Efficiency of ribavirin to eliminate apple scar skin viroid from apple plants

Materials And Methods

Plant materials

Malus pumila 'Spy 227' infected with apple scar skin viroid (ASSVd) and apple stem grooving virus (ASGV) was grown in a test field of the Chinese Academy of Agriculture Sciences (Xingcheng, Liaoning province, China). The dormant branches of this species were collected in November 2019 and used in the experiments.

Establishment of in vitro cultures

The branches were pruned, and those with full buds were inserted into distilled water and cultured at 26°C. After 35–40 d of hydroponic culture, the sprouted shoots (approximately 1.0–1.5 cm in length) were excised, sterilized with 75% alcohol for 30 s and 0.1% mercury bichloride for 15 min, and plated on modified Murashige and Skoog (MS) medium containing 0.5 mg/L 6-benzylaminopurine (6-BA), 0.1 mg/L indol-3-yl-acetic acid (IBA), 30 g/L sucrose, and 10 g/L agar. The explants were incubated in a tissue culture room at 24°C with a 16 h photoperiod and 2000 lx light intensity. After 20–25 d, viable shoot tips were sub-cultured onto new MS medium. The presence of ASSVd and ASGV was assessed again in each surviving shoot tip. Plants positive for both viruses were propagated for further treatments.

Hydroponic culture of branches with ribavirin at different concentrations

The pruned branches were inserted into a solution of ribavirin (Sigma-Aldrich, St. Louis, MO, USA) at concentrations of 25 and 50 µg/mL (R25 and R50, respectively). The sprouted shoots were treated as described above. Virus detection was performed in surviving shoot tips.

Chemotherapy of in vitro plants with ribavirin at different concentrations

After several sub-cultures, approximately 1.0 cm (in size) shoots of in vitro apple plants were cut and transferred into MS medium containing ribavirin at 10, 20, and 30 µg/mL (R10, R20, and R30, respectively). The ribavirin solution was filter-sterilized (0.22-µm filter) before being added to the autoclaved culture medium. Six shoots were cultured per culture bottle, and each treatment consisted of 36 apple shoots. The culture conditions of the ribavirin-treated apple plants were the same as those of the normal plants. Apple plants incubated in normal MS medium were used as controls.

The growth and proliferation of apple plants under five different periods (15, 25, 35, 45, and 55 d) were observed periodically. Plant materials were collected during these periods. There were five plants per sample, and three samples were collected for each treatment per period. Approximately 1.0-mm shoot tips were excised from the apical and newly sprouted axillary shoots (≥ 5 mm) at 35, 45, and 55 d of treatment. All shoot tips were separated and cultured on newly prepared MS medium. Viruses were detected by qPCR after four sub-culturing cycles. The efficiencies of the virus were determined by the number of virus-free plants/number of detected shoots.

Virus detection

Total RNA was extracted from apple plants using the method described by Fan et al. (2015). First-strand cDNA was synthesized using M-MLV reverse transcriptase (Promega, Madison, WI, USA). Quantitative real-time PCR (qPCR) was performed using a PrimeScript™ RT reagent kit with gDNA Eraser Perfect Real Time and TB Green® Premix Ex Taq™ (Tli RNaseH Plus) (TaKaRa). The ΔCt method was used to calculate the relative ASSVd and ASGV concentrations. All primers used were listed in Table 1.

Table 1

Primers used for detecting apple scar skin viroid (ASSVd) and apple stem grooving virus (ASGV)
Virus	Primers	Sequences (5’-3’)	Size (bp)	References
ASGV	C6396	CTGCAAGACCGCGACCAAGTTT	524	Clover et al. 2003
ASGV	H5873	CCCGCTGTTGGATTTGATACACCTC		Clover et al. 2003
	GV-qF	ACAGGTGATTGATAGGATGACA	137	This study
	GV-qR	AAGACCGCGACCAAGTTTGCGGAA		This study
ASSVd	AS1	CCGGCCTTCGTCGACGACGA	330	Sipahioglu et al. 2006
ASSVd	AS3	TGAGAAAGGAGCTGCCAGCAC		Sipahioglu et al. 2006
	ASS- qF	ACACCGTGCGGTTCCTGTGGTT	121	This study
	ASS- qR	TTAGTGCTGGCAGCTCCTTTCTCA		This study
Internal control	EF- 1α-F	GAGAAGGAGCCAAAGTTCTTGA	176	Li et al. 2016
Internal control	EF- 1α-R	CCTTCTTCTCAACGCTCTTGAT	176	Li et al. 2016

