iraq's Al-Muthanna hospitals.

Methods: In this investigation, 24 non-replicated clinical strains of A. baumannii were evaluated using Chrome agar as a selective medium and PCR of the rplB gene. The clonal relatedness of the isolates to class 1 integron was evaluated using a PCR technique.

Results: The prevalence of class 1 integron was detected by PCR in only 12 clones of A. baumannii followed by HinfI digestion analysis showing three identical bands at 160 bp, 1350 bp, and 870 bp. In addition, PCR sequencing confirmed the presence of gene cassette arrays consisting of aacA4-catB8-aadA1 (100%) in class 1 integron. The sequence analysis of the integron shows 97.87 identity with A. baumannii isolates from Australia (GenBank accession number CP054302) among A. baumannii isolates. The blast analysis of this class I integron showed that the presence of the intI1, aacA4-catB8-aadA1 genes can considerably boost the acquisition of MDR phenotypes in A. baumannii isolates.

Conclusions: Antibiotics of many types are widely used. The presence of integrons in A. baumannii is concerning for public health. In the clinical setting, it appears that class 1 integron can be used as a predictive biomarker for the presence of MDR phenotypes. In these bacteria, however, integron do not possess carbapenemases genes.

Acinetobacter baumannii

Multidrug-Resistant Isolates

Class 1 integron

Gene cassette

PCR-RFLP

With the increasing incidence on healthcare systems around the world, antimicrobial resistance (AMR) has emerged as a major issue. Antibiotic resistance has been linked to high rates of morbidity and mortality in recent years as a result of prolonged hospitalization (Gholami et al., 2017).

Antibiotic resistance is a normal occurrence in bacteria, but it is amplified when antibiotics are misused in humans and animals (Elshamy & Aboshanab, 2020). Highly mobile genetic elements are a crucial factor in the rapid spread of antibiotic resistance. These elements have the ability to multiply and spread amongst bacterial species (Mirshekar, Shahcheraghi, Azizi, Solgi, & Badmasti, 2018). Due to the development of a wide array of antibiotic resistance genes as well as environmental adaption in various harsh conditions, Acinetobacter baumannii is becoming a severe clinical concern. Regardless of new therapeutic alternatives, A. baumannii strains have demonstrated a remarkable ability to rapidly evolve multi-drug resistance in recent decades (MDR). This rapid rise in MDR is attributed not just to these strains' inherent resistance genes, but also to their exceptional ability to acquire resistant components from other bacteria (Koczura, Przyszlakowska, Mokracka, & Kaznowski, 2014).

Acinetobacter bacteria are members of the Gammaproteobacteria class, which includes a wide range of bacteria (Qin et al., 2019; Radolfova-Krizova et al., 2016). Some Acinetobacter species invade mammals' skin and mucous membranes, and they have been found as opportunistic pathogens in humans, especially in hospital patients (Dijkshoorn et al., 2007). Acinetobacter species are adaptable to a wide range of situations, including the natural world and hospitals (Adewoyin and Okoh, 2018). The Gram-negative opportunistic pathogen Acinetobacter baumannii causes a variety of nosocomial diseases. Due to increased levels of antibiotic resistance, treating infections caused by these bacteria has become problematic (Harding, Hennon, & Feldman, 2018).

Carbapenem-resistant A. baumannii (CRAb) strains that are also extensively drug resistant have become a major concern globally (Hamidian & Nigro, 2019; Higgins et al., 2021). Most A. baumannii strains were antibiotic-susceptible prior to the 1970s (Gootz and Marra, 2008); however, as antibiotic use increased, multidrug-resistant (MDR) strains quickly evolved, with up to 57 percent of strains demonstrating MDR in recent research (De Francesco et al., 2013). This rapid rise in MDR is due not only to these strains' intrinsic resistance genes, but also to their exceptional ability to acquire resistant elements from other bacteria. The A. baumannii genome relies on Class 1 integron to capture and accumulate many antibiotic resistance genes. Throughout Acinetobacter spp., horizontal gene transfers of mobile genetic elements such as plasmids, transposons, and integrons is frequently used to facilitate the acquisition and spread of an antimicrobial-resistant determinant in hospitals and communities. Integrons are unusual among these mobile elements in that they can carry and express resistance genes (Goudarzi & Azimi, 2017).

