Differing SAGA module requirements for NCR-sensitive gene transcription in yeast

doi:10.21203/rs.3.rs-1509080/v1

Download PDF

Article

Differing SAGA module requirements for NCR-sensitive gene transcription in yeast

https://doi.org/10.21203/rs.3.rs-1509080/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Nitrogen Catabolite repression is a means for yeast to adapt its transcriptome to changing nitrogen sources in its environment. In conditions of derepression (under poor nitrogen condition, upon rapamycin treatment, or when glutamine production is inhibited), two transcriptional activators of the GATA family are recruited to NCR-sensitive promoters and activate transcription of NCR-sensitive genes. Earlier observations have involved the SAGA chromatin remodelling complex in these transcriptional regulations. In this report, we provide an illustration of the varying NCR-sensitive responses and question whether differing SAGA recruitment could explain this diversity of responses.

Yeast

nitrogen catabolite repression

transcription

chromatin

SAGA

During its evolution, the yeast S. cerevisiae has faced a strong selective pressure for the optimal use of nitrogen sources. Hence, it has developed a series of regulations allowing for fine-tuned responses to the quality of the nitrogen source available. Among these, nitrogen catabolite repression (NCR) comprises transcriptional regulations of genes encoding permeases and catabolic enzymes permitting the use of non-preferred nitrogen sources (like proline, for example) when they are the only nitrogen sources available in the environment ^1–5. In addition to growing cells in the sole presence of non-preferred nitrogen sources, other ways of artificially inducing NCR-sensitive gene expression have been described: the addition of methionine sulfoximine (Msx), an inhibitor of the Gln1 glutamine synthetase or rapamycin (Rap), the inhibitor of the kinase complex TORC1, to cells grown in the presence of a preferred nitrogen source like ammonium can also lead to the derepression of NCR-sensitive genes ^6–8. NCR-sensitive transcriptional activation is mediated by two GATA-type transcriptional activators: Gln3 and Gat1/Nil1 ^9–11. In derepressive conditions, Gln3 and Gat1 are nuclear and bind to specific consensus GATA sequences in the promoter of NCR-sensitive genes ^8,12−14 to activate their transcription. Though, the mechanisms by which the GATA factors activate transcription are still largely unknown to date. In this context, we have previously shown that the expression of NCR-sensitive genes responds differently to the presence of the GATA activators according to the gene and nitrogen source considered ^8,14,15, which brought us to the idea that a transcriptional model including only the GATA activators to explain NCR-sensitive gene expression is likely to be incomplete.

Transcription initiation is a key step in the control of eukaryotic gene expression. It involves the ordered recruitment of activators, coactivators and basal transcription factors to promoters, contributing to the formation of the transcription preinitiation complex (PIC), before transcription initiation begins ^16–18. Nucleosome positioning and chromatin compaction are key in regulating promoter accessibility and PIC formation ^19,20. Co-activators can possibly affect PIC recruitment at three levels (reviewed in ^18,21): 1-by directly connecting activators with the basal transcription factors, 2-by covalent histone modification (methylation, acetylation, phosphorylation, ubiquitylation…) or 3-by ATP-dependent nucleosome remodeling (displacement, eviction, restructuration). More recently, a wide array of coactivators have been shown to be multi-modular complexes carrying different combinations of regulatory activities (reviewed by ²¹). Hence, the different subunits composing the functional modules of coactivators have been shown to be shared by different coactivator complexes ²¹. One such coactivator is the Spt-Ada-Gcn5 acetyltransferase (SAGA) complex, that modulates the expression of ± 10% of all yeast genes, being usually highly inducible genes ^22,23. SAGA is composed of proteins belonging to three major families involved in gene expression: Ada (Alteration/Deficiency in Activation; ²⁴), Spt (SuPpressor of Ty's; 25) and TAFs (TATA-binding protein (TBP)-Associated Factors). Although the SAGA complex was initially described as a histone acetyltransferase protein complex ²⁶, deep investigation of its structure and composition has largely contributed to deciphering its multifunctional character (reviewed in ^27–29). The yeast SAGA comprises 19–21 subunits ^30,31, organized into four functional units or modules in addition to the Tra1 recruitment protein ^28,31: the CORE structural module (Spt7, Spt20, Ada1, Taf5, Taf6, Taf9, Taf10 and Taf12), the histone H3 acetylation (HAT) module (Gcn5, Ada2, Ada3 and Sgf29), TBP-interaction module (Spt3 and Spt8) and the H2B deubiquitination (DUB) module (Ubp8, Sus1, Sgf11, and Sgf73). More recently, structure determination of the SAGA complex has attributed Spt3 to the CORE module ³². Nonetheless, in this report, Spt3 makes the connection between the CORE and Spt8, itself interacting with the TATA box-binding protein ³².

Interestingly, the SAGA CORE element Ada1 has been involved in the expression of many Nitrogen Catabolite Repression-sensitive genes at different degrees according to the nitrogen source available and the gene considered ³³. These observations suggest a role for SAGA that could connect the GATA factors to the variations in NCR-sensitive gene expression. In this report, we illustrate the diversity of NCR-sensitive responses: an NCR-sensitive gene does not respond similarly to different stimuli, different NCR-sensitive genes do not respond similarly to the same stimuli, GATA factor recruitment and requirement differ according to genes and stimuli. Here, we also show that SAGA recruitment does not escape the rule: it largely correlated with GATA factor recruitment, consistent with activation, confirming that chromatin remodeling, through SAGA function, plays a role in NCR-sensitive gene derepression.