Statistical analysis

Data were analyzed using factorial ANOVA with Statistica 6.0 (StatSoft Inc., Tulsa, OK, USA). The results are expressed as mean values and standard deviation (SD). Least significant differences (LSD) were calculated at P ≤ 0.05. All experiments were carried out at least in triplicate.

Results

Effects of hydroponic culture with ribavirin at different concentrations on elimination of ASGV and ASSVd

Ribavirin at concentrations of 25 and 50 µg/mL (R25 and R50) did not significantly affect bud sprouts of branches, but the survival rate of in vitro shoots treated with R25 was 25% higher than that with R50. The survival of in vitro apple plants was detected after one sub-culture. ASSVd was found in all surviving plants. The elimination rates of ASGV in apple plants after R25 and R50 hydroponic cultures were 44.5% and 50.0%, respectively (Table 2).

Table 2

Elimination efficiencies of ASSVd and ASGV in *in vitro* apple plants regenerated from hydroponic culture with ribavirin at different concentrations
Treatments	Collected shoots	Survival rate of shoots (%)	Elimination rate (%)
Treatments	Collected shoots	Survival rate of shoots (%)	ASSVd	ASGV
R25	20	45.0 (9/20)	0	44.4 (4/9)
R50	20	20.0 (4/20)	0	50.0 (2/4)
R25 and R50: chemotherapy with ribavirin at concentrations of 25 µg/mL and 50 µg/mL, respectively.

Effects of ribavirin on the growth and proliferation of in vitro apple plants

The growth rates of plants in three ribavirin treatments (10, 20, and 30 µg/mL: R10, R20, and R30) and a control (CK) showed no obvious differences for 15 d (Table 3). Significant differences in height among these treatments were observed after 25 d of treatment. The plant heights of R10, R20, and R30 were significantly higher than those of CK at 25–35 d. The heights of R20 and CK were almost the same at 45 d, and R30 showed the same trend as CK until the end of the experiment. The height of the R10 treatment was significantly greater than other treatments from 25 d until the end of the experiment. Moreover, significant height differences were also found among the three ribavirin treatments. This showed that the growth rate of in vitro plants decreased with an increase in concentration of the agent.

Ribavirin also had an obvious effect on the proliferation of treated apple plants. The proliferation of all antiviral agent-treated plants was significantly higher than that of CK plants throughout the experiment. Moreover, the proliferation of in vitro plants increased with an increase in ribavirin concentration. The growth and proliferation rates of plants for each treatment were significantly different for each growth period. There were no obvious phytotoxicity symptoms in any of the ribavirin-treated plants. At the end of experiment, some yellow or brown basal leaves were observed, and the margins of several new leaves near the bottle cap showed browning (Fig. 1). In addition, the height of plants in R10 was greater than that of other treatments, but the growth vigor of these plants was lower than that of other plants.