In this study, 12 clones of A. baumannii clinical isolates were tested. These isolates' antibiotic resistance phenotype and population structure were studied, as well as the genetic properties of class 1 integron in MDR isolates. The class I integron of a sample strain was sequenced and examined to acquire insight into the genetic environment of a common class 1 integron, as well as additional resistance gene content and context.

2.1. A. baumannii Isolates

During the months of September 2021 and February 2022, 200 clinical bacterial isolates were collected from Al-Muthanna hospitals in Iraq (Hussein Teaching Hospital and Maternity & Children Teaching Hospital). The Ethics Committee of Al-Muthanna University's Ministry of Higher Education and Scientific Research approved this work.

2.2 Bacterial isolation and laboratory diagnosis

Bacterial isolates were obtained from 50 skin burn swabs and 50 urine samples. These samples were grown overnight on MacConkey agar media to isolate a single non-fermenting bacterial colony, then grown overnight on Chrome agar as a selective medium to isolate pure A. baumannii. These isolates were confirmed through the use of standard microbiological and biochemical testing, including the Vitek system (bioMérieux Vitek Systems Inc., Hazelwood, MO), which was used to identify isolates. (Ciftci et al., 2015). According to MacFaddin (2000), the isolates were evaluated based on their physical traits and routine biochemical assays. Then, utilizing the previously published method of amplification of the rplB gene, a one-tube multiplex PCR assay was performed for the fast identification of A. baumannii (Abhari et al., 2021; Chen et al., 2007)

2.2. Antimicrobial Susceptibility Test

The susceptibility of A. baumannii to aminoglycoside drugs such as Amikacin, Gentamicin, Tobramycin, Streptomycin and Kanamycin; cephalosporins such as Ceftazidime and Ceftriaxone and Cefepime; penicillins such as Ticarcillin; monobactam such as Aztreonam; carbapenem such as Imipenem and Meropenem; fluoroquinolone antibiotics such as Ciprofloxacin and Levofloxacin; Ampicillin/sulbactam, Piperacillin/tazobactam, Imipenem/EDTA; Sulfamethoxazole/trimethoprim combination (TM Media/India) was tested using the Clinical Laboratory Standard Institute (CLSI) recommended agar dilution method (Zhang et al., 2011), and was evaluated using the CLSI interpretive criteria (Kristo et al., 2013).

2.2 DNA extraction

All twenty-four isolates had their genomic DNA extracted using a specialized kit (wizard® genomic DNA purification kit, Promega business, USA) according to the manufacturer's instructions. The gDNA was eluted in 50µL of nuclease-free water in the final stage of the extraction processes to produce a good DNA concentration and kept at -20 oC until used in the PCR reaction.

2.4 PCR amplification.

PCR amplifications were carried out in 20µL volumes using GoTaq® Green Master Mix, 2X containing GoTaq® DNA Polymerase is supplied in 2X Green GoTaq® reaction Buffer (pH 8.5), 400µM dATP, 400µM dGTP, 400µM dCTP, 400µM dTTP and 3mM MgCl2 and including 5 ml of template DNA and 1.25mM each primer. PCR amplification was performed with the Labnet MultiGene OptiMax Thermal Cycler. Amplification products were resolved by electrophoresis at 100 V for 1 h on 1.5% agarose gels with 0.53 Tris-borate-EDTA buffer containing ethidium bromide and were visualized under UV light. PCR amplification for the detection of class 1 integron cassettes (integron PCR) was performed with primers 5’CS and 3’CS, as described previously (Azizi et al., 2021). For PCR detection of the IntI1 and IntI2 integrase genes (integrase gene PCR), oligonucleotide primers based on the intI1 and intI2 genes were designed (Table1). Primers IntIF and IntIR were used to amplify a 160 bp fragment of the intI1gene. The combination of primers Int2F and Int2R amplified a fragment of 288 bp, specific for the intI2 gene. The combination of primers Int3F and Int3R amplified a fragment of 1041 bp, specific for the intI3 gene was described previously (Chen et al., 2015; Azizi et al., 2021). The positions of the primers relative to the integron are indicated in (Figure 1). PCR amplification of integrase gene type 1, type 2 and type 3 was performed simultaneously for 35 cycles: 5 min of denaturation at 95°C, 30 s of denaturation at 95°C, 30 s of annealing at 55°C, and 1 min of extension at 72°C while the viable region of the integron, the PCR was performed simultaneously for 35 cycles: 5 min of denaturation at 95°C, 30 s of denaturation at 95°C, 30 s of annealing at 55°C, and 2.5 min of extension at 72°C.