Differences in GATA and Ada1 requirements for NCR-sensitive gene expression

Before investigating the impact of SAGA on NCR-sensitive gene expression in chosen conditions, we have analyzed the expression of four deeply characterized NCR-sensitive genes (DAL5, GAP1, GDH2 and MEP2) in ammonia-grown cells and in response to three distinct NCR-derepressing treatments (the addition of rapamycin (Rap), L-methionine sulfoximine (Msx) or a transfer to proline as sole nitrogen source). The expression of the four NCR-sensitive genes was analyzed in wild type cells and in the absence of one or both the GATA transcriptional activators, Gln3 and Gat1 (Fig. 1). Wild type cells derepressed all four NCR-sensitive genes in response to the three stimuli, but with varying degrees: GAP1 and MEP2 were induced at similar levels irrespective of the derepressing stimulus whereas DAL5 was far less sensitive to Msx and GDH2 to Rap. All four genes required at least one of the GATA activators: their expression was fully abolished in the double gln3Δ gat1Δ mutant. Gat1 was largely dispensable for derepression when Gln3 was present, except when DAL5 expression was considered. In the absence of Gln3, however, Gat1 was required for GAP1 and MEP2 derepression. Finally, responses elicited by an Msx treatment more often relied on Gln3 only (in Msx-treated cells, for GAP1, GDH2 and MEP2 expression), and deleting GAT1 even seemed to increase Msx-induced derepression, suggesting that it could play a negative role in these conditions.

All in all, we have selected two of these four NCR genes with one condition that allowed for elevated gene transcription. Therefore, in the context of this report, yeast cells will be grown in defined culture medium with ammonia as sole nitrogen source. First, DAL5 derepression will be analyzed after treating exponentially growing cells with rapamycin, an inducing condition that requires both Gat1 and Gln3. Second, GDH2 expression will be assayed in response to a methionine sulfoximine (Msx) treatment, a condition that requires only Gln3, and for which Gat1 could play a negative role. We have characterized DAL5 and GDH2 expression in wild type and cells lacking Ada1 only or in combination with the deletion of GLN3 or GAT1 (Fig. 2). Single deletion of ADA1 decreased DAL5 expression upon rapamycin treatment to levels reached by the single GATA gene deletions, whereas any double deletion much more drastically impaired it (Fig. 2A). GDH2 derepression in response to Msx was strongly impacted by the deletion of ADA1 (Fig. 2B), irrespective of the presence of Gat1. From these observations, we conclude that the involvement of Ada1 appears similar on both genes in the conditions assayed and is synergistic with the GATA factors.

Differences in SAGA modules requirements

To determine the involvement of each of the SAGA modules on NCR-sensitive gene expression, we have analyzed the impact of deleting the genes coding for some of their representative members: ADA1 and SPT7 for the CORE module, GCN5 and SGF79 for the HAT module, UBP8 and SGF73 for the DUB module, SPT3 and SPT8 for the TBP module. DAL5 and GDH2 expression was monitored after Rap or Msx treatment, respectively, in each of the single mutants (Fig. 3). As a control experiment, the expression of VTC3 and BDF2, was analyzed in all mutants. Both genes required SAGA for maximal expression, and BDF2 expression did not require the HAT and DUB modules nor Spt3 (Supp. Figure 1).

When Rap-induced DAL5 expression was analyzed (Fig. 3A), CORE module deletions had the strongest effect (two- to five-fold reduction compared to wild type), DUB and TBP deletions had a reduced impact (less than twofold) and HAT had no influence. Combining SPT3 and SPT8 deletions had no additive effect on DAL5 expression compared to the respective single mutants. Deleting SAGA modules had no impact on Msx-induced GDH2 expression, apart from CORE module elements (Fig. 3B).

Altogether, these observations suggest that regulating the expression of NCR-sensitive genes by coactivators has gene and nitrogen source specificities. We can also hypothesize that each of the catalytic activities of the SAGA complex could play a complementary role on the transcriptional activation of the NCR-sensitive genes, which could explain that only the deletion of the structural subunit of the SAGA complex generates a strong effect on their expression.

Similar recruitment of the CORE and TBP modules at NCR-sensitive modules

Aiming at determining if the expression consequences of deleting SAGA modules are explained by differences in recruitment at the respective promoters, we assayed the recruitment of Ada1 (CORE) and Spt8 (TBP) in wild type and in cells lacking one of the GATA activators (Fig. 4).

At the DAL5 promoter (Fig. 4A-B), binding of Ada1 and Spt8 was strongly induced by rapamycin and severely affected in the single GATA mutants. At the GDH2 promoter (Fig. 4C-D), Ada1 and Spt8 binding was strongly induced by Msx, but only affected by a GLN3 deletion.