Table 3

Effects of ribavirin at different concentrations on the growth and proliferation of *in vitro* apple plants
Treatments^#	Duration (days)
	15		25		35		45		55
	Proliferation index^*	Shoot length (cm)	Proliferation index^*	Shoot length (cm)	Proliferation index^*	Shoot length (cm)	Proliferation index^*	Shoot length (cm)	Proliferation index^*	Shoot length (cm)
CK	0.3 ± 0.6 bD	2.64 ± 0.34 aC	1.7 ± 0.5 bC	3.16 ± 0.26 cB	1.8 ± 0.8 cC	3.35 ± 0.48 cB	2.5 ± 0.5 cB	4.62 ± 0.75 bA	3.2 ± 0.7 cA	4.79 ± 0.97 bA
R10	1.4 ± 1.0 aD	2.59 ± 0.35 aE	2.4 ± 0.6 aC	3.69 ± 0.36 aD	2.6 ± 0.8 bBC	4.36 ± 0.54 aC	3.2 ± 0.6 bB	5.35 ± 0.47 aB	4.0 ± 1.3 bA	5.72 ± 0.75 aA
R20	1.7 ± 0.9 aD	2.65 ± 0.42 aC	2.4 ± 0.7 aC	3.57 ± 0.47 abB	2.9 ± 1.2 bBC	3.67 ± 0.38 bB	3.2 ± 0.9 bB	4.26 ± 0.60 bcA	4.4 ± 1.5 bA	4.50 ± 0.82 bA
R30	1.7 ± 0.9 aE	2.78 ± 0.35 aD	2.6 ± 0.6 aD	3.43 ± 0.34 bC	3.9 ± 1.0 aC	3.76 ± 0.52 bB	4.8 ± 0.8 aB	4.09 ± 0.73 cAB	5.7 ± 1.1 aA	4.41 ± 0.60 bA
Means of length of treated shoots and proliferation index within the same column (lowercase letters, compared among treatments) or row (uppercase letters, compared among periods) followed by the same letter are not significantly different from each other at the 5% level.
^#CK: control; R10, R20, and R30: chemotherapy with ribavirin at concentrations of 10, 20, and 30 µg/mL, respectively.
^* The number of newly developed axillary shoots (≥ 5 mm) from treated plants was recorded at the end of each culture period.

Effects of ribavirin at different concentrations on the elimination of ASSVd and ASGV during treatments

The luminance of the amplified band in agarose gel was divided into five degrees, which was used to evaluate the relative content of ASSVd and ASGV during treatments (Table 4). ASSVd could be detected throughout the treatment, and the content was almost the same in each different period. The elimination efficiencies of the pathogens did not change with ribavirin concentration. The content of ASGV in R30 plants started to change at 25 d, and in the other two treatments it began to change at 35 d. The titer of ASGV decreased with the treatment duration and ribavirin concentration (Fig. 2). At the end of treatment (55 d), ASGV in some apple plants of R20 and R30 could still be detected, but the brightness of the band was weak.

Table 4

Effects of ribavirin at different concentrations on the elimination of ASSVd and ASGV during treatments
Virus	Treatments	Duration (days)
Virus	Treatments	5	15	25	35	45	55
ASSVd	R10	+++++	+++++	+++++	+++++	+++++	+++++
	R20	+++++	+++++	+++++	+++++	+++++	+++++
	R30	+++++	+++++	+++++	+++++	+++++	+++++
ASGV	R10	+++++	+++++	+++++	++++	+++	++
	R20	+++++	+++++	+++++	++++	++	+
	R30	+++++	+++++	++++	+++	++	+
+: degree of luminance for the viral amplified band in agarose gel.

Effects of ribavirin at different concentrations on the survival of regenerated apple plants

Plants in all treatments survived throughout the experiment. Suitable shoot tips (approximately 1.0 mm in size) in the main and axillary shoots (≥ 5 mm) were cut and transferred into fresh MS medium after 35, 45, and 55 d of treatment (Table 5). It takes approximately 40–50 d for the shoot tips to regenerate into plants. The regenerated plants were then sub-cultured. Survival rates were evaluated in the second sub-culture of regenerated plants. The shoot survival rate of plants regenerated from CK was 10.9% higher than that from ribavirin treatments. The concentration of ribavirin affected shoot regeneration. The average survival rate (80.8%) of R30 was similar to that of CK (82.5%) and was 14.2% and 16.3% higher than that of R10 and R20, respectively. Moreover, the survival rate of plants decreased with an increase in treatment duration. The average survival rate of plants regenerated after 35 d of treatment was 21% and 23.7% higher than that after 45 and 55 d, respectively.