The class 1 integron structure was determined by means of overlapping PCR fragments using the 5’CS /aacA6-R or aacA6-F/3’CS that covered from conserve of integron (intl1) to AAC(6') gene using the primers listed in (Table 1). PCR was performed simultaneously for 35 cycles: 30 s of denaturation at 95°C, 30 s of annealing at 55°C, and 1 min of extension at 72°C (Azizi et al., 2021).

2.5. Fragment Length Polymorphism Analysis

In order to identify class, I integron structures. PCR positive products of using 5’CS and 3’CS primer were digested using HinfI (promega). Briefly, the positive PCR products were purified using Wizard® SV Gel and PCR Clean-Up System (promega), and then eluted in 17.3µl in deionized water, followed by adding 2µl of 10x Buffer B, 0.2µl of 10µg/µl Acetylated BSA, and 0.5µl HinfI enzyme. The digestion reactions were carried out at 37°C for 2 h. The resulting restriction patterns were analyzed through electrophoresis on 1.5% agarose gels. The size and number of generated fragments are given in (Table 2).

2.6 Sequence analysis. To confirm the structure of class I intergon, the amplification products of using both 5’CS and 3’CS was purified and send to Macrogen Corporation-Korea using ABI3730XL, automated DNA sequencer. The strain A1 and A3 were chosen and sequenced as the digestion of HinfI was shown the same profile for 12 strains of class I intregon. Then sequenced DNA in NCBI GeneBanK database and the results were analyzed by using Geneious 9 software. The sequences of these products were 100% identical to previously published sequences of the intI1 gene.

2.7 Statistical analysis

The p-value of Antimicrobial resistance prevalence in integron-positive and integron-negative was analysis by was analyzed using one-way analysis of variance, student t-test, using GraphPad Prism 8 software.

2.8 Bioinformatics

Geneious 7.2.2 (Biomatters) was used for visualisation and alignment of gDNA, primers annotation and determination of restriction enzyme.

3.1 Identification of in A. baumannii

Isolates from 100 samples were assigned to 24 distinct Acinetobacter baumannii based on the results of rplB gene analysis and VITEK-2 Compact system. The PCR amplification of rplB gene showed the expected product of 440 bp (Figure 2). The rplB gene in A. baumannii is a housekeeping gene that encodes 50S ribosomal protein. It is essential for ribosome activity and is a major component of the peptidyl transferase (Von Mering et al., 2007; Case et al., 2007). Moreover, it has been used in multilocus sequence typing (MLST) in order to identify phylogenetic relationships for the genus Acinetobacter with local clinical isolates of A. baumannii (El-Shazly, Dashti, Vali, Bolaris, & Ibrahim, 2015).The samples were collected from 50 swabs of burned skin and 50 samples of urine (Table 2).Acinetobacterbaumanniiown class I integron was detected in 10 isolates of A. baumannii, while in the burn sample it was detected in 2 isolates (Table 2). In a recent study, it was shown that of 103 collected samples from different sources such as tracheal aspirate, catheter, sputum, CSF, and wounds, only 65 non-repetitive isolates were collected and confirmed as MDR A. baumannii (Azizi et al., 2021).

3.2 Mapping of class 1 integron

The cassette assortments in all the strains were characterized by PCR with the 5’CS and 3’CS primers and by sequencing of the amplification products (Table 1) (Figure 1 and Figure 3). The sequences were found to be identical to those identified in integron of other A. baumannii isolates from Australia (Roberts et al., 2020), (GenBank accession number CP054302) (Table 3) and (Figure 5) when compared using BLAST.

