DOI: https://doi.org/10.21203/rs.3.rs-1515562/v1
(1) Objective: To explore the change of bone resorption metabolism in T2DM mice as well as the effect of different exercise on the OC differentiation and bone resorption metabolism in T2DM mice through Sirt1/NF-κB pathway.
(2) Methods: A total of 55 4-week-old male C57BL/6 mice were randomly divided into normal control group (NC) (12 mice) and T2DM modeling group (n=43). After modeling, the T2DM mice were randomized into T2DM control group (TDC, n=13), T2DM high-intensity intermittent exercise group (TDG, n=13) and T2DM downhill running group (TDP, n=14). Group TDG and group TDP were trained by 8-week high-intensity intermittent exercise and downhill running respectively. After the interventions, related factors in the bone were detected for mRNA expression by RT-PCR, and for protein expression by West-blotting technique. TRAP staining was used to detect the quantity of OCs and multinuclear OCs induced by BMM induced differentiation, and ELISA to detect the serum tartrate-resistant acid phosphatase (StrACP) activity. Groups of mice were observed for morphological structure of bone tissue by HE staining and Safranin O-Fast Green staining.
(3) Results: Compared with group NC, the cancellous bone and cortical bone thickness were significantly degraded in TDC group, inhibition of OC differentiation in T2DM mice resulted in a decrease in serum StrACP activity, and down-regulation of Sirt1 expression in T2DM mice bone resulted in activation of the NF-κB pathway. After 8 weeks of training, the up-regulation of Sirt1 expression in the bone of TDG and TDP mice inhibited the NF-kB pathway, inhibited OC differentiation and serum AP activity in T2DM mice, and significantly improved the thickness of cancellous and cortical bone in the distal femur and tibia of T2DM mice. However, TDP is significantly better than TDG in improving the changes of the above related indicators.
(4) Conclusion: The bone resorption/metabolism in T2DM mice was enhanced. Downhill running activated Sirt1 expression in the bone of T2DM mice, and then inhibited the NF-κB pathway, thus suppressing OC differentiation and bone resorption/metabolism, and its effect was better than that of high-intensity intermittent exercise.
Type 2 diabetes mellitus (T2DM) can cause a decrease in insulin levels and an increase in glucagon levels, breaking the metabolic balance of calcium, phosphorus and other elements, weakening the ability of osteoblasts to form bone and enhancing the activity of osteoclasts, resulting in decreased bone mass and delayed bone transformation [1]. T2DM is associated with impaired energy metabolism accompanied by bone metabolic diseases like osteoporosis [2]. After down-regulated, as a key factor regulating energy metabolism, silent information regulator 1 (Sirt1) may acetylate the 310th lysine residue of NF-κB RelA/p65 subunit through its N-terminal domain. After activated, NF-κB enters the nucleus of osteoclast precursor and up-regulates the expressions for IL-6, thereby promoting the expressions of c-fos and nuclear factor of activated T-cells1 (NFATc1), as well as promoting the differentiation, fusion and maturation of osteoclast (OC), and enhancing the bone resorption/metabolism [3,4]. The down-regulation of Sirt1 expression in T2DM mediates the NF-κB pathway to regulate the hepatic insulin resistance, atherosclerosis, inflammatory response, lipid metabolism, etc. [5–7]. In the field of life medicine, there are few reports about the Sirt1 with down-regulated expression in T2DM bone promoting NF-κB pathway to regulate the bone metabolism. However, the significantly down-regulated Sirt1 expression in the bone of T2DM mice causes OC differentiation and enhances bone resorption function. It may also prevent the bone marrow mesenchymal stem cells from differentiation into osteoblasts [8]. After it is knocked out, Sirt1-/- mice and T2DM mice were consistent in metabolic characteristics of bone tissue. In addition, in vitro studies have also confirmed that inhibition of Sirt1 expression in RAW264.7 for high glucose (simulated in vivo environment of T2DM) may up-regulate the expressions of target genes c-fos and NFATc1 expression levels, thus promoting OC differentiation and its bone erosion ability [9]. In addition, NF-κB acetylation up-regulates downstream target genes c-fos and NFATc1 in the bone of T2DM rats, leading to osteoporosis [10]. Sirt1 mediates NF-κB pathway to regulate OC differentiation and bone resorption, and Sirt1 and NF-κB pathways play key roles in promoting OC differentiation and bone resorption of T2DM respectively. However, studies on Sirt1 mediating NF-κB pathway to regulate OC differentiation and bone resorption of T2DM are underway.