Effects of ribavirin at different concentrations on the elimination of ASSVd and ASGV in regenerated apple plants

The growth rate of regenerated plants was slower in the first sub-culture; then, it was similar to that of the untreated plants in the following cultivation. The elimination rate of regenerated plants was evaluated by qPCR after three sub-cultures (Table 5). Virus-free Malus baccata (Linn.) Borkh was used as the negative control. ASSVd- and ASGV-infected ‘Qingming’ was used as the positive control, and the quantitative cycles of the two pathogens were 12.8 and 22.5, respectively. The average elimination rates of ASSVd and ASGV were 1.6% and 78.7%, respectively. R10 and R20 did not inhibit ASSVd expression. A low elimination rate of ASSVd was found in R30 at 45 d (2.8%) of treatment and, even though the rate increased with treatment period, the rate was still less than 10% at the end of treatment. The efficiency of ASGV eradication depended on the duration and concentration of ribavirin treatment. The average elimination rates of ASGV in plants regenerated from 35, 45, and 55 d of treatment were 72.8%, 79.6%, and 85.0%, respectively. The average rates of ASGV in R10, R20, and R30 were 68.9%, 81.4%, and 82.9%, respectively. The elimination rate of ASGV in R20 for the three time points was close to that in R30, and the difference between the two treatments was approximately 2%. The difference between R10 and the first two treatments was 13.6–16.5% at 35–45 d of treatment and reduced to 6.8–8.9% at 55 d.

Table 5

Survival and elimination rates of regenerated apple plants after chemotherapy with ribavirin at different concentrations
Treatments	Duration (days)
	35				45				55
	Shoots		Elimination rate (%)		Shoots		Elimination rate (%)		Shoots		Elimination rate (%)
	No. of dissected	Survival rate (%)	ASSVd	ASGV	No. of dissected	Survival rate (%)	ASSVd	ASGV	No. of dissected	Survival rate (%)	ASSVd	ASGV
CK	98	96.9 (95/98)	0 (0/95)	0 (0/95)	123	76.4 (94/123)	0 (0/94)	0 (0/94)	121	76.9 (93/121)	0 (0/93)	0 (0/93)
R10	125	82.4 (103/125)	0 (0/103)	62.9 (64/103)	143	61.5 (88/143)	0 (0/88)	68.2 (60/88)	133	57.1 (76/133)	0 (0/76)	78.9 (60/76)
R20	138	84.1 (116/138)	0 (0/116)	77.6 (90/116)	146	58.9 (86/146 )	0 (0/86)	82.6 (71/86)	149	51.7 (77/149)	0 (0/77)	85.7 (66/77)
R30	162	94.4 (153/162)	0 (0/153)	76.5 (117/153)	191	75.4 (144/191)	2.8 (4/144)	84.7 (122/144)	198	74.7 (148/198)	8.1 (12/148)	87.8 (130/148)

Discussion

In the 1950s, apple scar skin disease caused severe losses in apple yields in the Liaodong peninsula area of China; thousands of trees were affected, and apple sales were low (Liu et al. 1957). Currently, ASSVd can be found in many apple production areas in Shandong, Liaoning, Xinjiang, Shanxi, Inner Mongolia, Hebei, and Beijing (Hu et al. 2017). Therefore, it is important to develop effective methods to acquire ASSVd-free propagation material and prevent the spread of viroids. In this study, chemotherapy with ribavirin was used to eliminate ASSVd and ASGV in apple plants. Our results showed that there was an obvious difference in the ability of ribavirin to eradicate ASSVd and ASGV. Ribavirin did not efficiently inhibit ASSVd in apple plants regenerated from the hydroponic culture of branches. The elimination efficiency of ribavirin on in vitro apple plants was also low (less than 2%). Of the 292 regenerated plants, only 16 were ASSVd-free. Previous studies have demonstrated that ASGV is more difficult to eliminate than other apple viruses (Wang et al. 2016; Hu et al. 2019). Our experimental materials coincidentally contained ASGV, which reflected the difficulty of removing ASSVd from a certain angle. In fact, there are species-specific differences in the sensitivity of viroids to ribavirin. The elimination rate of potato spindle tuber viroid infection in potato was 77.7% with a ribavirin concentration of 30 µg/mL (Mahfouze et al. 2010). The eradication rate of hop stunt viroid (HSVd) infection in peach and pear were 33% and 35%, respectively, at a concentration of 20 µg/mL ribavirin (El-Dougdoug et al., 2010). In addition, 40% chrysanthemum stunt viroid (CSVd) was eliminated using 25 µg/mL ribavirin (Savitri et al. 2013). Our results indicated that ASSVd is insensitive to ribavirin.