From these observations, we conclude that the binding of Ada1 and Spt8 are NCR-sensitive, and their profiles were largely similar to each other for the two promoters tested. Moreover, the requirement of the GATA activators for this binding depends on the gene and the nitrogen source considered. It nicely paralleled the expression levels, correlating with the dependence of the expression of DAL5 and GDH2 towards the GATA activators.

Integrity of the CORE is required to allow the remaining CORE recruitment

Given the importance of the impact of deleting one CORE component on NCR-sensitive gene expression, we wanted to determine if deleting one component of the CORE could comprise the integrity of the remaining CORE complex, and hence recruitment of the whole SAGA complex, at NCR-sensitive promoters. Therefore, we assayed the recruitment of Ada1 in cells lacking Spt7 and vice versa (Fig. 5).

In cells, lacking SPT7, Ada1 binding was not observed in response to Rap (Fig. 5A) or Msx (Fig. 5C). Similarly, in cells lacking ADA1, derepressed Spt7 binding was abolished at the DAL5 (Fig. 5B) and GDH2 (Fig. 5D) promoters.

These results indicate a strong interdependence of CORE elements towards one another, suggesting that the SAGA CORE module must be recruited at NCR-sensitive promoters as a whole. Interestingly, Spt7 binding levels were twice higher than those of Ada1.

Promoter-specific requirements of CORE integrity for GATA factor recruitment

To go further in our analysis, we aimed at determining if SAGA integrity was required for GATA factor recruitment at NCR-sensitive promoters. Gat1 and Gln3 binding were assayed in wild type cells and in mutants lacking either Ada1 or the other GATA activator (Fig. 6).

At the DAL5 promoter, Ada1 was required for Rap-induced Gat1 binding but not for Gln3 binding (Fig. 6A-B)). Also, as previously shown (ref), Gat1 and Gln3 binding were strongly interdependent at the DAL5 promoter. At the GDH2 promoter, deleting ADA1 only slightly affected Gln3 and Gat1 binding (Fig. 6C-D). Further, Gln3 binding was very robust: it did not require Gat1. On the contrary, Gat1 binding was largely Gln3-dependent.

This paper provides a thorough illustration of the gene, GATA activator and inducer specificities among NCR responses. Earlier reports have given some possible explanations to these observations. First, the promoter architecture, the number and orientation of GATA sites likely influence the way how an NCR-sensitive gene responds to a particular stimulus ^34–36. It has been recognized that in some cases, auxiliary promoter sequences were shown to contribute to transcriptional activation ³⁷, although this was never as efficient as additional GATA sites ³⁸. Second, we cannot neglect the impact of the two other GATA factors on NCR-sensitive transcription, the Dal80 and Gzf3 repressors ^39–42. Under limiting nitrogen conditions, DAL80 is highly induced ⁴⁰, and Gzf3 has been detected at NCR-sensitive promoters ⁴³. Given the elevated sequence conservation among the four yeast GATA factors, with 100% conservation of the residues involved in contacts with DNA ⁴⁴, it is very likely that the repressors do bind the exact same DNA sequences in vivo and may interfere with the GATA activators, in a gene-specific manner. Third, we have previously shown that Gln3 and Gat1 localizations are controlled by two different regulatory pathways, with Gln3 localization predominantly responding to intracellular nitrogen levels, and Gat1 localization mainly responding to rapamycin ⁴⁵, suggesting that the different stimuli do not borrow the same signalization cascades. Differences of GATA activator requirements for the transcriptional responses to different activation signals can therefore be anticipated.

This paper also provides a deep characterization of the role of the SAGA complex controlling DAL5 and GDH2 expression, together with the GATA activators. In wild type cells, elevated binding of both GATA activators and SAGA ensure maximal activation of DAL5 upon rapamycin treatment. The HAT module is dispensable here. In the absence of Ada1, DAL5 expression is strongly reduced despite the presence of Gln3 at the promoter, probably because SAGA is not recruited in this CORE mutant. Interestingly, the absence of SAGA prevents Gat1 recruitment at the DAL5 promoter. Low expression of DAL5 is also observed in cells lacking Gat1 or Gln3, in which recruitment of the other GATA activator to the DAL5 promoter is largely impaired, as well as the SAGA complex. DAL5 activation is nevertheless significant in all three single mutants, though, and this could be attributed to a binding of the GATA activators and/or SAGA subunits so weak that it escaped our detection. Since DAL5 expression is abolished in the double gln3Δ ada1Δ and gat1Δ ada1Δ mutants, we propose that SAGA is indeed recruited even though we could not detect it in the gln3Δ and gat1Δ single mutants. Since Gln3 binding can occur without SAGA, which is not the case for Gat1 binding, we propose that SAGA could be a better coactivator for Gat1-dependent transcriptional activation. Accordingly, Gln3 could be co-recruited with Gat1, leading to SAGA recruitment, allowing chromatin remodelling, thereby increasing Gat1 binding and subsequent transcription. Interdependence for binding suggest the existence of synergistic interferences between the different partners at the DAL5 promoter upon rapamycin treatment.