Exercise may inhibit OC differentiation and bone resorption for T2DM significantly [11–13]. As exploring the mechanism, the study found that the energy supply from OC of T2DM mice in exercise significantly increased, resulting in an increase in NAD + content and a decrease in NADH, and increased NAD+/NADH ratio activated the Sirt1 expression, thereby inhibiting the expressions for IL-6 and target genes c-fos and NFATc1 as well as OC differentiation, fusion and bone resorption [14,15]. After exercise, the expression of Sirt1 in the bone of T2DM mice was up-regulated and combined with P300 in osteoclast precursor cells, then inhibited the activation, phosphorylation and degradation of IκBα enzyme, resulting in deacetylation of NF-κB and inhibition of relevant pathway, as well as OC differentiation and decline of bone resorption function [4]. The results indicated that Sirt1/NF-κB pathway mediated exercise inhibited bone resorption/metabolism for T2DM. However, there is still no report concerning different ways of exercise regulating OC differentiation and bone resorption in T2DM through Sirt1/NF-κB pathway. For this, this study intervened T2DM mice through 8-week high-intensity intermittent exercise and downhill running, and after the intervenes, west-blotting, OC primary culture, HE staining, etc. were used to explore the action mechanism of Sirt1/NF-κB pathway in inhibiting OC differentiation and bone resorption in T2DM mice at different levels like gene expression, cell quantity and activity, and structure of bone tissue.
A total of 55 4-week-old male C57BL/6 mice were included and randomized into normal control group (NC, n = 12) and T2DM modeling group (n = 43). For the mice in the T2DM modeling group, after 8 weeks of high-fat feed, a single dose of streptozotocin (STZ, 110mg/kg) was injected after 24 hours of fasting. And group NC was injected with citric acid/sodium citrate solution under the same conditions. Three days after injection, the blood was sampled from caudal vein after 12 h of fasting for blood glucose testing. If the blood glucose ≥ 16.7mmol/L, the modeling was successful [16]. Forty mice were successfully modeled and randomized into T2DM control group (TDC, n = 13), T2DM high-intensity intermittent exercise group (TDG, n = 13), and T2DM downhill running group (TDP, n = 14). And group NC was given normal feed, and T2DM mice were given high-fat feed and free drinking water, day-night ratio: 1:1 [17,18].
Group TDG and group TDP underwent 8-weeks of high-intensity intermittent exercise and downhill running respectively. Specific procedures: After 3 days of adaptive training, the maximal performance was tested as follows: initial speed: 8m/min, increased by 1m/min every 2min; slope gradient: -10°, exercise until exhaustion. In other words, the maximum velocity (Vmax) was a speed at which the mice could not exercise for more than 10s as expelled [19]. Specific exercise protocol was formulated according to the test results: 40 min/time, once a day, 6 d/week, total 8 weeks, and slope gradient: -10°.
| Group | Stage 1 | Stage 2 | Stage 3 | ||||
|---|---|---|---|---|---|---|---|
| Velocity, m/min | Time, min | Velocity, m/min | Time, min | Time, s | Velocity, m/min | Time, min | |
| TDP | 9.6 | 5 | 14.4 | 30 | ×1 | 9.6 | 5 |
| TDG | 10 | 5 | 21 | 2 | ×6 | 10 | 5 |
| 11.3 | 3 | ||||||
The eyeballs of mice were removed for sampling the blood used for ELISA. The left femurs of mice were used for RT-PCR and Western Blot. The left femur was for HE staining, and the left tibia was for Safranin O-Fast Green staining. The bone marrow macrophages (BMMs) of mice were taken for primary culture to induce OC differentiation for tartrate-resistant acid phosphatase (TRAP) staining.