In viral elimination studies, one or more methods are used together with chemotherapy to increase the eradication rate of viruses, and the same is likely true for viroids. The percentage of HSVd-free plant materials treated with 20 µg/mL ribavirin combined with cold therapy at 4°C for 1 month was 40% (El-Dougdoug et al. 2010). All regenerated chrysanthemum plants were CSVd-free after 50 µg/mL ribavirin treatment combined with cold therapy at 4°C for 3 months (Savitri et al. 2013). A combination of ribavirin with other methods could be used to achieve better elimination efficiencies of ASSVd in future studies. In addition to the traditional methods, some new methods can also be used to eradicate ASSVd from apples. Electrotherapy, leaf primordia-free shoot apical meristem culture, and somatic embryogenesis achieved good results in the elimination of viroids (Savitri et al. 2013; Hosokawa et al. 2005; Gambino et al. 2011). Moreover, Matousek et al. (2008) used the developmental expression of a pollen nuclease and specific RNAses to eradicate hop latent viroid from pollen.

Although hydroponic culture of branches with ribavirin had no affect against ASSVd, the average elimination rate of ASGV in surviving shoots was up to 46%. Meristem culture is a common viral elimination method, and its elimination rate is inversely proportional to the size of the shoot tips (Han et al. 2011). It is difficult to excise the tip from explants during experimental operations because the required meristem tip is typically small (often < 1 mm in length) and is removed by sterile dissection under a microscope (Grout 1999). The hydroponic culture of branches with ribavirin can solve this problem. In this study, we excised 1.0–1.5 cm (in size) shoots, which effectively reduced the difficulty of operation and improved the survival rate of the shoot tip. James (2010) demonstrated that the inhibition of ribavirin on viruses did not decrease with year. Therefore, the acquisition of virus-free plants using this method is feasible. Even if the virus was not eliminated during hydroponic culture, our study strongly suggests that ribavirin has an inhibitory effect on the concentration of the virus, which will be helpful for subsequent elimination treatments. The hydroponic culture of branches with ribavirin can be used as a pre-treatment before virus eradication.

Previous studies have shown that low concentrations of ribavirin (< 25 µg/mL) could enhance the growth and proliferation of pear plants but inhibit the proliferation of apple and grapevine plants (Hu et al. 2012; 2015). In this study, ribavirin increased the growth and proliferation of 'Spy 227'. This indicates that there are species differences in the sensitivity of different hosts to ribavirin. Phytotoxicity was not observed in the ribavirin-treated in vitro apple plants. Furthermore, the yellow or brown leaves appeared at the end of treatment and a weaker growth vigor of plants was observed in R10. We speculate that these were related to the nutrient concentration of the medium, which could not meet the plant growth requirements due to the long culture duration and rapid growth. In addition, the acceleration of ribavirin would be use in the isolated culture of explants, which were difficult to meristem culture.

References

Boubourakas IN, Arambatzis C, Dovas C, Kyriakopoulou PE (2008) Amelioration of a reverse transcription polymerase chain reaction (RT-PCR) for the detection of ASSVd, PBCVd and PLMVd viroids and their presence in cultivated and wild pome and stone fruits in Greece. Acta Hortic 781:519–527

Bougie I, Bisaillon M (2004) The broad spectrum antiviral nucleoside ribavirin as a substrate for a viral rna capping enzyme. J Bio Chem 279:22124–22130

Chen W, Lin L, Tien P, Liu F, Wang G, Wang H (1988) Grafting external healthy pear bud induces scar skin viroid in apple. Chin J Virol, 4: 367–370

Cieślińska M (2007) Application of thermo- and chemotherapy in vitro for eliminating some viruses infecting Prunus sp. fruit trees. J Fruit Ornam Plant Res 15:117–124

Clover GRG, Pearson MN, Elliott DR, Tang Z, Smale TE, Alexander BJR (2003) Characterization of a strain of apple stem grooving virus in Actinidia chinensis from China. Plant Pathol 52:371–378