As far as GDH2 is concerned, the conclusions are clearly different. GDH2 expression is maximal in wild type cells treated with methionine sulfoximine, consistent with maximal GATA factor and SAGA subunit binding. Interestingly, this expression does not require Gat1, even though the activator is detected at the GDH2 promoter at elevated levels. Consistently, Gln3 and SAGA still bound at the GDH2 promoter in gat1Δ cells, ensuring elevated GDH2 transcription levels. The activation levels were even higher in gat1Δ mutant cells, and this could be due to Gat1 being negatively interfering with Gln3 transcription activation, more potent. Alternatively, increased GDH2 expression in gat1Δ cells could be explained by the decreased presence of the Gat1-dependent Dal80 negative regulator. In the absence of Gln3, nor Gat1 nor SAGA could be recruited at the GDH2 promoter, consistent with the lack of activation in gln3Δ mutant cells. Finally, in ada1Δ cells, binding of the GATA factors was only weakly altered, with much lower activation in the mutant cells, suggesting that SAGA is not mainly needed for GATA factor recruitment but most strongly for transcription activation. In sum, Msx-induced Gln3 binding at the GDH2 promoter can occur on its own, allowing for concomitant Gat1 and SAGA recruitment. Gat1 recruitment is ineffective for GDH2 activation whereas that of SAGA is crucial.

In this work, we have demonstrated an absolute interdependence for rapamycin-induced GATA activator binding at the DAL5 promoter. This has not always been the case. Our previous reports have shown that rapamycin-induced Gat1 binding at the DAL5 promoter could occur in the absence of Gln3, in both TB ¹⁴ and FY ¹⁵ genetic backgrounds. In these experiments, however, cells were grown with glutamine as the nitrogen source whereas they were grown with ammonia in the present work. Such a difference is striking and suggests that much more complexity is to be expected in the context of nitrogen source-specific regulations of NCR-sensitive genes.

Our work has demonstrated that SAGA subunits are recruited to NCR-sensitive promoters upon derepression. The SAGA CORE module is structurally made of a histone octamer-like fold and an adjacent submodule (Taf5, 6 and Spt20³²). The octamer-like domain is made of three pairs of subunits (Taf6-Taf9, Taf10-Spt7 and Taf12-Ada1), each pair contributing to two histone folds, plus Spt3, which brings two more histone folds on its own ⁴⁶. In our experiments, the strongest phenotypes with respect to NCR-sensitive transcription in SAGA mutants have been observed in the ada1Δ and spt7Δ mutant strains. This observation is consistent with the fact that Ada1 and Spt7 belong to the CORE of SAGA and their absence has previously been shown to fully impair SAGA complex integrity ⁴⁷⁻⁴⁹. Consistently, Ada1 and Spt7 recruitment at NCR-sensitive genes was fully interdependent. In addition, our observation that Spt7 ChIP levels were systematically twice higher than those of Ada1 could indicate a better accessibility of the former. Indeed, from the published structure of SAGA, Ada1 could be less accessible, interfacing the CORE module with the large Tra1 subunit and the DUB module, whereas Spt7’s position appears more peripheral ⁴⁶.

Interestingly, the HAT module was fully dispensable for NCR-sensitive gene transcription, whereas the DUB module was only mildly required, for rapamycin-induced DAL5 expression only. This could indicate that SAGA modules fulfil complementary activities at NCR-sensitive promoters, and altering only one of these activities may not alter its capacity to mediate transcriptional activation. More surprisingly, the reduced impact, on NCR-sensitive transcription, of the joint deletion of SPT3 and SPT8, supposedly altering TBP recruitment suggests that other coactivator complexes may help for its recruitment, or that GATA activators can perform this function themselves.

Our results illustrate the complexity and interactions taking place at NCR-sensitive promoters, enabling fine-tuned responses to environmental changes. Further work will be required to decipher all mechanisms involved in gene- and stimulus-specific transcriptional responses of NCR-sensitive genes.

Media and strain cultivation

Yeast cells were grown at 29°C to mid-log phase (A_660nm = 0.5) in YNB containing 2% glucose and 80mM ammonium (Am) and sampled at mid-exponential phase. Auxotrophic requirements were covered 25µg/mL^− 1 of histidine, uracil and/or tryptophane. Where indicated, exponentially-growing cells were treated with final concentrations of 200 ng/ml rapamycin (Rap; LC laboratories; dissolved in 10% Tween 20 + 90% ethanol) or 2 mM L-methionine sulfoximine (Msx; Sigma Aldrich; freshly dissolved in water) for 30 minutes, or transferred after filtration and rinsing to 0.1% (w/v) proline-containing YNB medium for one hour.

Strain construction

The strains used in this work are isogenic to S288C and listed in Table 1.