The left femur was taken, and the RNA was extracted and reversed into cDNA. The mRNA expressions for related factors in Sirt1/NF-κB signal pathway was detected according to the standard procedures for a quantitative kit. The primer sequence was designed with Primer software and synthesized by Shanghai Shenggong Bioengineering Technology Service Co., Ltd. as shown in Table 2.
| Name of Primer | Sequence (5 'to3') | Number of basic groups |
|---|---|---|
| NFATC1-Forward | GAGAATCGAGATCACCTCCTAC | 22 |
| NFATC1-Reverse | TTGCAGCTAGGAAGTACGTCTT | 22 |
| c-fos-Forward | TCTCTAGTGCCAACTTTATCCC | 22 |
| c-fos-Reverse | GAGATAGCTCTACTTTGCC | 22 |
| Sirt1-Forward | GCTGACGACTTCGACGACG | 21 |
| Sirt1-Reverse | TCGGTCAACAGGAGGTTGTCT | 21 |
| IL-6-Forward | TAGTCCTTCCTACCCCAATTTCC | 23 |
| IL-6-Reverse | TTGGTCCTTAGCCACTCCTTC | 21 |
| NF-κB-Forward | CAAAGACAAAGAGGAAGTGCAA | 22 |
| NF-κB-Reverse | GATGGAATGTAATCCCACCGTA | 22 |
| β-actin-Forward | GGCTGTATTCCCCTCCATCG | 20 |
| β-actin-Reverse | CCAGTTGGTAACAATGCCATGT | 22 |
The left femurs of mice were ground for protein extraction and protein concentration determination. The protein concentration was adjusted with PBS for consistency, followed by gel preparation, electrophoresis, mold transfer, staining, strip blocking and anti-incubations I and II. Finally, the PVDF membrane was developed and photographed by Alpha gel imaging system, and relevant data analysis was carried out by Fluor Chem FC2 software [20].
The femurs of mice were taken by standard procedures [21], and BMMs of mice were taken for inducing OC differentiation, which was terminated on the 5th day. After 4% PFA fixation, OC was stained with TRAP, photographed with Leica inverted fluorescence microscope and counted by Blindness method.
The eyeballs of mice were removed for sampling the blood. The content of serum tartrate-resistant acid phosphatase (StrACP) was determined by a microplate reader according to the standard procedure for StrACP activity kit.
The femurs and tibias of mice were taken, cleaned with PBS, and fixed with 4% PFA respectively. After the decalcification of EDTA, alcohol gradient dehydration, permeation, embedding, repair, section, dewaxing and rehydration were performed. After being stained with hematoxylin, the femurs were cleaned, and then stained with eosin. The tibias were stained with safranin and fast green successively. After the staining was completed, the samples were soaked with 85% ethanol for 2min, 2 times of 95% ethanol for 2min, and 2 times of 100% ethanol for 2min. The alcohol gradient dehydration was performed based on successive 5 min of xylene I and 5 min of xylene II. Finally, neutral gum and slide were used for mounting, and photographs were taken with an inverted fluorescence microscope.
SPSS20.0 software was used for data processing. A one-way analysis of variance was performed with group NC and TDC, and an independent-sample T test was carried out for group TDC, TDG and TDP. The results were expressed as mean ± standard deviation (SD).
This section may be divided by subheadings. It should provide a concise and precise description of the experimental results, their interpretation, as well as the experimental conclusions that can be drawn.
