Myometrial Oxidative Stress Drives MED12 Mutations for Leiomyoma development

doi:10.21203/rs.3.rs-1517048/v1

Download PDF

Research Article

Myometrial Oxidative Stress Drives MED12 Mutations for Leiomyoma development

https://doi.org/10.21203/rs.3.rs-1517048/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

Background

More than 70% of leiomyomas (LM) harbor MED12 mutations, primarily in exon 2 at c.130-131(GG). The cause of MED12 mutations in myometrial cells remains largely unknown. We hypothesized that increased ROS promotes MED12 mutations in myometrial cells through the oxidation of guanine nucleotides followed by misrepair.

Methods

Genomic oxidative burden (8-OHdG) was evaluated in vitro and in vivo by immunohistochemistry. MED12 mutations were examined by Sanger sequencing and deep sequencing. Transcriptome examined by RNA-seq was performed in myometrium with and without LM, in primary myometrial cells treated with ROS. 8-OHdG mediated misrepair was analyzed by CRISPR/Cas9.

Results

Uteri with high LM burden had a significantly higher rate of MED12 mutations than uteri with low LM burden. Compelling data suggest that the uterus normally produces reactive oxidative species (ROS) in response to stress, and ROS levels in LM are elevated due to metabolic defects. We demonstrated that genomic oxidized guanine (8-OHdG) was found at a significantly higher level in the myometrium of uteri that had multiple LM compared to myometrium without LM. Transcriptome and pathway analyses detected ROS stress in myometrium with LM. Targeted replacement of guanine with 8-OHdG at MED12 c.130 by CRISPR/Cas9 significantly increased the misrepair of G>T. Exposure of primary myometrial cells to oxidative stress in vitro increased misrepair/mutations as detected by duplex sequencing.

Conclusions

Together, our data identified a clear connection between increased myometrial oxidative stress and a high rate of MED12 mutations that may underlie the risk of LM development and severity in women of reproductive age.

leiomyoma

MED12 mutation

myometrium

reactive oxidative species (ROS)

8-OHdG

duplex sequencing

High rate of MED12 mutations and leiomyoma burden are clearly associated with myometrial oxidative stress.
MED12 mutations are driven by misrepair of 8-OHdG at c.130-c.131 detected by deep sequencing analysis both in vitro and in vivo.

Uterine leiomyomas (LM) occur in up to 77% of women of reproductive age and are the leading cause of approximately 600,000 hysterectomies/myomectomies per year in the U.S. [1, 2]. Health-related costs are estimated at $5.9 to $34.4 billion per year [3]. LM can cause significant morbidity, including profuse menstrual bleeding and pelvic pain as well as reproductive dysfunction. Whole genome sequencing studies have identified MED12 mutations to occur in up to 70% of all LM [4, 5], however, the molecular cause of these mutations remains unknown.

The uterus functions under conditions of high oxidative stress with elevated reactive oxidative species (ROS), in part, due to dynamic steroid hormone changes, homeostatic mechanisms, and ROS-related cell function [6-9]. Furthermore, studies have found a higher ROS burden in LM, related to a decreased ability to detoxify superoxides by protein acetylation of manganese superoxide dismutase at lysine 122 (MnSOD^K122Ac) [9], and NADPH oxidase 4 (NOX4) dysfunction [10]. Although the ability of ROS to cause DNA mutations has been shown [11, 12], its effects on uterine myometrium are unknown. One common mutagenesis mechanism in response to ROS exposure is the accumulation of oxidative nucleotides in genomic DNA [13, 14], in particular, modified guanine 8-OHdG ((8-hydroxy-2'–deoxyguanosine). Through oxidization of the G nucleotide and subsequent mismatch pairing, ROS exposure can cause specific types of DNA mutations [15]. Although emerging data show that oxidized nucleotides in DNA can be readily fixed by base excision repair (BER) [16], high ROS levels continue to increase the misrepair rate of 8-OHdG and other modified nucleotides, which is a hallmark of ROS-mediated tumorigenesis [17]. 8-OHdG–mediated gene mutations have been reported for K-Ras and p53 [11, 12], where a disproportionately high rate of missense mutations are seen in guanine transversions/transitions in p53 at codons 175/248/273 [12] and in K-Ras at codon 12, particularly in lung cancer associated with tobacco smoking [12].

In this study, we test our hypothesis that ROS can promote mutations in the MED12 gene through the oxidation of guanine nucleotides in human myometrial cells. We demonstrate that increased ROS is evident in the myometrium of uteri with high number of LM tumors, that treatment of myometrial cells in vitro with ROS inducers causes increased 8-OHdG, that insertion of oxidized guanines at c.130-131of MED12 using CRISPR/Cas9 technology promotes misrepair and mutations, and that both acute and chronic treatments of myometrial cells promote mutations of MED12 at sites similar to hot spot mutations found in LM tumors. Altogether, our study demonstrates for the first time, a clear connection between increased myometrial ROS and MED12 mutations that may underlie leiomyoma development.

Patient specimens

Uterine tissues were collected from premenopausal women undergoing hysterectomy or myomectomy at Northwestern University Prentice Women’s Hospital (Chicago, Illinois) from 2010 to2021. Tissues collected from a total of 309 women were included in this study. A total of 529 leiomyomas (LM) were subjected to MED12 mutation analysis. In addition, 35 uteri without LM from age-matched hysterectomy (uterine bleeding, prolapse, and Adenomyosis) were included as controls. Pathology reports were reviewed and all LM were usual type. Patient age at surgery, race, uterine weight, number of tumors, tumor size, hormonal status, and hormonal treatment were documented. All LM and matched myometrium (MM) used for primary cell culture were from patients who had not received hormonal treatment. General information about the patient cohort is summarized in Table S1.