Table 1

List of strains used in this work.
Strain	Pertinent genotype	Parent	Primers	Reference
25T0b	WT (wild type)			Georis et al. 2011
03740c	gln3Δ GAT1-MYC¹³			Georis et al. 2009
FV022	gln3Δ			Georis et al. 2009
FV023	gat1Δ			Georis et al. 2009
FV024	gln3Δ gat1Δ			Georis et al. 2009
FV034	GAT1-MYC¹³			Georis et al. 2009
FV036	GLN3-MYC¹³			Georis et al. 2009
FV041	gat1Δ GLN3-MYC¹³			Georis et al. 2009
FV156	gat1Δ	25T0b	GAT1 L1-4	Georis et al. 2009
FV530	ADA1-HA³	25T0b	ADA1-TAG-F; ADA1-TAG-R
FV531	ada1Δ	25T0b	ADA1 L1-4
FV547	ada1Δ GAT1-MYC¹³	FV034	ADA1 L1-4
FV578	gln3Δ ADA1-HA³	FV022	ADA1-TAG-F; ADA1-TAG-R
FV579	gat1Δ ADA1-HA³	FV023	ADA1-TAG-F; ADA1-TAG-R
FV580	gln3Δ gat1Δ ADA1-HA³	FV024	ADA1-TAG-F; ADA1-TAG-R
FV598	gcn5Δ	25T0b	GCN5 L1-4
FV635	ubp8Δ	25T0b	UBP8 L1-4
FV636	spt3Δ	25T0b	SPT3 L1-4
FV637	spt8Δ	25T0b	SPT8 L1-4
FV645	gln3Δ ada1Δ	FV022	ADA1 L1-4
FV646	gat1Δ ada1Δ	FV156	ADA1 L1-4
FV656	spt3Δ spt8Δ	FV637	SPT3 L1-4
FV659	spt7Δ	25T0b	SPT7 L1-4
FV687	spt7Δ ADA1-HA³	FV659	ADA1-TAG-F; ADA1-TAG-R
FV754	gln3Δ SPT8-HA³	FV022	SPT8-TAG-F; SPT8-TAG-R
FV755	gat1Δ SPT8-HA³	FV023	SPT8-TAG-F; SPT8-TAG-R
FV815	sgf29Δ	25T0b	SGF29 L1-4
FV817	sgf73Δ	25T0b	SGF73 L1-4
FV1256	SPT7-HA³	25T0b	SPT7-TAG-F; SPT7-TAG-R
FV1257	ada1Δ SPT7-HA³	FV1256	ADA1 L1-4

Strain tagging constructions were carried out using the short flanking homology ⁵⁰ and genes were deleted by the insertion of kanMX or natMX cassettes that constructed using the long flanking homology strategy ⁵¹. Primers sequences used for gene tagging and deletions are given in Table 2.

Table 2

List of oligonucleotides used in this work for strain constructions.
Name	Sequence (5' to 3')
ADA1 L1	GCTGTAATTCCCGCCCATTT
ADA1 L2	GGGGATCCGTCGACCTGCAGCCATGATAGAAGAAATCAAA
ADA1 L3	CGAGCTCGAATTCATCGATGATGATGTATAAAAAGTGTGT
ADA1 L4	CCGTACCGGTGGACTTTTAT
ADA1-TAG-F	TGAATTAAATTGGTTAATTAAAGGAATCTTAACGGAAGATCGGATCCCCGGGTTAATTAA
ADA1-TAG-R	TAATTACAACATACCGCATACACACACTTTTTATACATCAGAATTCGAGCTCGTTTAAAC
GCN5 L1	TGTAGTGCGCTGTATGGA
GCN5 L2	TTAATTAACCCGGGGATCCGCTAATGTAGAATACGAACCTGAGTTAACTGAAG
GCN5 L3	GTTTAAACGAGCTCGAATTCTGCGTAGAAGAAGCTTTTCCGCTACTAT
GCN5 L4	AAGCCATTGGTTCAGGCTCTGAAG
SGF73 L1	AGGCGTGCTTCAGCATATGGAT
SGF73 L2	CAAGCTAAACAGATCTGGCGCGCCTTAATTAACCCGGGGATCCGTTTAGCTCTTTACTCTTTT
SGF73 L3	TTCGATACTAACGCCGCCATCCAGTTTAAACGAGCTCGAATTCTTGAATCATGCACGTTATCCAG
SGF73 L4	ACCCAATAATCCATGGCCCTTCCT
SGF29 L1	TGTGGAGTTGTCTGCAAAACCC
SGF29 L2	CAAGCTAAACAGATCTGGCGCGCCTTAATTAACCCGGGGATCCGAATAAGAAAGGTGACCGTGTGT
SGF29 L3	TCGATTCGATACTAACGCCGCCATCCAGTTTAAACGAGCTCGAATTCCAATGGTGGTTAACATTTACTAC
SGF29 L4	CCCTCTGAATGATCTGCTTCCTC
SPT3 L1	ACTCTGATGCCGTTCACACCAA
SPT3 L2	GATCTGGCGCGCCTTAATTAACCCGGGGATCCGTCCTGCCCTAATCTCTTGAATTTTGGC
SPT3 L3	GATACTAACGCCGCCATCCAGTTTAAACGAGCTCGAATTCATTTTTGTATAATTTCATCAT
SPT3 L4	GACAACTTCCTGTTTGCCTCTTG
SPT7 L1	AAATTGGTCAAATGCTGGCCAGC
SPT7 L2	GCTAAACagatctGGCGCGCCTTAATTAACCCGGGGATCCGTATTCAGACTTAATTTCTTTGTA
SPT7 L3	TCGATTCGATACTAACGCCGCCATCCAgtttaaacGAGCTCGAATTCTGAGCGCGCTAAATAGTTGA
SPT7 L4	CAGCTACGTTTGCGAGTGCATA
SPT7-TAG-F	CAATAGTTCATTTAGCTTGAGCCTTCCTCGCCTTAATCAACGGATCCCCGGGTTAATTAA
SPT7-TAG-R	TTTAATTAAAGATAAAATATTCAACTATTTAGCGCGCTCAGAATTCGAGCTCGTTTAAAC
SPT8 L1	GCGATGTTTCTTTCGACCGTTAC
SPT8 L2	GATCTGGCGCGCCTTAATTAACCCGGGGATCCGTACGTAAAAGAAGAAA
SPT8 L3	GATACTAACGCCGCCATCCAGTTTAAACGAGCTCGAATTCTGAGTTGTAATAATAATCATA
SPT8 L4	GCAACTAACTCGTCACTAGACACA
SPT8-TAG-F	GACACGACCCTTATTTACGATATAGACTTAGAACGGATCCCCGGGTTAATTAACAT
SPT8-TAG-R	GATTATGGTTATGATTATTATTACAACTCACTAGAATTCGAGCTCGTTTAAAC
UBP8 L1	GGGAAATTCATTGGGTGCTGTTGG
UBP8 L2	GATCTGGCGCGCCTTAATTAACCCGGGGATCCGAATTATTAATAACAAATA
UBP8 L3	CGCCATCCAGTTTAAACGAGCTCGAATTCTTCAGCAAATAGCATTCAA
UBP8 L4	ATAACCAAGGGCTTGCCTTCG