In this study, 24 non-duplicated isolates were identified as A. baumannii isolates. The gDNA was extracted, followed by PCR screening for the intI, intI1 and intI1I. The result showed a positive PCR product for only intI atthe expected product of 160 bp (Figure 3). Then the variable region for the integron was amplified using 5’CS and 3’CS primers, giving the expected product of 2380 bp (Figure 1 and Figure 3). Subsequently, the primers aacA6-F and aacA6R were used in order to identify the integron cassette arrays. This PCR amplification showed the expected product of 508 bp, followed by using an overlap PCR fragment using the aacA6-F/3'CS, giving the expected product of 2204 bp, confirming that AAC(6) is part of the classI integron. In order to differentiate between the classes, the I integron cassette of 12 clones was PCR product using IntI-F and 3’CS primers and was digested with HinfI restriction enzyme, showing three different bands of 160 bp, 1350 bp, and 870 bp, confirming that the 12 strains contain the same cassette arrays of three different genes (Table 1 and Table 3). These results are different from those that were published, which showed different cassette arrays (Turton et al., 2005; Zhu et al., 2014). Out of twelve, two identical strains were sequenced using 5’CS and 3’CS primers, showing alignment at 97.87 with CP054302 (Table 3) having three encoding genes: AAC(6)-catB8-AadA. Similarly, these A. baumannii strains have aadA6 cassettes, which have been previously described for P. aeruginosa, indicating that integrons can be transferred between these two species via plasmids and/or transposons (Koeleman et al.,2001; Turton et al., 2005).

In a recent study, the class 1 integron and complex gene cassettes of distinct species of clinical isolates from northern China were described. 383 clinical isolates were collected from northern China, and class 1 integron with gene cassettes were found in gram-negative clinical isolates in large numbers. A. baumannii was the most common isolate, with 78.5 percent carrying the aacA4-catB8-aadA1 gene cassettes (Xia et al.,2013)

Twelve strains had an integron containing a single cassette which encoded an AAC(6)-catB8-AadA aminoglycoside-modifying enzyme. Previous studies reported integrons containing genes that confer resistance to aminoglycoside antibiotics such as gentamicin, spectinomycin, streptomycin, amikacin, netilmicin, and tobramycin (Turton et al., 2005). Furthermore, the sequencing results show that the integron class I contain catB8, which encodes a chloramphenicol acetyltransferase, and AadA, which have previously been identified as resistance genes for chloramphenicol, spectinomycin, and streptomycin, respectively (Turton et al., 2005; Sung, Kwon, Cho, & Koo, 2011; Azizi et al., 2021).

3.3. Antimicrobial resistance pattern of positive class I integron in A. baumannii isolates

Antibiotic susceptibilities of some representatives from this study are given in (Table 4). Representatives of the 12 clones containing the 2.3-kb class I integron cassette array associated with contained the aacA4 gene, the chloramphenicol acetyltransferase gene catB8, and the aadA1 gene, conferring resistance to aminoglycoside were highly resistant to most antibiotics they would be considered resistant using National Committee for Clinical Laboratory Standards guidelines. The 12 strains were shown to have 100% level resistance against Amikacin, Gentamicin, Tobramycin, Kanamycin, Ceftazidime, Cefepime, Ceftriaxone, Imipenem, Meropenem, Ciprofloxacin, Levofloxacin, Trimethoprim/sulfamethoxazole, while only 6 out of 12 clones were resistant to Imipenem/EDTA at 50% and 66% resistance level against Ampicillin/sulbactam and Piperacillin/tazobactam. According to a recent study, 75.2 percent of the 125 examined isolates were imipenem resistant, which was linked to having the blaADC and blaOXA-51 like genes were found in 84 percent and 8% (imipenem resistant) of isolates, respectively, in association with the ISAba1 sequence in all isolates (Khorsi et al., 2015).