3.1. Effects of different exercise modes on mRNA expressions for Sirt1/NF-κB pathway related factors in the bone of T2DM mice
As shown in Figure 1, compared with group NC, the mRNA expression for Sirt1 of group TDC had down-regulated significantly (p<0.01) and for NF-κB, IL-6, c-fos and NFATc1 up-regulated significantly (p<0.05 or p<0.01); compared with group TDC, the mRNA expression for Sirt1 of group TDG had up-regulated significantly (p<0.05), for NF-κB and NFATC1 down-regulated significantly (p<0.05), and for IL-6 and c-fos down-regulated, but not significantly (p>0.05); compared with group TDC, the mRNA expression for Sirt1 of group TDP had up-regulated significantly (p<0.01) and for NF-κB, IL-6, c-fos and NFATc1 down-regulated significantly (p<0.05 or p<0.01); compared with group TDG, the mRNA expression for Sirt1 of group TDP had significantly up-regulated (p<0.05), for IL-6 and NFATc1 down-regulated significantly (p<0.05), and for NF-κB and c-fos down-regulated, but not significantly (p>0.05).
3.2. Effects of different exercise modes on protein expressions for Sirt1/NF-κB pathway related factors in the bone of T2DM mice
As shown in Figure 2 and 3, compared with group NC, the mRNA expression for Sirt1 of group TDC had down-regulated significantly (p<0.01) and for NF-κB, IL-6, c-fos and NFATc1 up-regulated significantly (p<0.01); compared with group TDC, the mRNA expression for Sirt1 of group TDG had up-regulated significantly (p<0.05), for c-fos and NFATc1 down-regulated significantly (p<0.05), and for NF-κB and IL-6 down-regulated, but not significantly (p>0.05). The mRNA expression for Sirt1 of group TDP had up-regulated significantly (p<0.05), and for NF-κB, IL-6, c-fos and NFATc1 down-regulated significantly (p<0.05 or p<0.01). Compared with group TDG, the mRNA expression for Sirt1 of group TDP had up-regulated significantly (p<0.05), and for NF-κB, IL-6, c-fos and NFATc1 down-regulated significantly (p<0.05).
3.3. Effects of different exercise modes on OC differentiation in T2DM mice
As shown in Figure 4 and 5, compared with group NC, the total number of OCs and the number of OC with ≥3 nuclei of group D had increased significantly (p<0.01); compared with group TDC, the total number of OCs and the number of OC with ≥3 nuclei of group TDG and TDP had decreased significantly (p<0.05 or p<0.01); compared with group TDG, the total number of OCs and the number of OC with ≥3 nuclei of group TDP had decreased significantly (p<0.05).
3.4. StrACP activity in serum of T2DM mice affected by different exercise modes
As shown in Figure 6, compared with group NC, the StrACP activity of group TDC had increased significantly (p<0.01); compared with group TDC, the StrACP activity of group TDG and TDP had decreased significantly (p<0.05 or p<0.01); compared with group TDG, the StrACP activity of group TDP had decreased significantly (p<0.05).
3.5. Effects of different exercise modes on the morphological structure of femoral cancellous bone in T2DM mice
As shown in Figure 7 and 8, compared with group NC, the distal femoral cancellous bone of group TDC had degraded seriously, the number of bone trabecular decreased significantly, and the cortical bone thickness reduced significantly (p<0.01); compared with group TDC, the morphology of distal femoral cancellous bone, the number of bone trabecular and the cortical bone thickness of group TDG had significantly improved (p<0.05), and the morphology of distal femoral cancellous bone, the number of bone trabecular and the cortical bone thickness of group TDP had significantly improved (p<0.01); compared with group TDG, the distal femoral cancellous bone of group TDP had significantly improved, the number of bone trabecular had increased significantly, and the cortical bone had thickened significantly (p<0.05).