Quantitative RT-PCR analysis

Quantitative RT-PCR was performed as described previously ⁴³. Total RNA was extracted from 4-ml cultures and cDNA was generated from 100 to 500 ng of total RNA using a Thermo Scientific™ RevertAid RT Reverse Transcription Kit using the manufacturer's recommended protocol. Purified cDNAs were subsequently quantified by RT-PCR using the FastStart Essential DNA Green Master mix from Roche, on a Roche LC96 instrument.

Chromatin immunoprecipitation

Cell extracts and chromatin immunoprecipitations were conducted as described previously ⁵² using primers described previously ^8,53.

ACKNOWLEDGEMENTS

This work was supported by the Commission Communautaire Française (COCOF; E.D., F.V., and I.G.), the Fonds de la Recherche Fondamentale Collective (FRFC 2.4547.11; E.D and I.G.). A.R. was a FRIA Research Fellow (Fonds pour la Formation à la Recherche dans l'Industrie et dans l'Agriculture).

AUTHOR CONTRIBUTIONS

I.G, A.R. and E.D. conceived the study and designed the experiments. F.V. and A.R. performed the experiments. I.G, A.R. and E.D. analyzed the data. I.G. and E.D. wrote the manuscript. All authors read and approved the final manuscript.

COMPETING INTERESTS

The authors declare no competing interests.

DATA AVAILABILITY STATEMENT

The datasets used and/or analysed during the current study available from the corresponding author on reasonable request.