De Fazio G, Caner J, Vicente M (1978) Inhibitory effect of virazole (Ribavirin) on the replication of tomato white necrosis virus (VNBT). Arch Virol 58:153–156

Desvignes JC, Grasseau N, Boye R, Cornaggia D, Aparicio F, Di Serio F, Flores R (1999) Biological properties of apple scar skin viroid: isolates, host range, different sensitivity of apple cultivars, elimination, and natural transmission. Plant Dis 83:768–772

El-Dougdoug KA, Osman ME, Abdelkader HS, Dawoud RA, Elbaz RM (2010) Elimination of hop stunt viroid (HSVd) from infected peach and pear plants using cold therapy and chemotherapy. Aust J Basic Applied Sci 4:54–60

Fan XD, Hong N, Dong YF, Ma YX, Zhang ZP, Ren F, Hu GJ, Zhou J, Wang GP (2015) Genetic diversity and recombination analysis of grapevine leafroll-associated virus 1 from China. Arch Virol 160:1669–1678

Flores R, Minoia S, Carbonell A, Gisel A, Delgado S, Lo’pez-Carrasco A, Navarro B, Di Serio F (2015) Viroids, the simplest RNA replicons: how they manipulate their hosts for being propagated and how their hosts react for containing the infection. Virus Res 209:136–145

Gambino G, Navarro B, Vallania R, Gribaudo I, Serio FD (2011) Somatic embryogenesis efficiently eliminates viroid infections from grapevines. Eur J Plant Pathol 130:511–519

Grout B (1999) Meristem-tip culture for propagation and virus elimination. In: Hall, R.D. (eds) Plant Cell Culture Protocols. Methods In Molecular Biology™. Humana Press, 111:115–125

Han YT, Shi XH, Yang GS, Wang XR, Liu KY, Xu F, Ni JJ (2011) Shoot tip tissue virus-free culture and RT-PCR detection of GLRaV-3 in Red globe grape. Chinese Agricultural Science Bulletin 27:198–202

Hansen AJ, Lane WD (1985) Elimination of apple chlorotic leaf spot virus from apple shoot cultures by ribavirin. Plant Dis 69:134–135

Hosokawa M, Matsushita Y, Ohishi K, Yazawa S (2005) Elimination of chrysanthemum chlorotic mottle viroid (CChMVd) recently detected in Japan by leaf-primordia free shoot apical meristem culture from infected cultivars. J Jap Soc Hortic Sci 74:386–391

Howell WE, Burgess J, Mink GI, Skrzeczkowski LJ, Zhang YP (1997) Elimination of apple fruit and bark deforming agents by heat therapy. Acta Horti 472:641–648

Hu GJ, Zhang ZP, Fan XD, Ren F, Li ZN, Dong YF (2017) Main apple viruses and research progress in China. China Fruits 71–74

Hu GJ, Dong YF, Zhang ZP, Fan XD, Ren F (2019) Elimination of apple necrosis mosaic virus from potted apple plants by thermotherapy combined with shoot-tip grafting. Sci Hortic 252:310–315

Hu GJ, Dong YF, Zhang ZP, Fan XD, Ren F, Zhou J (2015) Virus elimination from in vitro apple by thermotherapy combined with chemotherapy. Plant Cell, Tiss Org Cult 121:435–443

Hu GJ, Hong N, Wang LP, Hu HJ, Wang GP (2012) Efficacy of virus elimination from in vitro cultured sand pear (Pyrus pyrifolia) by chemotherapy combined with thermotherapy. Crop Prot 37:20–25

Hu GJ, Zhang ZP, Dong YF, Fan XD, Ren F, Zhu HJ (2015) Efficiency of virus elimination from potted apple plants by thermotherapy coupled with shoot-tip grafting. Australas Plant Pathol 44:167–173

James D (2010) Confirmation of the elimination of apple stem grooving virus from apple trees by in vitro chemotherapy. Julius-Kühn-Archiv 427:47–50

Kaponi MS, Luigi M, Barba M, Kyriakopoulou PE (2010) Molecular characterization of Hellenic variants of apple scar skin viroid and pear blister canker viroid in pome fruit trees. Julius-Kuhn-Archiv 427:366–372