3.6. Effects of different exercise modes on the morphological structure of tibial cancellous bone in T2DM mice
As shown in Figure 9 and 10, compared with group NC, the distal tibial cancellous bone of group TDC had degraded seriously, the number of bone trabecular had reduced significantly, and the cortical bone thickness had decreased significantly (p<0.01); compared with group TDC, the morphology of distal tibial cancellous bone of group TDG had bone improved significantly, the number of bone trabecular had increased significantly, and the cortical bone had thickened significantly (p<0.05); compared with group TDC, the morphology of distal tibial cancellous of group TDP had bone significantly improved, the number of bone trabecular significantly increased, and the cortical bone significantly thickened (p<0.01); compared with group TDG, the morphology of distal tibial cancellous bone of group TDP had significantly improved, the number of bone trabecular had significantly increased, and the cortical bone had significantly thickened (p<0.05).
This study investigated the effects and mechanisms of two types of exercise on T2DM bone resorption metabolism. We further interrogated the role of Sirt1/NF-κB signaling pathway in mediating bone resorption effects in T2DM mice. Our data demonstrate that two types of exercise inhibits the bone resorption in T2DM mice and the effect is mediated by Sirt1/NF-κB. Interestingly, downhill running conferred the best effect.
Advanced increase of glycation end products and abnormal expression of insulin-like growth factor due to high glucose and insulin deficiency for T2DM lead to abnormal enhancement of bone resorption, decrease of BMD and osteoporosis [22]. Studies have proved that in T2DM patients, the cortical bone thickness and the number of bone trabecular are reduced significantly, and the morphological structure of bone is compromised seriously [23–25]. In this study, the morphological and structural degeneration of bone tissue was observed by both HE staining and Safranin O-Fast Green staining, indicating bone mass loss in T2DM mice resulting in significant degeneration in microstructure of bone tissue. This was closely related to the increased number of OCs and multinuclear OCs produced by differentiation in this study, for the secreted StrACP increased significantly with the number of OCs and multinuclear OCs, indicating that in T2DM mice, the bone resorption capacity was significantly enhanced, resulting in the secretion of organic acids on the bone surface enhancing bone erosion capacity, which caused the degradation of bone microstructure [26,27,12]. This process may be regulated by key pathways or factors. As a key factor for energy metabolism, Sirt1 also regulates bone metabolism. When Sirt1 is knocked out, the OC differentiation in mice will be inhibited and the bone mass lost significantly [28,29], which is closely related to the activation of NF-κB pathway by Sirt1 knockout causing up-regulation of IL-6 and downstream c-fos and NFATc1 genes and promotion of OC differentiation, fusion and bone resorption [30,31]. Although studies have confirmed that Sirt1 and NF-κB pathways regulate T2DM to promote OC differentiation and bone resorption respectively, the Sirt1 mediated NF-κB pathway for regulating T2DM to inhibit OC differentiation and bone resorption is still to be revealed. In this study, the mRNA and protein expressions for Sirt1 were down-regulated significantly and for NF-κB, IL-6, c-fos and NFATc1 up-regulated significantly in the bone of T2DM mice, suggesting that down-regulation of Sirt1 expression activated the NF-κB pathway in T2DM mice. When this pathway was activated, its target gene NFATc1 promoted OC differentiation, fusion and bone resorption capacity, and thus, the activity of StrACP, a serum biochemical marker for bone resorption, was enhanced significantly, resulting in further bone loss and degeneration of bone tissue microstructure [32]. This may explain the increased number of OCs produced by differentiation, the enhanced StrACP activity, the degeneration of bone microstructure and the decrease of bone mass in this study. In T2DM mice, abnormal energy metabolism in OCs results in decreased NAD+/NADH ratio and inhibits Sirt1 expression through peroxisome proliferator- activated receptor γ coactivator 1α (PGC-1α) [33]. After activated, the C-terminal domain of forkhead box O1 (FOXO1) binds to Sirt1 to form the FoxO3A-Sirt1 complex group, which down-regulates the Sirt1 expression together with v-ATPase V0subunit d2 (Atp6v0d2) and DC-STAMP in OCs, thus activating NF-κB and its downstream target genes like IL-6, c-fos, NFATc1, etc., and thus, the OC differentiation and bone resorption are promoted.
