4.1 Materials
Poly(ε-caprolactone)-Poly(2-ethyl-2-oxazoline)-amine (PCL-PEOz-NH2, Mw 5000 Da) was purchased from Ruixibiotech (China). Psoralidin (PSO) and CCK8 were obtained from Sigma-Aldrich (US). Cy5.5-NHS and BHQ-3000S-5 was purchased from Seebio Biotech (China). N-Hydroxysuccinimide (NHS), N-(3-dimethylaminopropyl)-N’-ethylcarbodiimide hydrochloride (EDC•HCl) and N-succinimidyl-4-maleimide butyrate (GMBS) were supplied by J&K Scientific (China).
4.2 Synthesis and characterizations of MRC-PPL micelles
MMP-13/pH responsive and cartilage targeting MRC-PPL micelles was obtained by self-assembly of C-PPL and MR-PPL[28]. Specifically, a Cy5.5 labeled MMP-13 substrate with the sequence of H2N–GPLGVRGC–SH was dissolved in DMSO (15 mmol, 500 µL) followed by the addition of N-succinimidyl-4-Maleimidobutyrate (30 mmol in 100 µL DMSO) to form MR-Cy5.5. The reaction solution was incubated at room temperature for 4 h in a 1.5 mL eppendorf tube with gentle shaking. Then, to conjugate with the MMP-13 responsive peptide, EDC and NHS were added in MR-Cy5.5 solution, followed by the addition of 50 mg PPL. Subsequently, BHQ-3 was added in dark to form MR-Cy5.5-BHQ-3-PPL (MR-PPL), followed by the purification using HPLC. In parallel, WYRGRL peptide (10 mg in 100 µL DMSO) which specifically binds with collagen type II was coupled with PPL (50 mg in 100 µL DMSO) to obtain C-PPL. With addition of N, N-diisopropyl ethylamine (DIPEA, 10 µL) and overnight reaction, MRC-PPL micelles self-assembled from C-PPL and MR-PPL were finally obtained after ultrasonication and filtration through a 0.8-µm membrane.
Polymeric micelles can encapsulate drug compounds using the film hydration method [29, 30]. The PPL copolymer (10 mg) and PSO (1 mg) were dissolved in acetonitrile and then evaporated in a vacuum at 50 °C until a dry film was formed. Subsequently, 2 mL ddH2O was added and vortexed. The morphology of MRC-PPL was uncovered by a transmission electron microscope (TEM, H-7650). We used Malvern Zetasizer Nano ZS90 to measure the size distribution and zeta potential of the micelles in aqueous suspension. Absorption spectra were obtained from a microplate reader (Thermo Scientific Multiskan GO Microplate Spectrophotometer). And the fluorescence from Cy5.5 was detected using a Fluorescence spectrophotometer (RF-5301PC).
The loading capability of PSO in MRC-PPL micelles was determined using the HPLC. Briefly, Lyophilized [email protected] powder was dissolved in HCl (0.1 mol/L) and moderate methanol was added to release PSO. After the supernatant was collected by centrifugation (6000 rpm,30 minutes), the PSO concentration in the supernatant was detected by ACQ-BSM HPLC system (Waters, Milford, MA, USA).The system parameters were set to wavelength 347 nm, and the C18 analytical column (250 × 4.6 mm, 5 microns) was used at 37 °C. The mobile phase was consisted of methanol/water/0.05 M acetic acid (78/22/0.2, v/v) and the flow rate was 1.0 mL/min. The loading content (LC) of PSO were calculated according to the formula:
LC (%) = (the mass of loaded PSO / the total mass of nanoparticles) × 100%
4.3 Drug release studies
The pH-dependent release behavior of PSO from the [email protected] micelles was monitored at 37 °C. Briefly, 2 mL of the PSO-loaded micelles were placed in a dialysis bag (MWCO 3500), which was then immersed in PBS (10 mM, pH 6.5 and 7.4) containing 1% Tween 80. The release device was continuously shaken at 37 °C. Remove 1 mL of release media at predetermined intervals and immediately replace it with 1 mL of fresh media. The accumulative release amount of PSO was finally determined by HPLC.
4.4 The chondrocytes extraction and culture.
The chondrocytes was extracted from the knee joints of new born (3–5 days) C57BL6/J mice (Animal Resources Center of Guangxi Medical University, Nanning, Guangxi) after the articular cartilage were minced, digested with trypsin for 30 minutes, and digested with type II collagenase (2 mg/mL ,Gibco). Chondrocytes were cultured in Eagle medium (Gibco) containing1% (v/v) penicillin/streptomycin (Solarbio) and 10% (v/v) fetal bovine serum (Gibco). Cell experiments were constructed according to our previous work[7].
4.5 Cytotoxicity test
The cytotoxicity of different formulations to chondrocytes cells were using Cell Counting Kit-8 (CCK-8; Dojindo Laboratories, Kumamoto, Japan). Briefly, the cell at a density of 5,000 per well were seeded in 96-well plate overnight. Thereafter, [email protected] with the various amount of PSO was added and further incubated for 48 h. MRC-PPL micelles without PSO at different concentrations (0 ~ 200 µL/mL) were also tested for comparison. After treatment, 10 µL of CCK-8 were added to each well and cultivated for 4 h. Finally, the absorbance at 450 nm was measured using a microplate reader (Thermo Scientific Multiskan GO Microplate Spectrophotometer). The viability of [email protected] on the proliferation of IL-1β-induced chondrocytes was measured by CCK8 assay. Chondrocytes with density of 1.5 × 104 cells/wells were cultured in 24-well plates, which were treated with 10 ng/mL IL-1β for 2 h to establish an in vitro model of osteoarthritis. Incubated with the PSO (15 µM), [email protected] or [email protected] for 24 h. The latter two treatments equivalently contained 15 µM PSO. The remaining steps are based on the CCK8 method.