Cell culture and treatment

Myo-hTERT cell line was kindly provided by C. Mendelson (UT Southwestern) and cultured in DMEM/F12 medium (Thermo Fisher Scientific, Cat# 41966052) plus 10% Fetal Bovine Serum (FBS, Fisher Scientific). HUtSMCs were obtained from PromoCell (C-12575) and grown in Smooth Muscle Cell Growth Medium 2 (PromoCell, C-22062). Primary LM and matched myometrial cells were isolated as previously described[18]. All the cells were grown at 37 °C in a humidified cell culture incubator containing 5% CO₂. Oxidative stress conditions were mimicked in vitro by the exogenous addition of Paraquat dichloride hydrate (PQ; Sigma Aldrich, 36541). An optimal dose for PQ (100 μM) was selected based on ~50% cell death after 48 hrs of treatment in a dose-response study. For acute treatment strategy, cells were treated with PQ for 24 hrs or 48 hrs; for chronic treatment, the cells were treated with PQ for 48 hrs and recovered in fresh media for 24 hrs. This process was then repeated 5-6 times.

Myometrial spheroid/three-dimensional (3D) culture

Myometrial spheroids were cultured as previously described [18, 19]. Briefly, cells were plated in 96-well ultra-low attachment plates (Corning Costar), cultured in mesenchymal stem cell medium (Lonza, PT-3001), and incubated at 37°C in a humidified incubator with 5% CO₂ for at least 48 hrs. Spheroids were formed and evaluated under an inverted microscope.

DNA extraction and Sanger sequencing

DNA extraction from fresh/frozen or FFPE tissues of tissue bank was performed using the ZYMO RESEARCH Quick-DNA™ MiniPrep Plus Kit and ZYMO RESEARCH Quick-DNA™ FFPE Kit (ZYMO RESEARCH, D4068, D3067, USA), respectively, according to the manufacturer’s protocol. 50 ng of genomic DNA was used to amplify MED12 exon 2 for Sanger sequencing (primer see Table S2). Sanger DNA sequencing of the purified DNA products was performed in NUSeq Core (Northwestern) with Applied Biosystem's 3730xl DNA Analyzer. Mutations/variations were analyzed by FinchTV and Indigo software (https://www.gear-genomics.com/indigo/).

AP Assay

Apurinic or apyrimidinic (AP or abasic) sites produced by ROS inducers are detected by AP Sites Quantitation Kit (Cell Biolabs) according to the manufacturer protocol. Genomic DNA (gDNA) was isolated from the cells treated with or without ROS inducers using DNAzol reagent and dissolved in TE buffer. gDNA was mixed with the aldehyde reactive probe (ARP) ) to react specifically with an aldehyde group on the open-ring form of AP sites. AP sites were tagged with biotin and detected with a streptavidin–enzyme conjugate. The quantity of AP sites per 10⁵ nucleotides was determined at 450 nm with a standard curve produced using ARP-DNA standard solutions.

RNA extraction and RT-PCR

Treated primary cells were isolated with TRIZOL reagents (Invitrogen, Carlsbad, CA) according to the manufacturer's protocol. RNA was quantified with the NanoDrop (ND-1000, Saarbrücken), and cDNA was synthesized from 1 μg of total RNA using qScript™ cDNA Synthesis Kit (QuantaBio). Quantitative RT-PCR was performed using Power SYBR™ Green PCR Master Mix in an Applied Biosystems 7900HT Real-Time PCR System. Primer sequences are shown in Table S. Fold change values were calculated using the comparative Ct method using endogenous control GAPDH. The experiments were repeated in triplicate.

Tissue microarray (TMA)

After slide review, the FFPE tissue of LM and matched myometrium were selected. Tissue cores of 1.5 mm in diameter were taken to create TMAs. TMAs were sectioned at 4 μm. The first and last slides of each TMA were stained with hematoxylin and eosin (H&E) for quality assurance to confirm the correct tissue types.

Immunohistochemistry

Immunohistochemical staining was performed on a Ventana Nexus automated system as described previously [5]. Antibody information is summarized in Table S3, including antibodies for 8-OHdG and γH2AX. Immunostaining was scored semi-quantitatively by percentage and intensity by pathologists. The intensity and the percentage were combined as H-Score.

Immunofluorescence and Dihydroethidium (DHE) Stain

The cell and tissue sections were washed with cold PBS and immediately fixed with cold methanol (−20°C) for 10 min, followed by incubation in 3% bovine serum albumin in PBS for 1 hr to block the nonspecific binding sites. A primary antibody to 8-OHdG (Santa Cruz) or γH2AX (Novus Biologicals) was added overnight at 4°C. After washing 3 times with 1X PBST, secondary antibodies and Alexa Fluor® 488-conjugated goat anti-mouse (1:1000, Life Technologies) were added for 1 hr at room temperature (Table S3). Slides were counterstained with 4′,6-diamidino-2-phenylindole (DAPI) for analysis. For the DHE staining, the slides were incubated with the 5 μM DHE for 10 to 15 minutes in a dark chamber, on an orbital shaker at room temperature. After washing 3 times for 5 minutes/wash with 1X PBS and slight fixation for 4 to 8 minutes in 7% formaldehyde in 1X PBS, the slides were counterstained with DAPI, and images were captured using a fluorescence microscope.

CRISPR/Cas9 and target sequence

c.129-131 (AGG) from MED12 exon2 was selected as the Protospacer Adjacent Motif (PAM) site. The target-specific sequence for guiding Cas9 protein was: ACGGCCTTGAATGTAAAACA, and was inserted into Alt-R^® CRISPR/Cas9 crRNA (provided by Integrated DNA Technologies [IDT]). The template sequence for the ssDNA HDR donor (ACGCCGCATTCCTGCCTCAGGA TGAACTGACGGCCTTGAATGTAAAACAA/i8-oxodG/GTTTCAACAACCAGCCTGCTGT CTCTGGGGATGAGCATGGCAGTGCCAA) was designed and synthesized by IDT (Table S2). c.138T>C was taken as the index in the genomic DNA. The electroporation of CRISPR/Cas9 was done using the Neon^® Transfection System Kit. In brief, crRNA and ATTO 550-tracrRNA were heated at 95°C for 5 min to form the gRNA complex at a final concentration of 50 μM. Then, the gRNA complex (final concentration: 4.8 μM) and Alt-R Cas9 enzyme (final concentration: 4 μM) were mixed and incubated at room temperature for 10-20 min to form the RNP complex. 1 μl of 50 μM ssDNA template was added to 2.5 μl RNP complex and then the Cas9‐RNP+ssDNA mixture was prepared. 9 μl (10x10⁶ primary myometrial cells/ml) was resuspended in 9 μl buffer R in the PCR tube and 3.5 μl Cas9 RNP+ssODN was added. 10 μl tips were used for the electroporation at 1500V, 20ms with 2 pulses. The electroporated myometrial cells were plated into 6-well plates and then cultured for 18 hours. The cell condition and ATTO 550 were checked using fluorescence microscopy. Cells were maintained in a regular medium for 5 days, then harvested for DNA extraction. The target sequences in treated cells were analyzed by deep sequencing (see below).