Abnormally enhanced bone resorption in T2DM degrades the morphology of bone tissue and decreases the bone mass. For the bone, an organ sensitive to mechanical stimulation, the mechanical load generated by exercise on T2DM bone is transformed into biological signals to inhibit OC differentiation and bone resorption capacity as well as bone resorption, thus improving the microstructure of bone tissue and bone mass [34]. Studies have verified that in T2DM mice, the abnormal increase of bone resorption results in significant degeneration of bone phenotypes like distal tibial and femoral cancellous bones as morphometric indicators, while 8-week downhill running may improve the indicators in T2DM significantly [13,35,36]. High-intensity intermittent exercise is an important method for improving bone resorption, but there are still few reports on the comparison between the exercise modes for improving bone resorption in T2DM. In this study, both 8-week high-intensity intermittent exercise and downhill running significantly improved the morphological structure of tibial and femoral cancellous bones in T2DM mice, but compared with high-intensity intermittent exercise, downhill running had a more significant effect on the morphological structure of tibia and femur. This might be closely related to the great mechanical stimulation of bone in T2DM mice by running downhill, which may improve the microstructure of bone tissue significantly [37]. In this study, both exercise modes improved the morphological structure of distal tibial cancellous bone in the mice significantly, but the downhill running had a more significant effect. The results were consistent with Moon's study, which reckons that the effect of downhill running on the bone of T2DM mice results in more significant improvement in the morphological structure of bone tissue, supporting the positive effect of downhill running on bone [38]. An analysis of relevant mechanism has shown that in T2DM mice, downhill running inhibits OC differentiation and fusion as well as bone resorption capacity and secretion of StrACP (a biochemical marker for bone resorption) significantly in T2DM mice [39]. In this study, the total number of OCs and the number of ≥ 3 nuclei OCs produced by BMM differentiation in T2DM mice were decreased significantly under both exercise modes. In addition, a comparison between the two modes showed that the total number of OCs and the number of ≥ 3 nuclei OCs decreased more significantly in the downhill running group. StrACP secretion was inhibited by the decrease in OCs and relevant bone resorption capacity. Moreover, exercise inhibited the decline in bone erosion of OCs in T2DM mice and improved the microstructure of bone tissue, especially for cancellous bone [40]. A study by Chen Xianghe et al. [12] has also verified that exercise inhibited OC differentiation, fusion and bone formation in T2DM mice, the mechanism is closely related to the inhibition of CN/NFAT pathway in the bone by exercise, and downhill running has a more significant effect for its direct mechanical stimulation on the bone.