However, the 12 strains that did not have class I integron detection were shown to have the lowest resistance level, represented by 25% for aminoglycoside, fluoroquinolone antibiotics, 33.33% for cephalosporin and monobactam, and 41.66% against Trimethoprim/sulfamethoxazole. The most effective antibiotics are Imipenem, Meropenem, Ampicillin/sulbactam, and Piperacillin/tazobactam. The results showed only two strains were resisted at a percentage of 16.66%, followed by the recombination drugs such as Imipenem and EDTA, which showed 100% sensitivity against all 12 non-class I integron strains. Class 1 integron have cassettes that don't normally have a promoter. As a result, they are frequently transcribed from P_C, a promoter upstream of the cassette arrays, resulting in significantly lower expression levels of downstream gene cassettes (Hall, 2012). As a result, the class 1 integron usually only comprises 6 gene cassettes (Gillings et al., 2008). In addition, the integron discovered in this study had 3–5gene cassettes, which is typical of class 1 integron. The most common form of resistant bacteria is β-lactam (Norrby, 2005). Despite the fact that gene cassettes in class 1 integron encode diverse types of resistance, no gene cassette conferring β-lactam resistance was discovered in our investigation. Furthermore, gene cassettes encoding aminoglycoside-modifying enzymes were the most common in the study. This shows that aminoglycoside resistance and our MDR isolates are linked. A similar recent study found that class I integron contains only three genes, aac(6)-IId-catB8-aadA1, with no genes encoding for β-lactamase enzymes, and A. baummanni clones had the highest prevalence of antibiotic resistance (Zhu et al., 2014). Globally, a substantial incidence of class 1 integron has been confirmed among multidrug-resistant A. baumannii clinical strains (Turton et al., 2005; Asadollahi et al., 2011; Poonsuk et al., 2012). Class 1 integron have also been found in >50% of antibiotic-resistant A. baumannii strains in China (Zhang et al., 2010; Zhong et al., 2012). Furthermore, the class 1 integron gene cassette array aac(6)-IId-catB8-aadA1 has a large fraction of the aac(6)-IId-catB8-aadA1 (Zhong et al.,2012; Chen et al., 2015). Approximately 50 percent of the 12 MDR strains studied in this study include class 1 integron, the majority of which have the aac(6)-IId-catB8-aadA1 array. More research into the gene cassette array transmission method is needed, with an emphasis on the clinical prevalence of the aac(6)-IId-catB8-aadA1 cassette array.

The significant incidence of antibiotic resistance among A. baumannii isolates in clinical samples necessitates a comprehensive antimicrobial stewardship and infection control approach. In clinical strains, repertoires of aminoglycoside-modifying enzymes make up the Class 1 integron. In the clinical setting, class 1 integron can be employed as a predictive biomarker for the existence of MDR microorganisms. Carbapenemase hoarding on the integron apparatus, on the other hand, is not common among A. baumannii strains. Continuous observation of MDR A. baumannii in the clinic and clarification of their AMR processes are clearly required to aid in the development of successful therapeutic regimens and to avoid the spread of these superbug bacteria. More research is needed to clarify the link between A. baumannii gene pools and antibiotic resistance patterns, as well as the epidemiological and clinical effects of infection.

Abhari, S. S., Azizi, O., Modiri, L., Aslani, M. M., Assmar, M., Fereshteh, S., . . . probes, c. (2021). Two new rapid PCR-based methods for identification of Acinetobacter baumannii isolated from clinical samples. 58, 101732.

Adewoyin, M. A., & Okoh, A. I. J. R. o. e. h. (2018). The natural environment as a reservoir of pathogenic and non-pathogenic Acinetobacter species. 33(3), 265-272.

Asadollahi, K., Taherikalani, M., Maleki, A., Alizadeh, E., Valadbaigi, H., Soroush, S., . . . Emaneini, M. J. A. m. e. i. H. (2011). Diversity of aminoglycoside modifying enzyme genes among multidrug resistant Acinetobacter baumannii genotypes isolated from nosocomial infections in Tehran hospitals and their association with class 1 integrons. 58(4), 359-370.

Azizi, O., Fereshteh, S., Nasiri, O., Ghorbani, M., Barzi, S. M., & Badmasti, F. J. J. J. o. M. (2021). The occurrence and characterization of class i, ii, and iii integrons among carbapenemase-producing clinical strains of acinetobacter baumannii in tehran, iran. 14(6), 1-13.

Case, R. J., Boucher, Y., Dahllöf, I., Holmström, C., Doolittle, W. F., Kjelleberg, S. J. A., & microbiology, e. (2007). Use of 16S rRNA and rpoB genes as molecular markers for microbial ecology studies. 73(1), 278-288.

Chen, J., Li, H., Yang, J., Zhan, R., Chen, A., Yan, Y. J. I. J. o. E. R., & Health, P. (2015). Prevalence and characterization of integrons in multidrug resistant Acinetobacter baumannii in Eastern China: a multiple-hospital study. 12(8), 10093-10105.

Chen, T.-L., Sin, L.-K., Wu, R.-C., Shaio, M.-F., Huang, L.-Y., Fung, C.-P., . . . infection. (2007). Comparison of one-tube multiplex PCR, automated ribotyping and intergenic spacer (ITS) sequencing for rapid identification of Acinetobacter baumannii. 13(8), 801-806.