4.6 In vitro cellular uptake
Cellular uptake of MRC-PPL was examined in chondrocytes. IL-1β (10 ng/mL) treated cells were added MRC-PPL or MR-PPL (1 mg/mL). Meanwhile, the cells were stained with immunofluorescence against COL2A1 (Boster, Wuhan, China, 1:200). After the nuclei were stained with DAPI, the images were captured using a laser scanning confocal microscope (Nikon A1, Tokyo, Japan). The excitation wavelengths for DAPI and Cy5.5 were 405 nm and 640 nm, respectively.
4.7 In vitro anti-inflammatory activity and Immunofluorescence staining.
The chondrocytes were seeded in 6-well (density of 5 × 104 cells/cm2) or 24-well plates (density of 2 × 104 cells/cm2). The cells pretreated with IL-1β (10 ng/mL) for 2 h were incubated with the PSO (15 µM), [email protected] or [email protected]PSO for 24 h. The latter two treatments equivalently contained 15 µM PSO. The cells were then washed with saline and fixed with 95% ethyl alcohol for 30 minutes, followed by staining with hematoxylin and eosin (HE, Nanjing Jian Biotechnology, China).The immunofluorescence was used to detect the protein expression level of MMP-13 and TNF-α. Samples were incubated with primary antibodies against MMP-13 (Boster, China; 1:100) and TNF-α (Boster, China; 1:100) at 37 ˚C for 4 h. The second antibody FITC-anti-rabbit IgG (Boster, China) was incubated in dark for 1 h. Finally, the nuclei were stained with DAPI, and the cells were observed with fluorescence microscope (Olympus, Japan).
4.8 qRT-PCR detection
RNA separation kits (Megentec, China) were used to extract total RNA. The reverse transcription is done by a reverse transcription kit (Fermentas Company, USA). All qRT-PCR reactions were performed by a light Cycle 96 system (Roche, Switzerland) for 10 min at 95 ˚C, followed by 40 cycles with 10 s duration at 95 ˚C and then 60 s duration at 60 ˚C. The primers were used as follows in the Table 1:
Table 1
Primers for RT-PCR performance
gene | Forward primer (5'-3') | Reverse primer (5'-3') | size |
TNF-α | CAGAAAGCATGATCCGCGAC | TTCACCCACATCAGGCACTC | 20 |
MMP-13 | TACCATCCTGCGACTCTTGC | TTCACCCACATCAGGCACTC | 20 |
MMP-3 | GTTCTGGGCTATACGAGGGC | TTCTTCACGGTTGCAGGGAG | 20 |
Col2a1 | ACACCGCTAACGTCCAGA TG | TCGGTACTCGATGACGGTCT | 20 |
β-actin | CCCATCTATGAGGGTTACGC | TTTAATGTCACGCACGATTTC | 20 |
4.9 Induction of osteoarthritis in mice
A total of 100 C57BL/6J mice (aged 6–10 weeks) were used for the in vivo experiments, which were performed in accordance with the ethical approval of the Institutional Ethics Committee of Guangxi Medical University. Arthritis was induced by articular injection of a mixture of papain solution (Sigma; 8% W/V) with L-cysteine (Sigma, 0.03 mol/L) three times a week. Mice were randomly divided into different experimental groups (n = 5): healthy control group, OA group and treatment groups. For OA group, mice were IA injected with 20 µL of PBS once per week. The treatments included IA injection of 20 µL PSO (15 µM), 20 µL [email protected] solution (containing 15 µM PSO), or 20 µL [email protected] (containing 15 µM PSO), once per week for 2 or 6 weeks.
4.10 In vivo near infrared fluorescence (NIRF) imaging
After anesthetized with 2% isoflurane (Aerrane; Baxter), mice were injected with treatment solution through the articular cavity (n = 4 for each group). In vivo fluorescence imaging was performed on an IVIS 200 system with a Cy5.5 filter set (excitation 630 nm; emission 695 nm). The mice were anesthetized and imaged at 0.5, 1, 3, 7, 14, 21 d after injection.
4.11 Ex-vivo NIRF imaging and histological analysis
At research endpoints, mice were euthanized and their hind knee joints were collected for fluorescence imaging by an IVIS-200 system. The treated articular cartilages were harvested. Grading of articular cartilage surface was performed by specifically evaluating a nine-area grid of each medial and lateral tibia plateau (scale of 0–8)[27]. Moreover, the treated joints were fixed with 4% formaldehyde for 48 hours and decalcified with EDTA buffer. The samples were then embedded in paraffin and cut into sections of 3 microns. Paraffin sections were dewaxed and then collected for staining with hematoxylin (Solarbio, China). Glycosaminoglycan (GAG) secretion was detected using a safranin O-fast green kit (Solarbio, China) and MMP-13 secretion was assessed using a immunohistochemistry kit (Bioss, China). The stained slides were then imaged to examine the knee joint morphology on a fluorescence microscope. The OARSI cartilage OA histopathology grading system was adopted to evaluate the treated tissues[31].
4.12 Statistical analysis
All data were reported as mean ± standard deviation of at least three experiments. The two-sided student t test was used for statistical analysis. P value less than or equal to 0.05 was considered statistically significant.
Ethics approval and consent to participate
Animal care was in accordance with institutional guidelines. All animal studies were performed in accordance with the ethical approval of the Institutional Ethics Committee of Guangxi Medical University.
Consent for publication
Not applicable.
Availability of data and materials
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.