Deep sequencing and duplex sequencing

To detect DNA misrepair/mutations in MED12 exon2, genomic DNA was extracted and MED12 exon 2 DNA was amplified for conventional deep sequencing or were captured for duplex sequencing analysis. For conventional deep sequencing, MED12 exon 2 was amplified, followed by library preparation using the QIAseq 1-Step Amplicon Library Kit (Qiagen) according to the manufacturer’s instructions. The libraries were pooled and sequenced on an Illumina HiSeq4000, and sequencing reads were aligned to hg19 and assembled using Samtools-Mpileup and GATK4. MED12 mutation frequency of each nucleotide of exon 2 was calculated as the number of reads with mutated allele divided by the total number of reads.

A more sensitive sequencing strategy, duplex sequencing detects very low rates of double-strand nucleotide alterations/mutations [20, 21]. For duplex sequencing, DNA was sonicated, end-repaired, A-tailed, and ligated with UMI (IDT) and index adapters (IDT) using the KAPA HyperPrep library kit (Roche Sequencing). After initial amplification, 120 bp biotinylated oligonucleotide probes (IDT) were used to capture the exon 2 DNA of MED12 using xGen^® Lockdown^® Reagents (IDT) according to the manufacturer’s protocol. Two successive rounds of captures were performed to ensure sufficient target enrichment. The libraries were sequenced using 2 x 150 paired-end reads with eight-base indexing read on an Illumina NovaSeq 6000. Duplex sequencing data were processed using the previously published method [21]. Briefly, FASTQ files were converted to unaligned bam using Picard FastqToSam. Reads were grouped based on the unique tagged sequences to generate read families needed to make single-strand consensus sequences (SSCS) and duplex consensus sequences (DCS) using Unified consensus maker (UCM). Consensus sequences were aligned to the reference hg38 genome using BurrowsWheeler aligner (BWA-mem) and variants calling was performed using VarDict (Java). Later, for each mutation, mutation frequency was calculated as the number of DCS reads showing the mutant allele divided by the total number of DCS reads. All the sequencing data were summarized in Table S4.

RNA sequencing

Total RNA was isolated using the Qiagen miRNeasy Mini Kit according to the manufacturer’s instructions (Qiagen, cat. # 217004). These included fresh frozen tissue of MM with and without LM (n=3 each), 4 groups of cultured myometrial cells (controls and PQ treatment, n=4 each). RNA samples were quantified using a Qubit 2.0 Fluorometer (Life Technologies) and RNA integrity was checked using Agilent TapeStation 4200 (Agilent Technologies). RNA integrity numbers (RIN) greater than or equal to 9 were used for library preparation using the NEBNext Ultra II RNA Library Prep Kit for Illumina following the manufacturer’s instructions (New England Biolabs/NEB, Ipswich, MA). Briefly, mRNAs enriched using Oligo (dT) beads were fragmented for 15 minutes at 94°C. First-strand and second-strand cDNAs were then synthesized. cDNA fragments were end-repaired and adenylated at the 3’ ends, and universal adapters were ligated to cDNA fragments, followed by index addition and library enrichment by limited-cycle PCR. The sequencing libraries were validated on the Agilent TapeStation (Agilent Technologies) and quantified using a Qubit 2.0 Fluorometer (Invitrogen), as well as by quantitative PCR (KAPA Biosystems). RNA sequencing was performed by Genewiz (Genewiz, NJ) on the Illumina HiSeq4000 and sequenced using a 2x150bp Paired End (PE) configuration.

RNA-seq data processing and analysis

The quality of DNA reads, in FASTQ format, was evaluated using FastQC (Babraham Bioinformatics). Adapters were trimmed and reads of poor quality or aligned to rRNA sequences were filtered out. The clean reads were mapped to the Homo sapiens GRCh38 reference genome available on ENSEMBL using the STAR aligner v.2.5.2b, and featureCounts from Subread package v.1.5.2 was applied to calculate unique gene hit counts. After extraction, the gene hit counts table was used for downstream differential expression analysis using the DESeq2 package in R. Differentially expressed genes were identified using threshold adjusted p-value < 0.05 and absolute log2 fold change >0.5 (for Control vs. PQ). To perform clustering analyses on a group of samples, a union of all the genes and their expression RPKM values within that group was generated to build a read count matrix for the group of interest. Various unsupervised cluster analysis and other machine learning techniques were applied to the composite read count matrix of interest. The packages ggplot2 and Pheatmap in R were used to build various heatmaps and volcano plots. “Factoextra and FactoMineR” packages were used for principal component analysis (PCA) to reveal the similarity between samples based on the distance matrix. The “fgsea” and “enrichplot” packages were run for gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis. Functional analysis was performed by Gene Set Enrichment Analysis (GSEA) using the Molecular Signatures Database, MSigDB (http://www.broad.mit.edu/gsea/msigdb/index.jsp). RNA sequence data have been submitted to GeneBank (SRA accession number: PRJNA746002) and the significantly changed genes were summarized in Table S5.

Statistical analysis

Statistical analysis of RNA_Seq was performed using related packages in R. A two-way ANOVA (paired t-test) was constructed to identify genes that were differentially expressed in all LM compared with the corresponding myometrium samples. A one-way ANOVA was constructed to identify genes that were differentially expressed between each LM subtype and the myometrium samples. Another statistical analysis was performed using GraphPad Prism version 8.0 (GraphPad Software). Unpaired t-tests were performed when comparing two groups. Paired t-test was used when comparing the two treatments. Ordinary one-way ANOVA, Brown-Forsythe and Welch ANOVA, or Kruskal-Wallis test was performed for multiple comparisons depending on the distribution and variances of the data. All data represent the mean ± SEM of a minimum of three independent experiments and data were considered statistically significant if the p value was < 0.05.