Ciftci, A., Karakece, E., Atasoy, A., Asik, G., Ciftci, I. J. J. o. M., & Experimentation. (2015). Culture media for detection of Acinetobacter baumannii selective media for detection of A baumannii. 2(3), 1-4.

De Francesco, M. A., Ravizzola, G., Peroni, L., Bonfanti, C., & Manca, N. (2013). Prevalence of multidrug-resistant Acinetobacter baumannii and Pseudomonas aeruginosa in an Italian hospital. J Infect Public Health, 6(3), 179-185. doi:10.1016/j.jiph.2012.11.006.

Dijkshoorn, L., Nemec, A., & Seifert, H. J. N. r. m. (2007). An increasing threat in hospitals: multidrug-resistant Acinetobacter baumannii. 5(12), 939-951.

El-Shazly, S., Dashti, A., Vali, L., Bolaris, M., & Ibrahim, A. S. J. I. J. o. I. D. (2015). Molecular epidemiology and characterization of multiple drug-resistant (MDR) clinical isolates of Acinetobacter baumannii. 41, 42-49.

Elshamy, A. A., & Aboshanab, K. M. J. F. s. O. (2020). A review on bacterial resistance to carbapenems: epidemiology, detection and treatment options. 6(3), FSO438.

Gholami, M., Haghshenas, M., Moshiri, M., Razavi, S., Pournajaf, A., Irajian, G., & Heidary, M. J. I. J. o. P. (2017). Frequency of 16S rRNA methylase and aminoglycoside-modifying enzyme genes among clinical isolates of Acinetobacter baumannii in Iran. 12(4), 329.

Gillings, M., Boucher, Y., Labbate, M., Holmes, A., Krishnan, S., Holley, M., & Stokes, H. W. J. J. o. b. (2008). The evolution of class 1 integrons and the rise of antibiotic resistance. 190(14), 5095-5100.

Gootz, T. D., & Marra, A. J. E. r. o. a.-i. t. (2008). Acinetobacter baumannii: an emerging multidrug-resistant threat. 6(3), 309-325.

Goudarzi, M., & Azimi, H. J. J. J. o. M. (2017). Dissemination of classes 1, 2, and 3 integrons in acinetobacter baumannii strains recovered from intensive care units using polymerase chain reaction-restriction fragment length polymorphism. 10(5).

Hall, R. M. (2012). Integrons and gene cassettes: hotspots of diversity in bacterial genomes. 1267(1), 71-78. doi:https://doi.org/10.1111/j.1749-6632.2012.06588.x

Hamidian, M., & Nigro, S. J. J. M. g. (2019). Emergence, molecular mechanisms and global spread of carbapenem-resistant Acinetobacter baumannii. 5(10).

Harding, C. M., Hennon, S. W., & Feldman, M. F. J. N. R. M. (2018). Uncovering the mechanisms of Acinetobacter baumannii virulence. 16(2), 91-102.

Harding, C. M., Hennon, S. W., & Feldman, M. F. J. N. R. M. (2018). Uncovering the mechanisms of Acinetobacter baumannii virulence. 16(2), 91-102.

Higgins, P. G., Hagen, R. M., Kreikemeyer, B., Warnke, P., Podbielski, A., Frickmann, H., & Loderstädt, U. J. A. (2021). Molecular epidemiology of carbapenem-resistant Acinetobacter baumannii isolates from Northern Africa and the Middle East. 10(3), 291.

Khorsi, K., Messai, Y., Hamidi, M., Ammari, H., & Bakour, R. J. A. P. j. o. t. m. (2015). High prevalence of multidrug-resistance in Acinetobacter baumannii and dissemination of carbapenemase-encoding genes blaOXA-23-like, blaOXA-24-like and blaNDM-1 in Algiers hospitals. 8(6), 438-446.

Koczura, R., Przyszlakowska, B., Mokracka, J., & Kaznowski, A. J. C. m. (2014). Class 1 Integrons and Antibiotic Resistance of Clinical Acinetobacter calcoaceticus–baumannii Complex in Poznań, Poland. 69(3), 258-262.