Kim HR, Lee SH, Lee, DH, Kim JS, Park JW (2006) Transmission of apple scar skin viroid by grafting, using contaminated pruning equipment, and planting infected seeds. Plant Pathol J 22:63–67

Koganezawa H, Yang X, Zhu SF, Hashimoto J, Hadidi A (2003) Apple scar skin viroid in apple. In: Hadidi, A., Flores, R., Randles, J.W., and Semancik, J.S. (Eds.), Viroids. CSIRO Publishing, Collingwood, VIC, Australia, pp. 137–141

Kyriakopoulou PE, Giunchedi L, Hadidi A (2001) Peach latent mosaic and pome fruit viroids in naturally infected cultivated pear Pyrus communis and wild pear P. amygdaliformis: implications on possible origin of these viroids in the Mediterranean region. J Plant Pathol 83:51–62

Li JY, Zhang H, Han YF, Shao JZ, Sun JS (2016) Selection of reference genes for teal-time quantitative PCR in apples (Malus domestica) in vitro. J Fruit Sci 33:1033–1042

Li S, Li GX, Ying WK, Yang H, Zhang GR, Dai QD, Zhou CY, Li SF (2020) Occurrence and molecular characterization of apple scar skin viroid in malus pumila 'saiwaihong' (small apple tree) from north china. J Plant Pathol 102:899–902

Liu FC, Chen RF, Chen YX (1957) Apple scar skin disease. Science Press, Beijing, pp43

Mahfouze SA, El-Dougdoug KA, Allam EK (2010) Production of potato spindle tuber viroid-free potato plant materials in vitro. J Am Sci 6:1570–1577

Matousek J, Orctová L, Skopek J, Pesina K, Steger G (2008) Elimination of hop latent viroid upon developmental activation of pollen nucleases. Biol Chem 389:905–918

Panattoni A, D’Anna F, Cristani C, Triolo E (2007) Grapevine vitivirus A eradication in Vitis vinifera explants by antiviral drugs and thermotherapy. J Virol Methods 146:129–135

Postman JD, Hadidi A (1995) Elimination of apple scar skin viroid from pears by in vitro thermotherapy and apical meristem culture. Acta Hortic 386:536–543

Roy A, Kumar A, Walia Y, Hallan V, Ramachandran P (2017) Studies on viroids occurring in India. In A Century of Plant Virology in India. Springer, Singapore, p487–511

Savitri WD, Park KI, Jeon SM, Chung MY, Han JS, Kim CK (2013) Elimination of chrysanthemum stunt viroid (CSVd) from meristem tip culture combined with prolonged cold treatment. Hortic Environ Biote 54:177–182

Sipahioglu HM, Usta M, Ocakm M (2006) Use of dried high-phenolic laden host leaves for virus and viroid preservation and detection by PCR methods. J Virol methods 137:120–124

Skrzeczkowski LJ, Howell WE, Mink GI (1993) Correlation between leaf epinasty symptoms on two apple cultivars and results of cRNA hybridization for detection of apple scar skin viroid. Plant Dis 77:919–921

Walia Y, Dhir S, Bhadoria S, Hallan V, Zaidi AA (2012) Molecular characterization of apple scar skin viroid from Himalayan wild cherry. Forest Pathol 42:84–87

Walia Y, Dhir S, Zaidi AA, Hallan V (2015) Apple scar skin viroid naked RNA is actively transmitted by the whitefly Trialeurodes vaporariorum. RNA Biol 12:1–8

Wang MR, Li BQ, Feng CH, Wang QC (2016) Culture of shoot tips from adventitious shoots can eradicate apple stem pitting virus but fails in apple stem grooving virus. Plant Cell, Tiss Org Cult 125:283–291

Yamaguchi A, Yanase H (1976) Possible relationship between the causal agent of dapple apple and scar skin. Acta Hortic 67:249–254

Zhao Y, Niu J (2008) Apricot is a new host of apple scar skin viroid. Australas Plant Dis Notes 3:98–100

Zhao Y, Niu J (2006) Cloning and sequencing of Sinkiang isolate of apple scar skin viroid (ASSVd). J Fruit Sci 23:896–898