Study approval

The study protocol for tissue donation was approved by Northwestern Institute Review Board (IRB) and informed consents were obtained from all patients following an IRB-approved protocol.

MED12 mutations are associated with LM burden

Mutations in the MED12 gene are prevalent in uterine LM and thus have been implicated in LM tumor development[4]. In order to determine whether MED12 mutation rate is affected by the LM burden of the uterus, the incidence of MED12 mutations was analyzed on a large cohort of 529 tumors (Fig. 1a). Among them, 301 LM were from uteri with more than 5 LM, which we call LM-high (LM-H), 197 were from uteri with 1-4 leiomyomas, called LM-low (LM-L) and 31 were from uteri with an unknown number of LM/uterus (Fig. 1a, Table S1). We observed that the MED12 mutations were highly enriched at c.130-131 (55.0%), followed by deletions (10.6%) and other point mutations at eight other sites (9.3%; Fig. 1b). A significantly increased MED12 mutation rate was seen in LM-H compared to LM-L (79.7 % vs. 68.0%; p<0.01; Fig. 1c). Given the noticeable difference in MED12 mutations between LM-H and LM-L, we performed a comparative analysis of all mutation types including point mutations at c.130-131, other point mutations, and insertion/deletions, and observed that point mutations at c.130-131 and insertion/deletions were higher in LM-H compared to LM-L (p<0.01; Fig. 1d). When comparing the types of missense mutations at c.130-131, G>A (53.9% in LM-H, 60.6% in LM-L), followed by G>T, and G>C, no significant differences were noted between tumor number groups (Fig. 1e). MED12 mutation patterns and distributions in association with tumor number are summarized in Fig. S1a-1b. These data demonstrate that increased LM burden is associated with higher MED12 mutation rate, implicating the importance of the microenvironment that promotes MED12 mutations.

Transcriptome analysis reveals myometrium with LM has a high ROS burden and oxidative stress response

The mechanisms associated with the development of LM tumors remain unknown. The increased MED12 mutation when LM burden is high suggests that the signals from LM promote MED12 mutations. Our previous studies demonstrated that LM are under high oxidative stress related to ROS metabolic defects [9, 18]. In order to evaluate the naturally occurring ROS burden in the myometrium, we examined a subset of age-matched myometrial tissues from women with LM (MM^+LM) and without LM (MM^-LM). As ROS is able to oxidize deoxyguanosine in DNA, 8-OHdG was used as a biomarker for oxidative stress. Immunohistochemistry (Fig. 2a) and immunofluorescence staining (Fig. S2a) for 8-OHdG, were performed in MM^+LM or MM^-LM in a tissue microarray (TMA, Fig. 2a, 2b). Significantly higher immunoreactivity for 8-OHdG was observed in MM^+LM compared to MM^-LM (Fig. 2c; p<0.001), suggesting that MM^+LM have a higher ROS burden than MM^-LM. As oxidized DNA 8-OHdG accumulation has been found to overlap with DNA damage[22], we examined gH2AX, DNA damage in the same samples by immunofluorescence staining (Fig. S2b). Quantification of the gH2AX immunofluorescent signals was significantly higher in MM^+LM compared to MM^-LM (Fig. 2d).

To evaluate the gene expression differences in myometrium with and without LM, RNA sequencing analysis was performed in age-matched MM^+LM and MM^-LM. Expression analysis revealed a total of 3446 genes were significantly different between MM^+LM and MM^-LM (1596 upregulated and 1850 downregulated with p-value < 0.05 and absolute log2 fold change > 1) (Fig. 2e, Table S5). Volcano plots illustrated gene expression in fold change and level of significance and genes in ROS, DNA repair, p53, and hypoxia were highlighted and most of them were upregulated (Fig. 2f). Pathway analysis by Gene Ontology (GO) revealed cell proliferation and cell cycle, ROS pathways, DNA repair and DNA damage response pathways were strongly associated with MM^+LM (Fig. 2g). Gene Set Enrichment Analysis (GSEA) revealed that MM^+LM weresignificantly associated with ROS pathway, hypoxia, DNA repair, p53 pathway, estrogen response, and AKT signaling (Fig. 2h). Transcriptome and pathway analyses further defined defects in the uterine with LM in response to ROS stress.

Stable ROS-mediated 8-OHdG, DNA damage response, and global gene expression in myometrium can be recapitulated in vitro

To demonstrate that ROS directly promotes DNA oxidation and damage and changes genes expression, primary myometrial cells were treated with two ROS inducers, Paraquat (PQ) [18], and responses were measured. Following dose-response studies, myometrial cells were treated with 100 µM PQ for 24-48 hours which showed the greatest oxidative stress with minimal cell death (Fig. 3a). Fluorescent staining was performed to detect ROS (dihydroethidium [DHE]), oxidized DNA (8-OHdG), and DNA damage (gH2AX) (Fig. S3a-3b). Myometrial spheroids treated with PQ showed high ROS level (Fig. 3a) and histologic analysis showed no significant cytohistologic change or cell death on histology evaluation, however, a significant increase in immunoreactivity for 8-OHdG, and gH2AX were found in PQ-treated cells compared to untreated controls (Fig. 3b and 3c). Since apurinic/apyrimidinic (AP) sites are closely associated with 8-OHdG in genomic DNA mediated by OGG1, the primary enzyme responsible for the excision of 8-OHdG [23], we performed AP site analysis. As shown in Fig. 3d, primary myometrial cells treated with PQ resulted in a significantly higher number of AP sites in genomic DNA than controls. Together, these findings indicate that exposure of myometrial cells with ROS inducers causes DNA oxidation leading to 8-OHdG and DNA damage.