Koeleman, J. G., Stoof, J., Van Der Bijl, M. W., Vandenbroucke-Grauls, C. M., & Savelkoul, P. H. J. J. o. c. m. (2001). Identification of epidemic strains of Acinetobacter baumannii by integrase gene PCR. 39(1), 8-13.

Kristo, I., Pitiriga, V., Poulou, A., Zarkotou, O., Kimouli, M., Pournaras, S., & Tsakris, A. J. I. j. o. a. a. (2013). Susceptibility patterns to extended-spectrum cephalosporins among Enterobacteriaceae harbouring extended-spectrum β-lactamases using the updated Clinical and Laboratory Standards Institute interpretive criteria. 41(4), 383-387.

MacFaddin, J. J. P., PA. (2000). Biochemical tests for identification of medical bacteria, Williams and Wilkins. 113.

Mirshekar, M., Shahcheraghi, F., Azizi, O., Solgi, H., & Badmasti, F. J. M. D. R. (2018). Diversity of class 1 integrons, and disruption of carO and dacD by insertion sequences among Acinetobacter baumannii isolates in Tehran, Iran. 24(4), 359-366.

Norrby, S. R. J. C. I. D. (2005). Integrons: adding another threat to the use of antibiotic therapy. 41(1), 10-11.

Poonsuk, K., Tribuddharat, C., Chuanchuen, R. J. S. A. J. o. T. M., & Health, P. (2012). Class 1 integrons in Pseudomonas aeruginosa and Acinetobacter baumannii isolated from clinical isolates. 43(2), 376.

Qin, J., Maixnerová, M., Nemec, M., Feng, Y., Zhang, X., Nemec, A., . . . microbiology, a. (2019). Acinetobacter cumulans sp. nov., isolated from hospital sewage and capable of acquisition of multiple antibiotic resistance genes. 42(3), 319-325.

Radolfova-Krizova, L., Maixnerova, M., Nemec, A. J. I. j. o. s., & microbiology, e. (2016). Acinetobactercelticus sp. nov., a psychrotolerant species widespread in natural soil and water ecosystems. 66(12), 5392-5398.

Roberts, L. W., Forde, B. M., Hurst, T., Ling, W., Nimmo, G. R., Bergh, H., . . . Lipman, J. J. m. (2020). Genomic surveillance, characterisation and intervention of a carbapenem-resistant Acinetobacter baumannii outbreak in critical care.

Sung, J. Y., Kwon, K. C., Cho, H. H., & Koo, S. H. J. T. K. J. o. L. M. (2011). Antimicrobial resistance determinants in imipenem-nonsusceptible Acinetobacter calcoaceticus-baumannii complex isolated in Daejeon, Korea. 31(4), 265-270.

Turton, J. F., Kaufmann, M. E., Glover, J., Coelho, J. M., Warner, M., Pike, R., & Pitt, T. L. J. J. o. c. m. (2005). Detection and typing of integrons in epidemic strains of Acinetobacter baumannii found in the United Kingdom. 43(7), 3074-3082.

Von Mering, C., Hugenholtz, P., Raes, J., Tringe, S., Doerks, T., Jensen, L., . . . Bork, P. J. s. (2007). Quantitative phylogenetic assessment of microbial communities in diverse environments. 315(5815), 1126-1130.

Xia, C., Li, G. X., Zhang, H., Min, Y., Hou, X. P., Yu, H. L., . . . Sciences, E. (2013). Characterization of class 1 integron gene cassettes among clinical bacteria isolated from one large hospital in northern China. 26(12), 1003-1007.

Zhang, J. P., Zhu, W., Tian, S. F., Chu, Y. Z., & Chen, B. Y. J. T. J. o. M. (2010). Molecular characteristics and resistant mechanisms of imipenem-resistant Acinetobacter baumannii isolates in Shenyang, China. 48(5), 689-694.

Zhang, S. X., Rawte, P., Brown, S., Lo, S., Siebert, H., Pong-Porter, S., . . . Jamieson, F. B. J. J. o. c. m. (2011). Evaluation of CLSI agar dilution method and Trek Sensititre broth microdilution panel for determining antimicrobial susceptibility of Streptococcus pneumoniae. 49(2), 704-706.

Zhong, Q., Xu, W., Wu, Y., & Xu, H. J. A. o. l. m. (2012). Clonal spread of carbapenem non-susceptible Acinetobacter baumannii in an intensive care unit in a teaching hospital in China. 32(6), 413-419.