Godard, P. et al. Effect of 21 Different Nitrogen Sources on Global Gene Expression in the Yeast Saccharomyces cerevisiae. Mol. Cell. Biol. 27, 3065–3086 (2007).
Airoldi, E. M. et al. Steady-state and dynamic gene expression programs in Saccharomyces cerevisiae in response to variation in environmental nitrogen. Mol. Biol. Cell 27, 1–38 (2016).
Scherens, B., Feller, A., Vierendeels, F., Messenguy, F. & Dubois, E. Identification of direct and indirect targets of the Gln3 and Gat1 activators by transcriptional profiling in response to nitrogen availability in the short and long term. FEMS Yeast Res. 6, 777–791 (2006).
Boer, V. M., De Winde, J. H., Pronk, J. T. & Piper, M. D. W. The genome-wide transcriptional responses of Saccharomyces cerevisiae grown on glucose in aerobic chemostat cultures limited for carbon, nitrogen, phosphorus, or sulfur. J. Biol. Chem. 278, 3265–3274 (2003).
Boer, V. M. et al. Transcriptional responses of Saccharomyces cerevisiae to preferred and nonpreferred nitrogen sources in glucose-limited chemostat cultures. FEMS Yeast Res. 7, 604–620 (2007).
Beck, T. & Hall, M. N. The TOR signalling pathway controls nuclear localization of nutrient-regulated transcription factors. Nature 402, 689–692 (1999).
Crespo, J. L. & Hall, M. N. Elucidating TOR Signaling and Rapamycin Action: Lessons from Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev. 66, 579–591 (2002).
Georis, I., Tate, J. J., Cooper, T. G. & Dubois, E. Nitrogen-responsive regulation of GATA protein family activators Gln3 and Gat1 occurs by two distinct pathways, one inhibited by rapamycin and the other by methionine sulfoximine. J. Biol. Chem. 286, 44897–44912 (2011).
Coffman, J. A., Rai, R., Cunningham, T., Svetlov, V. & Cooper, T. G. Gat1p, a GATA family protein whose production is sensitive to nitrogen catabolite repression, participates in transcriptional activation of nitrogen-catabolic genes in Saccharomyces cerevisiae. Mol. Cell. Biol. 16, 847–858 (1996).
Mitchell, A. P. & Magasanik, B. Regulation of glutamine-repressible gene products by the GLN3 function in Saccharomyces cerevisiae. Mol. Cell. Biol. 4, 2758–2766 (1984).
Minehart, P. L. & Magasanik, B. Sequence and expression of GLN3, a positive nitrogen regulatory gene of Saccharomyces cerevisiae encoding a protein with a putative zinc finger DNA-binding domain. Mol. Cell. Biol. 11, 6216–6228 (1991).
Cox, K. et al. Saccharomyces cerevisiae GATA sequences function as TATA elements during nitrogen catabolite repression and when Gln3p is excluded from the nucleus by overproduction of Ure2p. J. Biol. Chem. 275, 17611–17618 (2000).
Courchesne, W. E. & Magasanik, B. Regulation of nitrogen assimilation in Saccharomyces cerevisiae: roles of the URE2 and GLN3 genes. J. Bacteriol. 170, 708–713 (1988).
Georis, I., Tate, J. J., Cooper, T. G. & Dubois, E. Tor pathway control of the nitrogen-responsive DAL5 gene bifurcates at the level of Gln3 and Gat1 regulation in Saccharomyces cerevisiae. J. Biol. Chem. 283, 8919–8929 (2008).
Georis, I., Feller, A., Tate, J. J., Cooper, T. G. & Dubois, E. Nitrogen catabolite repression-sensitive transcription as a readout of Tor pathway regulation: The genetic background, reporter gene and GATA factor assayed determine the outcomes. Genetics 181, 861–874 (2009).
Cosma, M. P., Tanaka, T. & Nasmyth, K. Ordered recruitment of transcription and chromatin remodeling factors to a cell cycle- and developmentally regulated promoter. Cell 97, 299–311 (1999).
Hahn, S. & Young, E. T. Transcriptional regulation in saccharomyces cerevisiae: Transcription factor regulation and function, mechanisms of initiation, and roles of activators and coactivators. Genetics 189, 705–736 (2011).
Chen, H. & Pugh, B. F. What do Transcription Factors Interact With? J. Mol. Biol. 433, 166883 (2021).
Cairns, B. R. The logic of chromatin architecture and remodelling at promoters. Nature 461, 193–198 (2009).
Jiang, C. & Pugh, B. F. Nucleosome positioning and gene regulation: advances through genomics. Nat. Rev. Genet. 10, 161–172 (2009).
Helmlinger, D. & Tora, L. Sharing the SAGA. Trends Biochem. Sci. 42, 850–861 (2017).
Lee, T. I. et al. Redundant roles for the TFIID and SAGA complexes in global transcription. Nature 405, 701–704 (2000).
Huisinga, K. L. & Pugh, B. F. A genome-wide housekeeping role for TFIID and a highly regulated stress-related role for SAGA in Saccharomyces cerevisiae. Mol. Cell 13, 573–585 (2004).
Berger, S. L. et al. Genetic isolation of ADA2: A potential transcriptional adaptor required for function of certain acidic activation domains. Cell 70, 251–265 (1992).
Winston, F., Chaleff, D. T., Valent, B. & Fink, G. R. Mutations affecting Ty-mediated expression of the HIS4 gene of Saccharomyces cerevisiae. Genetics 107, 179–197 (1984).
Grant, P. A. et al. Yeast Gcn5 functions in two multisubunit complexes to acetylate nucleosomal histones: Characterization of an ada complex and the saga (spt/ada) complex. Genes Dev. 11, 1640–1650 (1997).
Rodriguez-Navarro, S. Insights into SAGA function during gene expression. EMBO Rep. 10, 843–850 (2009).
Koutelou, E., Hirsch, C. L. & Dent, S. Y. R. Multiple faces of the SAGA complex. Curr. Opin. Cell Biol. 22, 374–382 (2010).
Nagy, Z. & Tora, L. Distinct GCN5/PCAF-containing complexes function as co-activators and are involved in transcription factor and global histone acetylation. Oncogene 26, 5341–5357 (2007).