To evaluate the gene expression patterns in myometrial cells treated with PQ, RNA sequencing analysis was performed. After normalizing the data with an absolute log2 fold change cutoff of 1 (for Control vs. PQ), a total of 325 genes were dysregulated in cells treated with PQ (178 upregulated and 147 downregulated, Fig. 3e and 3f, Table S5). GSEA revealed the dysregulated genes aresignificantly associated with the ROS pathway, hypoxia, DNA repair, p53 pathway, estrogen response, and AKT signaling (Fig. 3g), consistent with findings in myometrial tissue with LM (Fig. 2g and 2h), suggesting common mechanisms of the ROS-mediated DNA damage response to these two compounds. Upregulation of AKT pathways by PQ (Fig. 2h and 3g) was consistent with our previous functional analysis [18]. Genes in ROS stress response and the DNA repair pathway were mostly upregulated in PQ treatment (Fig. S4a). The pathway connections and gene expression trends are summarized in Fig. S4b. These findings demonstrate a common effect of PQ on ROS metabolic pathways, with DNA damage response, specifically the base excision repair pathway were dysregulated in PQ treatment.

CRISPR/Cas9 editing of c.130^8-oxodGresults in DNA misrepair in myometrial cells

High ROS promotes DNA nucleotide oxidization, such as modified guanine 8-OHdG [22]. The 8-OHdG adduct, a typical product of oxidative DNA damage, can cause misrepair or mutation of guanine [15]. To demonstrate that oxidized guanine can indeed promote misrepair and mutations, CRISPR/Cas9 was used to replace guanine at codon44 c.130G of the MED12 gene with an oxidized derivative of deoxyguanosine, 8-oxo-dG adduct (c.130^8-oxodG). Technical details are summarized in Methods and Fig. 4a. c.130^8-oxodGand normal control were introduced into a myometrial cell line (myo-hTERT, Fig. 4b). c.130^8-oxodGmutations were detected by deep sequencing. Among a total of 15k reads, approximately 34.3% of c.130^8-oxodGshowed misrepair of G>T, A, C, as demonstrated by the large peak at c.130 in the myometrial cell line (Fig. 4b, Table S4). This data shows the extent of misrepair at this particular codon. In comparison, normal controls showed a baseline misrepair rate at c.130^G. To accurately calculate the misrepair rates at c.130^8-oxodG, an index nucleotide change at c.138^index (T>C, no amino acid change) along with c.130^8-oxodGfrom an ssDNA donor sequence was introduced into primary cultures of myometrial cells (n=3) and myo-hTERT cells. Misrepair at c.130^8-oxodGwas examined by a high depth deep sequencing analysis (depth of 500k to 1 million reads /sample, Fig. 4c, Fig. S5a). As shown in Fig. 4d (Table S4), the c.130^8-oxodGmisrepair rate in exon sequences with c.138^index was 16-46%. This is consistent with previous data from Manabu et al. [24] who used the TATAM (tracing DNA adducts in targeted mutagenesis) system to investigate the consequent mutations of synthetic 8-oxodG introduced into the human genome. The most common misrepair of c.130^8-oxodGwas G>T, accounting for 96.0%-99.4% of mutations, whereas G>A represented a small fraction (0.3%-3.8%) of total misrepair and G>C accounted for 0.1% -0.4% of misrepair (Fig. 4e). Furthermore, CRISPR/Cas9 targeted replacement of 8-oxodG at codon44 c.130 was reproducible in primary myometrial cells, but the success rate of site editing (based on presence of index c.138C) varied from case to case (ranging from 0.63 to 1.32%, Fig. S5b), consistent with published data [25]. Of note, structural changes accounted for more than 75% of sequences (Fig. 4d, Fig. S5b). Increased point mutations at c.123-126 AAAA might relate to the repeated adenosine sequence which is around the Cas9 cut site near the PAM site. (Fig. 4b and Fig. S5a). Taken together, this data demonstrates as proof of concept the significant consequences that the replacement of G with 8-OHdG has on misrepair and mutation.

PQ treatment induces misrepair of MED12 exon 2 in myometrial cells in vitro

Thus far, we have demonstrated that the myometrium from a uterus with LM exhibited increased ROS, that ROS inducers cause oxidation of DNA, 8-OHdG, which can eventually be misrepaired and mutated as demonstrated using replacement of G with oxidized G at c.130 of the MED12 gene. Next MM cells were exposed to either acute or chronic treatment with PQ (Fig. 5a) to determine the effects on exon2 of MED12. LM samples with known MED12 mutations served as positive controls and showed MED12 mutations at c.122, c.128, c.130, and c.130 were present at rates of 58.1, 25.0, 33.3, and 22.7%, respectively, based on a total of 50k reads/sample (n=4, Fig. 5b). Sequencing of MM samples treated with an acute or chronic dose of vehicle control (DMSO; Fig. 5c) showed a low mutation rate per nucleotide (acute: 0.12%; chronic: 0.10%) through the c.100-c.204 region (Fig. 5c). Twenty-four myometrial samples were treated with PQ once (acute) and the DNA sequence of MED12 exon 2 showed a higher rate of nucleotide alterations (average 0.42% per nucleotide) (Fig. 5d, Table S4). Of note, c.127C, c.130G and c.131G alterations reached an average rate of 0.56%, 0.46% and 0.49%, respectively. Among these, 11 out of 24 myometrial samples harbored misrepair of c.127C, and 2 out of 24 harbored misrepair of c.130-131GG above cut-off (Fig. 5d). A total of 15 myometrial samples were treated with PQ five times (chronic). Deep sequencing analysis revealed that overall baseline mutations/alterations were similar to those seen with acute treatment, with no statistical difference (average 0.417% vs. 0.416%, p>0.05). To our surprise, 6 of 15 myometrial samples harbored c.130G,131G mutations above the cut-off line with an average mutation rate per nucleotide reaching 0.52% (c.130G) and 0.57% (c.131G), respectively. Three of 15 myometrial samples in this group showed a high mutation rate at c.132T above the cut-off (Fig. 5e, Table S4). Interestingly, acute and chronic treatment resulted in different MED12 mutation hotspots (Fig. 5f), suggesting a potential cell selection mechanism or non-random targeted DNA strand breaks and repair [26]. Next, we analyzed the ratio of G/C and T/A mutations and found that the G/C mutation rate is significantly higher than the A/T mutation rate (Fig. 5f). When all guanines were extracted from MED12 exon 2 and the misrepair pattern of G>T, A, C examined, we found high G>A, followed by G>T, and G>C showed the lowest misrepair pattern (Fig. S6a). These findings suggest that in vitro ROS exposure can increase mutations in MED12 exon 2 and selected point mutations are non-randomly presented at unproportionally high rates above chance alone.