The process for exercise inhibiting OC differentiation and bone resorption in T2DM is regulated by signaling pathways or key proteins like OPG/RANKL/RANK, G protein coupled receptor 48 (GPR48) and p38MAPK [41,42]. For the Sirt1/NF-κB pathway, an important signal pathway that regulates T2DM for promoting OC differentiation and bone resorption, relevant effects have been verified in this study, and furthermore, Sirt1 and NF-κB pathway play important regulatory roles in exercise inhibition of OC differentiation and bone resorption respectively [43–45]. However, there are few studies concerning this pathway regulating exercise for inhibiting OC differentiation and bone resorption in T2DM patients. In this study, after 8-weeks of intervention by exercise, the expression of Sirt1 mRNA and protein was up-regulated in group TDG, mRNA expressions for NF-κB and NFATc1 and protein expressions for c-fos and NFATc1 down-regulated, but for the mRNA expressions for IL-6 and c-fos and protein expressions for NF-κB and IL-6, the effects were not significant, while the expression of Sirt1 mRNA and protein in group TDP was up-regulated significantly and for NF-κB, IL-6, c-fos and NFATc1 down-regulated significantly. Although high-intensity intermittent exercise up-regulated the expressions for Sirt1 and down-regulated the expressions for c-fos and NFATc1 significantly, the expressions for NF-κB were not significantly changed. Relevant studies have shown that NF-κB and IL-6 play their role at a translation level, suggesting that Sirt1 also mediates other pathways to regulate bone resorption in T2DM mice through target genes c-fos and NFATc1. However, downhill running can inhibit NF-κB pathway through up-regulating Sirt1 expressions in the bone of T2DM mice. This has explained the changes in OC differentiation, cancellous bone microstructure and BMD under the two exercise modes in this study. Compared with group TDG, the mRNA and protein expressions for Sirt1 of group TDP had up-regulated significantly, mRNA expressions for Il-6 and NFATc1 had down-regulated significantly, and mRNA expressions for NF-κB and c-fos had down-regulated but not significantly. However, the protein expressions for NF-κB, IL-6, c-fos and NFATc1 were down-regulated significantly. Overall compared with high-intensity intermittent exercise, downhill running can significantly up-regulate Sirt1 expressions and inhibit NF-κB pathway in T2DM mice, for the direct effect of downhill running on the bone of T2DM mice up-regulates expressions for Sirt1, thus inhibiting the expressions for IκBα and preventing it from binding to NF-κB subunit P65 through nucleation, and thus, NF-κBp65 is deacetylated and the expressions for IL-6 and target genes c-fos and NFATc1 are down-regulated [46]. Downhill running may also promote the expressions of Wnt1 inducible signaling pathway protein 1 (WISP1) in the bone of T2DM mice significantly, thus up-regulating Sirt1 and its NF-κB pathway [47]. Furthermore, this is related to up-regulation of AMPK expressions in the bone for T2DM by downhill running [48]. AMPK can transcriptionally activate Nicotinamide Phosphoribosyl transferase (Nampt), thus increasing the NAD+/NADH ratio, and activating Sirt1 and downstream NF-κB pathway [49]. Downhill running can activate Sirt1/NF-κB pathway in the bone of T2DM mice significantly, which has also explained the OC differentiation and bone resorption capacity decreased and bone microstructure and BMD significantly improved after inhibition of bone resorption in this study in terms of molecular mechanism.
Taken together, after down-regulation of Sirt1 expressions, the NF-κB inflammatory pathway is activated for promoting the bone resorption in the bone of T2DM mice. Downhill running may activate Sirt1 in the bone of T2DM mice, and then inhibit the NF-κB inflammatory pathway as well as the bone resorption, thus improving the morphological structure of bone tissue and BMD. Its effect is better than that of high-intensity intermittent exercise.
Authors’ Contributions: Xianghe Chen and Kaihong Sun designed this present research study. Pengcheng Lu, Shengjie Jin, Xinyu Zeng performed this research, analyzed the data, and drafted the manuscript. Chi Liu and Xiao Qiu critically reviewed and revised the manuscript. All authors have read and agreed to the published version of the manuscript.
Funding: This study was funded by grants received by Xianghe Chen from The China Postdoctoral Science Foundation (2019M661957), The Special grants from China Postdoctoral Science Foundation (2021T140580), 2020 Yangzhou University “High-end Talent Support Program” and 2021 Yangzhou University “Qinglan Project”.
Availability of data and materials: The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.
Ethics approval and consent to participate: The following information was supplied relating to ethical approvals (i.e., approving body and any reference numbers): all animal procedures were performed according to the guidelines of the Experimental Animal Care and Use Committee at Yangzhou University (License No.: YZU-TYXY-31).
Consent for publication: Written informed consent for publication was obtained from all participants.
Competing interests: The authors have declared that no competing interests exist.