Spedale, G., Timmers, H. T. M. & Pijnappel, W. W. M. P. ATAC-king the complexity of SAGA during evolution. Genes Dev. 26, 527–541 (2012).
Grant, P. A., Winston, F. & Berger, S. L. The biochemical and genetic discovery of the SAGA complex. Biochim. Biophys. Acta - Gene Regul. Mech. 1864, 1–24 (2021).
Wang, H. et al. Structure of the transcription coactivator SAGA. Nature 577, 717–720 (2020).
Soussi-Boudekou, S. & André, B. A co-activator of nitrogen-regulated transcription in Saccharomyces cerevisiae. Mol. Microbiol. 31, 753–762 (1999).
Bysani, N., Daugherty, J. R. & Cooper, T. G. Saturation mutagenesis of the UAS(NTR) (GATAA) responsible for nitrogen catabolite repression-sensitive transcriptional activation of the allantoin pathway genes in Saccharomyces cerevisiae. J. Bacteriol. 173, 4977–4982 (1991).
Cooper, T. G., Rai, R. & Yoo, H. S. Requirement of upstream activation sequences for nitrogen catabolite repression of the allantoin system genes in Saccharomyces cerevisiae. Mol. Cell. Biol. 9, 5440–5444 (1989).
Rai, R., Genbauffe, F. S., Sumrada, R. A. & Cooper, T. G. Identification of sequences responsible for transcriptional activation of the allantoate permease gene in Saccharomyces cerevisiae. Mol. Cell. Biol. 9, 602–8 (1989).
Miller, S. M. & Magasanik, B. Role of the complex upstream region of the GDH2 gene in nitrogen regulation of the NAD-linked glutamate dehydrogenase in Saccharomyces cerevisiae. Mol. Cell. Biol. 11, 6229–47 (1991).
Minehart, P. L. & Magasanik, B. Sequence of the GLN1 gene of Saccharomyces cerevisiae: Role of the upstream region in regulation of glutamine synthetase expression. J. Bacteriol. (1992) doi:10.1128/jb.174.6.1828-1836.1992.
Coornaert, D., Vissers, S., Andre, B. & Grenson, M. The UGA43 negative regulatory gene of Saccharomyces cerevisiae contains both a GATA-1 type zinc finger and a putative leucine zipper. Curr. Genet. 21, 301–307 (1992).
Cunningham, T. S. & Cooper, T. G. Expression of the DAL80 gene, whose product is homologous to the GATA factors and is a negative regulator of multiple nitrogen catabolic genes in Saccharomyces cerevisiae, is sensitive to nitrogen catabolite repression. Mol. Cell. Biol. 11, 6205–15. (1991).
Rowen, D. W., Esiobu, N. & Magasanik, B. Role of GATA factor Nil2p in nitrogen regulation of gene expression in Saccharomyces cerevisiae. J. Bacteriol. 179, 3761–3766 (1997).
Soussi-Boudekou, S., Vissers, S., Urrestarazu, A., Jauniaux, J. C. & André, B. Gzf3P, a fourth GATA factor involved in nitrogen-regulated transcription in Saccharomyces cerevisiae. Mol. Microbiol. 23, 1157–1168 (1997).
Georis, I., Feller, A., Vierendeels, F. & Dubois, E. The Yeast GATA Factor Gat1 Occupies a Central Position in Nitrogen Catabolite Repression-Sensitive Gene Activation. Mol. Cell. Biol. 29, 3803–3815 (2009).
Ravagnani, A. et al. Subtle hydrophobic interactions between the seventh residue of the zinc finger loop and the first base of an HGATAR sequence determine promoter-specific recognition by the Aspergillus nidulans GATA factor AreA. EMBO J. 16, 3974–3986 (1997).
Tate, J. J., Georis, I., Dubois, E. & Cooper, T. G. Distinct phosphatase requirements and GATA factor responses to nitrogen catabolite repression and rapamycin treatment in Saccharomyces cerevisiae. J. Biol. Chem. 285, 17880–17895 (2010).
Green, R. et al. Metabolic excretion associated with nutrient–growth dysregulation promotes the rapid evolution of an overt metabolic defect. PLoS Biology vol. 18 (2020).
Sterner, D. E. et al. Functional organization of the yeast SAGA complex: distinct components involved in structural integrity, nucleosome acetylation, and TATA-binding protein interaction. Mol. Cell. Biol. 19, 86–98 (1999).
Wu, P.-Y. J. & Winston, F. Analysis of Spt7 function in the Saccharomyces cerevisiae SAGA coactivator complex. Mol. Cell. Biol. 22, 5367–5379 (2002).
Nuño-Cabanes, C. et al. SAGA-CORE subunit Spt7 is required for correct Ubp8 localization, chromatin association and deubiquitinase activity. Epigenetics Chromatin 13, 46 (2020).
Longtine, M. S. et al. Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast 14, 953–961 (1998).
Wach, A. PCR-synthesis of marker cassettes with long flanking homology regions for gene disruptions in S. cerevisiae. Yeast 12, 259–265 (1996).
Ronsmans, A. et al. Transcription-dependent spreading of the Dal80 yeast GATA factor across the body of highly expressed genes. PLoS Genet. 15, (2019).
Georis, I., Tate, J. J., Cooper, T. G. & Dubois, E. Tor pathway control of the nitrogen-responsive DAL5 gene bifurcates at the level of Gln3 and Gat1 regulation in Saccharomyces cerevisiae. J. Biol. Chem. 283, (2008).

No competing interests reported.

SuppFig.pptx

Download PDF

Version 1

posted

You are reading this latest preprint version

Differing SAGA module requirements for NCR-sensitive gene transcription in yeast

Status:

Version 1

Abstract

Figures

Introduction

Results

Differences in GATA and Ada1 requirements for NCR-sensitive gene expression

Differences in SAGA modules requirements

Similar recruitment of the CORE and TBP modules at NCR-sensitive modules

Integrity of the CORE is required to allow the remaining CORE recruitment

Promoter-specific requirements of CORE integrity for GATA factor recruitment

Discussion

Methods

Media and strain cultivation

Strain construction

Quantitative RT-PCR analysis

Chromatin immunoprecipitation

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1