Duplex Sequencing confirms high rate of MED12 mutations in myometria with oxidative burden both in vitro and in vivo

Given the error rate of conventional deep sequencing, we used duplex sequencing technology to detect bona-fide mutations with high accuracy and low rate of error by single strand-nucleotide change, effectively eliminating the chance of PCR errors (see Methods). A new cohort of 16 myometrial cases was exposed to chronic PQ treatment and duplex sequencing was performed. A similar mutation pattern in exon 2 with high misrepair/mutations at c.130-131GG was observed (Fig. 6, Table S4). In the control group, 6 of the 16 samples detected c.130-131G mutation (Fig. 6b). In contrast, 11 of the 16 PQ-treated cells detect 0.024% to 0.73% of c.130-131G mutations (Fig. 6a). The G misrepair rate in the PQ-treated group was also higher than the control group (Fig. S6b). Altogether, these data provide strong evidence that ROS promotes MED12 c.130-131GG mutations in myometrial cells in vitro. This is a discovery of substantial value to the field as proof of concept showing hotspot mutations in MED12 caused by inducers of ROS in the myometrium. Findings support MED12 exon 2 mutations at c.130-131G can be induced by oxidative exposure in vitro and in vivo.

In this study, we addressed important gaps in knowledge regarding oxidative stress in the myometrium and MED12 mutations in LM development. As proof of concept, we demonstrated that ROS could promote MED12 mutations, at c.130-131 in exon 2, in myometrial cells, suggesting that mutation in this region could be an early, initiating event for LM. It is thought that the majority of LM result from transformations of a myocyte after a single genetic hit. Thus, there is high interest in the mutations found in MED12 in more than 70% of uterine LM. We have shown here, a significantly higher rate of MED12 mutations in uteri with a greater number of LM (Fig. 1). The positive correlation of MED12 mutations with LM tumor numbers in the uterus has been reported previously [26, 27], and the reason for this may surround the increased oxidative stress found with high numbers of LM occur, shown in this study.

The uterus is considered to be an organ that is naturally associated with high oxidative stress. The myometrium of reproductive-age women undergoes cyclic contractions promoting local hypoxia [28] and is subject to inflammation during the menstrual cycle and menses [29]. Estrogen enhances ROS through redox cycling in mitochondria or proinflammatory cytokines [30]. To maintain homeostasis of the tissue, detoxifying mechanisms are triggered to offset the harmful effects of ROS, including the activity of MnSOD, followed by catalase, glutathione peroxidases, and the antioxidative pathway (HO-1). Recently, we and others demonstrated that LM have insufficient detoxifying mechanisms, including reduced MnSOD activity [9], altered AKT signaling [18], and altered ROS-induced miRNA response[31] and NADPH oxidase complex profile [10]. Whether the early MED12 mutations are involved in driving these responses remains to be investigated.

ROS radical that induces most damage to DNA is hydroxyl radical. DNA damage plays a significant role in mutations, genetic instability, and epigenetic changes. Many kinds of oncogenes and tumor suppressor genes can suffer damage by oxidative stress causing mutations. The oxidized guanine (8-OHdG) is mutagenic, and many studies showed that levels of 8-OHdG are elevated in many different types of cancer. 8-OHdG can pair with both adenine and cytosine, but if the mismatch between adenine and guanine (A: G) is not repaired, there will be a transversion of regular pairs of adenine and thymidine (A: T), cytosine and guanine (C: G) that is the hallmark of oxidative mutagenesis [11, 15]. This mutation is commonly found in oncogenes and tumor suppressor genes. Detection of 8-OHdG misrepair induced by ROS has been tested at specific genes as well as globally [32] such as those found for K-Ras and p53 [11, 12]. Therefore, 8-OHdG is used as a biomarker for the evaluation of oxidative stress. In this study, we found a high oxidative burden in myometrium with LM. This was demonstrated by a significantly increased 8-OHdG in the genomic DNA of myometrial cells. Oxidized genomic DNA in association with MED12 mutations has never been investigated. MED12 mutations in LM are mostly found in exon 2 and the intron 1 -exon 2 boundary, with a dominant hotspot at codon44 c.130G-131G (Fig. 1) [4]. MED12 mutations occur in only a few tumor types, including LM and fibroadenoma of the breast [33] implicating selective mechanisms that are tissue-specific. We proposed in this study that increased ROS promotes 8-OHdG modifications which cause misrepair due to transversions of G nucleotide. If left unrepaired, 8-OHdG will base pair with dATP during replication to facilitate a stable G to T transversion.

It has been shown that the G to T transversion is the major targeted substitution mutation caused by the 8-OHdG base in mammalian cells [24]. A significantly high rate of 8-OHdG to T misrepair at codon44 c.130 (Fig. 4 and 5) in myometrial cells was detected. Notably, the overall frequency of mutations was not high and this is most likely attributed to the multiple repair systems that are in place, including BER and nucleotide excision repair (NER), that can repair oxidized nucleotides[34]. Specifically, OGG1 (8-hydroxyguanine DNA glycosylase) and MUTYH (MutY DNA Glycosylase) are specific BER enzymes that repair modified guanine 8-OHdG and are responsible for the integrity of ROS-induced DNA modification [34]. However, correction of 8-OHdG in vivo is not perfect, and a small fraction of misrepair and nucleotide transversions occur [24]. In this study, we found altered BER gene expression in myometrium and LM with increased 8-OHdG levels (Fig. 3), indicating the presence of single base repair responses in these cell types. This may be one explanation of why LM tumors are not ridden with mutations compared to other malignant tumors. It would be of interest to analyze other regions of the genome in our experimental model and compare them with naturally occurring mutations in LM.

The limitation of this study is that we only presented PQ-mediated MED12 mutations. Although PQ is a reliable oxidative inducer, it remains unknown whether PQ can reproduce ROS environment similar to nature uterus. Our preliminarydata (not shown) showed that other ROS inducers, such as KBrO₃ and H₂O₂ can induce MED12 mutations similar to PQ, but their reproducibility and remarkable genotoxic effects in global transcriptome make them less favorable in ROS-mediated mutation analysis. The transgenic models of SOD2 and NOX4 can be an excellent alternative in the future studies.