Zhu, Y., Yi, Y., Liu, F., Lv, N., Yang, X., Li, J., . . . Zhu, B. J. M. r. (2014). Distribution and molecular profiling of class 1 integrons in MDR Acinetobacter baumannii isolates and whole genome-based analysis of antibiotic resistance mechanisms in a representative strain. 169(11), 811-816.

Table 1: Primer Sequences Used for PCR Amplification and Sequencing
Gene name	Primer Sequences	PCR Product Size (bp)	Annealing temp (°C)
intl1	F: 5’-CAG TGG ACA TAA GCC TGT TC-3’; R: 5’-CCC GAG GCA TAG ACT GTA-3’	160	55 °C
intl2	F: 5’-TTG CGA GTA TCC ATA ACC TG-3’; R: 5’-TTA CCT GCA CTG GAT TAA GC-3’	288	55 °C
intl3	F: 5’-GCCTCCGGCAGCGACTTTCAG-3’; R: 5’-ACGGATCTGCCAAACCTGACT-3’	1041	55 °C
intl CS	F: 5’-GGC ATC CAA GCA GCA AG-3’; R: 5’-AAGCAG ACT TGA CCT GA-3’	Unknown	55 °C
aacA6	F: 5’-ATGACTGAGCATGACCTTG-3’ R: 5’-TGCGTGTTCGCTCGAATGCC-3	508	55 °C
rplB	F: GTAGAGCGTATTGAATACGATCCTAACC R: CACCACCACCATGCGGGTGATC	440	55 °C

Table 2. Numbers of *A. baumannii* isolates and distribution of class I integron based on source of isolation
Specimen	A. baumannii No. (%)	class I integron No. (%)
Urine	15 (62.5%)	10 (66.66%)
Burn	9 (37.5%)	2 (22.22%)
Total	24 (100%)	12 (50%)
Frequency of class I integron among urine samples was significantly the highest in all the A. baumannii isolates at P-value: 0.0.0692, Chi-square, df = 3.303, 1at ( P < 0.05)

Table 3. Restriction enzymes in RFLP and gene cassette array restriction fragments
Sources	Identity	Gene cassette array	GenBank accession No.	Amplicon size (bp)	Restriction enzyme	Restriction fragment size (s) (bp)
A. baumannii strain MS14413	97.87	aacA4-catB8-AadA	CP054302	2,380	HinfI	160/1350/870

*Table 4. Antimicrobial resistance prevalence in integron-positive and integron-negative Acinetobacter baumannii* isolates.**
Antimicrobial	Integron-Positive *A. baumannii* Isolates (n = 12) *Resistance (%)**	Integron-Negative *baumannii* Isolates (n = 12) *Resistance (%)**	*P value*
Amikacin	12 (100)	3 (25)	<0.001
Gentamicin	12 (100)	3 (25)	<0.001
Tobramycin	12 (100)	3 (25)	<0.001
Streptomycin	12 (100)	3 (25)	<0.001
Kanamycin	12 (100)	3 (25)	<0.001
Ceftazidime	12 (100)	4 (33.33)	<0.001
Cefepime	12 (100)	4 (33.33)	<0.001
Ceftriaxone	12 (100)	4 (33.33)	<0.001
Ticarcillin	12 (100)	4 (33.33)	<0.001
Aztreonam	12 (100)	4 (33.33)	<0.001
Imipenem	12 (100)	2 (16.66)	<0.001
Meropenem	12 (100)	2 (16.66)	<0.001
Imipenem/EDTA	6 (50)	0 (100)	<0.001
Ampicillin/sulbactam	8 (66.66)	2 (16.66)	<0.001
Piperacillin/tazobactam	8 (66.66)	2 (16.66)	<0.001
Ciprofloxacin	12 (100)	3 (25)	<0.001
Levofloxacin	12 (100)	3 (25)	<0.001
Trimethoprim/ sulfamethoxazole	12 (100)	5 (41.66)	<0.001

No competing interests reported.

PDF

Version 1

posted 04 Apr, 2022

You are reading this latest preprint version

Antibiotic resistance and carriage class I integron in clinical isolates of Acinetobacter baumannii from Al muthanna, Iraq

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials And Methods

3. Results And Discussion

4. Conclusion

References

Tables

Competing Interests

Status:

Version 1