In summary, this is the first study to demonstrate the association between uterine oxidative stress and MED12 mutations arising through 8-OHdG misrepair. Further research is needed to understand how MED12 mutation in myometrial cells promotes transformation into LM tumors.

AP apurinic or apyrimidinic

BER base excision repair

Cas9 CRISPR associated protein 9

CRISPR clustered regularly interspaced short palindromic repeats

DHE dihydroethidium

DS duplex sequencing

FFPE formalin-fixed and paraffin embedded tissues

GSEA Gene Set Enrichment Analysis

GATK4 genome Analysis Toolkit 4

KBrO₃potassium bromate

LM leiomyoma

MED12 mediator complex subunit 12

NER nucleotide excision repair

8-OHdG 8-hydroxy-2′-deoxyguanosine

8-oxo-dG 8-oxo-2'-deoxyguanosine

PQ paraquat dichloride hydrate

ROS reactive oxidative species

SOD^K68Acdetoxify superoxide by protein acetylation at lysine 68

SOD^K122Acdetoxify superoxide by protein acetylation at lysine 122

TATAM tracing DNA adducts in targeted mutagenesis

Acknowledgments

We thank Drs. Serdar Bulun, Debabrata Chakravarti, and Changshun Shao for their valuable scientific discussion and team support. We thank Dr. Xinkun Wang and Matthew Schipma from the NUSeq Core for their technical support for deep sequencing. We thank Dr. Demircan Gursel, Bella Shmaltsuyeva, and Shanshan Zhang from the NU Pathology Core Facility for TMA and IHC work. We thank Mrs. Stacey Tobin and Dr. Ross McNally for their help in editing this manuscript.

Fundings

The authors have nothing to disclose. This study was supported by NCI (R01CA254367) and NICHD (P01HD057877).

Availability of data and materials

The datasets supporting the conclusions of this article are included within the article and Supplementary Information..

Ethics approval and consent to participate

This study was approved by Northwestern University IRB and study biospecimens were from consented patients. YL, XX, YF, BFK, SRK, JJK, JJW

Author contributions

Conceptualization: J.J.W. and J.J.K.; methodology: Y.L., J.J.W. and X.X.; investigation: Y.L. and J.J.W.; experiments: Y.L., X.X., Y.F. and J.J.W.; materials: J.J.W., J.J.K..; data analysis: Y.L. and J.J.W.; data curation: Y.L., J.J.W., and Y.F.; duplex sequencing-design and data analysis: H.A., S.R.K, Y.L. and B.F.K.; writing-original: J.J.W. and Y.L.; writing-review & editing: J.J.W., J.J.K., Y.L. and S.R.K.; supervision: J.J.W. and J.J.K.; project administration: J.J.K. and J.J.W.; funding acquisition: J.J.K. and J.J.W.

Consent for publication

All the participants of this study consented to the publication of this work.

Competing interests

The authors declare that they have no competing interests.

Bulun SE: Uterine fibroids. N Engl J Med2013, 369(14):1344-1355.
Catherino WH, Parrott E, Segars J: Proceedings from theNational Institute of Child Health and Human Development conference on the Uterine Fibroid Research Update Workshop. Fertil Steril2011, 95(1):9-12.
Cardozo ER, Clark AD, Banks NK, Henne MB, Stegmann BJ, Segars JH: The estimated annual cost of uterine leiomyomata in the United States. Am J Obstet Gynecol2012, 206(3):211 e211-219.
Makinen N, Mehine M, Tolvanen J, Kaasinen E, Li Y, Lehtonen HJ, Gentile M, Yan J, Enge M, Taipale Met al: MED12, the mediator complex subunit 12 gene, is mutated at high frequency in uterine leiomyomas. Science2011, 334(6053):252-255.
Bertsch E, Qiang W, Zhang Q, Espona-Fiedler M, Druschitz S, Liu Y, Mittal K, Kong B, Kurita T, Wei JJ: MED12 and HMGA2 mutations: two independent genetic events in uterine leiomyoma and leiomyosarcoma. Mod Pathol2014, 27(8):1144-1153.
Fletcher NM, Abusamaan MS, Memaj I, Saed MG, Al-Hendy A, Diamond MP, Saed GM: Oxidative stress: a key regulator of leiomyoma cell survival. Fertil Steril2017, 107(6):1387-1394 e1381.
Foksinski M, Kotzbach R, Szymanski W, Olinski R: The level of typical biomarker of oxidative stress 8-hydroxy-2'-deoxyguanosine is higher in uterine myomas than in control tissues and correlates with the size of the tumor. Free Radic Biol Med2000, 29(7):597-601.
Torres MJ, Kew KA, Ryan TE, Pennington ER, Lin CT, Buddo KA, Fix AM, Smith CA, Gilliam LA, Karvinen Set al: 17beta-Estradiol Directly Lowers Mitochondrial Membrane Microviscosity and Improves Bioenergetic Function in Skeletal Muscle. Cell Metab2018, 27(1):167-179 e167.
Vidimar V, Gius D, Chakravarti D, Bulun SE, Wei JJ, Kim JJ: Dysfunctional MnSOD leads to redox dysregulation and activation of prosurvival AKT signaling in uterine leiomyomas. Sci Adv2016, 2(11):e1601132.
Fletcher NM, Saed MG, Abuanzeh S, Abu-Soud HM, Al-Hendy A, Diamond MP, Saed GM: Nicotinamide adenine dinucleotide phosphate oxidase is differentially regulated in normal myometrium versus leiomyoma. Reprod Sci2014, 21(9):1145-1152.
Ziech D, Franco R, Pappa A, Panayiotidis MI: Reactive oxygen species (ROS)--induced genetic and epigenetic alterations in human carcinogenesis. Mutat Res2011, 711(1-2):167-173.
Olivier M, Hollstein M, Hainaut P: TP53 mutations in human cancers: origins, consequences, and clinical use. Cold Spring Harb Perspect Biol2010, 2(1):a001008.
Poetsch AR: The genomics of oxidative DNA damage, repair, and resulting mutagenesis. Comput Struct Biotechnol J2020, 18:207-219.
Sekiguchi M, Tsuzuki T: Oxidative nucleotide damage: consequences and prevention. Oncogene2002, 21(58):8895-8904.
Cheng KC, Cahill DS, Kasai H, Nishimura S, Loeb LA: 8-Hydroxyguanine, an abundant form of oxidative DNA damage, causes G----T and A----C substitutions. J Biol Chem1992, 267(1):166-172.
Lee TH, Kang TH: DNA Oxidation and Excision Repair Pathways. Int J Mol Sci2019, 20(23).
Aggarwal V, Tuli HS, Varol A, Thakral F, Yerer MB, Sak K, Varol M, Jain A, Khan MA, Sethi G: Role of Reactive Oxygen Species in Cancer Progression: Molecular Mechanisms and Recent Advancements. Biomolecules2019, 9(11).
Xie J, Xu X, Yin P, Li Y, Guo H, Kujawa S, Chakravarti D, Bulun S, Kim JJ, Wei JJ: Application of ex-vivo spheroid model system for the analysis of senescence and senolytic phenotypes in uterine leiomyoma. Lab Invest2018, 98(12):1575-1587.
Vidimar V, Chakravarti D, Bulun SE, Yin P, Nowak R, Wei JJ, Kim JJ: The AKT/BCL-2 axis mediates survival of uterine leiomyoma in a novel 3D spheroid model. Endocrinology2018.
Schmitt MW, Kennedy SR, Salk JJ, Fox EJ, Hiatt JB, Loeb LA: Detection of ultra-rare mutations by next-generation sequencing. Proc Natl Acad Sci U S A2012, 109(36):14508-14513.
Kennedy SR, Schmitt MW, Fox EJ, Kohrn BF, Salk JJ, Ahn EH, Prindle MJ, Kuong KJ, Shen JC, Risques RAet al: Detecting ultralow-frequency mutations by Duplex Sequencing. Nat Protoc2014, 9(11):2586-2606.
Amente S, Di Palo G, Scala G, Castrignano T, Gorini F, Cocozza S, Moresano A, Pucci P, Ma B, Stepanov Iet al: Genome-wide mapping of 8-oxo-7,8-dihydro-2'-deoxyguanosine reveals accumulation of oxidatively-generated damage at DNA replication origins within transcribed long genes of mammalian cells. Nucleic Acids Res2019, 47(1):221-236.
Pao PC, Patnaik D, Watson LA, Gao F, Pan L, Wang J, Adaikkan C, Penney J, Cam HP, Huang WCet al: HDAC1 modulates OGG1-initiated oxidative DNA damage repair in the aging brain and Alzheimer's disease. Nat Commun2020, 11(1):2484.
Yasui M, Kanemaru Y, Kamoshita N, Suzuki T, Arakawa T, Honma M: Tracing the fates of site-specifically introduced DNA adducts in the human genome. DNA Repair (Amst)2014, 15:11-20.
Yang L, Guell M, Byrne S, Yang JL, De Los Angeles A, Mali P, Aach J, Kim-Kiselak C, Briggs AW, Rios Xet al: Optimization of scarless human stem cell genome editing. Nucleic Acids Res2013, 41(19):9049-9061.
Bullerdiek J, Rommel B: Factors targeting MED12 to drive tumorigenesis? F1000Res2018, 7:359.
Heinonen HR, Pasanen A, Heikinheimo O, Tanskanen T, Palin K, Tolvanen J, Vahteristo P, Sjoberg J, Pitkanen E, Butzow Ret al: Multiple clinical characteristics separate MED12-mutation-positive and -negative uterine leiomyomas. Sci Rep2017, 7(1):1015.
Mayer A, Hockel M, Wree A, Leo C, Horn LC, Vaupel P: Lack of hypoxic response in uterine leiomyomas despite severe tissue hypoxia. Cancer Res2008, 68(12):4719-4726.
Wu B, Chen X, He B, Liu S, Li Y, Wang Q, Gao H, Wang S, Liu J, Zhang Set al: ROS are critical for endometrial breakdown via NF-kappaB-COX-2 signaling in a female mouse menstrual-like model. Endocrinology2014, 155(9):3638-3648.
Roy D, Cai Q, Felty Q, Narayan S: Estrogen-induced generation of reactive oxygen and nitrogen species, gene damage, and estrogen-dependent cancers. J Toxicol Environ Health B Crit Rev2007, 10(4):235-257.
Xu X, Kim JJ, Li Y, Xie J, Shao C, Wei JJ: Oxidative stress-induced miRNAs modulate AKT signaling and promote cellular senescence in uterine leiomyoma. J Mol Med (Berl)2018, 96(10):1095-1106.
Kucab JE, Zou X, Morganella S, Joel M, Nanda AS, Nagy E, Gomez C, Degasperi A, Harris R, Jackson SPet al: A Compendium of Mutational Signatures of Environmental Agents. Cell2019, 177(4):821-836 e816.
Lim WK, Ong CK, Tan J, Thike AA, Ng CC, Rajasegaran V, Myint SS, Nagarajan S, Nasir ND, McPherson JRet al: Exome sequencing identifies highly recurrent MED12 somatic mutations in breast fibroadenoma. Nat Genet2014, 46(8):877-880.
David SS, O'Shea VL, Kundu S: Base-excision repair of oxidative DNA damage. Nature2007, 447(7147):941-950.

supplFigures.pdf
Additional file 1. Supplementary Figures
Supplementarytables.xlsx
Additional file 2. Supplementary Tables
Graphicalabstract.png

Download PDF

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

Myometrial Oxidative Stress Drives MED12 Mutations for Leiomyoma development

Archived Versions:

Version 1

Abstract

Figures

Highlights

Background

Materials And Methods

Patient specimens

Cell culture and treatment

Myometrial spheroid/three-dimensional (3D) culture

DNA extraction and Sanger sequencing

AP Assay

RNA extraction and RT-PCR

Tissue microarray (TMA)

Immunohistochemistry

CRISPR/Cas9 and target sequence

RNA sequencing

RNA-seq data processing and analysis

Statistical analysis

Study approval

Results

Discussion

Conclusion

Abbreviations

Declarations

References

Supplementary Files

Archived Versions:

Version 1