Downregulation of Linc00173 increases BCL2 mRNA stability via the miR-1275/PROCA1/ZFP36L2 axis and induces acquired cisplatin resistance of lung adenocarcinoma

doi:10.21203/rs.3.rs-1518812/v1

Download PDF

Research Article

Downregulation of Linc00173 increases BCL2 mRNA stability via the miR-1275/PROCA1/ZFP36L2 axis and induces acquired cisplatin resistance of lung adenocarcinoma

https://doi.org/10.21203/rs.3.rs-1518812/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 10 Jan, 2023

Read the published version in Journal of Experimental & Clinical Cancer Research →

You are reading this latest preprint version

Background

LINC00173 had been reported as a cisplatin (cis-diamminedichloroplatinum, DDP) chemotherapy-resistant inducer in small cell lung cancer (SCLC) and lung squamous cell carcinoma (LUSC). Here, reversed data was displayed for LINC00173 as a DDP chemosensitivity-inducing factor in lung adenocarcinoma (LUAD).

Methods

LINC00173 was screened from GEO databases (GSE43493), then In situ hybridization and qRT-PCR were used to detect the expression level of LINC00173 in tissue samples and LUAD cell lines. Moreover, colony formation assay, cell viability and IC50 assays, flow cytometry, nude mouse tumor xenograft model were individually performed to certificate the effect of LINC00173 on LUAD in vitro and in vivo. The relationships between miR-1275 and LINC00173 or PROCA1 were identified by dual-luciferase reporter assay, as well as c-Myc binding with LINC00173 promoter. The direct binding of miR-1275 with LINC00173 was investigated c by RAP. ZFP36L2 protein bind to the 3’UTR of BCL2 was confirmed by RIP. The apoptosis related proteins (including c-CASP3, c-PARP and BCL2) and related signal proteins were analysed by Western blot.

Results

LINC00173 down-regulation in DDP-resistant LUAD patients was correlated with poor prognosis. Further, LINC00173 expression was significantly reduced in DDP-resistant LUAD cells and DDP-treated human LUAD tissues. Suppressed LINC00173 in LUAD cells enhanced DDP chemoresistance in vivo and in vitro, while restored LINC00173 in DDP-resistant LUAD cells markedly regained chemosensitivity to DDP. Mechanistically, DDP-resistant LUAD cells activated PI3K/AKT signal and further elevated c-Myc expression. C-Myc binds to the promoter of LINC00173 to suppress its expression. Reduced LINC00173 attenuated the adsorption of oncogenic miR-1275 and thus down-regulated the expression of miR-1275-target gene PROCA1. PROCA1 played a potential tumor-suppressive role inducing cell apoptosis and DDP chemosensitivity via recruiting ZFP36L2 to bind to the 3’UTR of BCL2, reducing the stability of BCL2 mRNA and thus activating apoptotic signal.

Conclusion

Our study demonstrated a novel and critical role of LINC00173 which was transcriptionally repressed by DDP activated PI3K/AKT/c-Myc signal in LUAD and thus promoted DDP-acquired chemotherapeutic resistance via regulating miR-1275 to suppress PROCA1/ZFP36L2-induced BCL2 degradation, leading to apoptotic signal reduction.

lung adenocarcinoma

LINC00173

PROCA1

ZFP36L2

apoptosis

BCL2 stability

Lung cancer is the leading cause of cancer mortality worldwide as shown by the poor survival and high relapse rates after surgery[1]. According to clinical features and pathological classification, lung cancer can be commonly divided into non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC)[2]. NSCLC is the predominant type of lung cancer, accounting for 85% of all lung cancer cases. Histologically, it consists mainly of squamous cell carcinoma (LUSC) and adenocarcinoma (LUAD). In recent years, LUAD incidence increased and it has gradually replaced LUSC as the most common histological subtype[2]. Cisplatin (cis-diamminedichloroplatinum, DDP)-based chemotherapy is utilized as one of the primary treatments for intermediate and advanced LUAD[3]. Unfortunately, acquired chemoresistance to DDP remains a major problem for their therapeutic outcomes[4]. Therefore, further clarifying the mechanism of acquired resistance to DDP in LUAD is urgently required.

In previous studies, some LncRNAs with dysregulated expression levels have been reported to be involved in the acquired drug resistance of neoplasms[5–8]. LINC00173 was introduced first in 2017, with the location on human chromosome 12q24.22 and a full length of 1597 bp[9]. Some studies have shown that LINC00173 plays a dual role in tumors, suggesting its complex role in the pathogenesis of malignancies[10–12]. Recently, LINC00173 was shown to be up-regulated in SCLC and LUSC, which promoted resistance to chemotherapeutic drugs[13, 14]. However, its role and mechanism in DDP resistance in LUAD have not been elucidated.

Here we perform a detailed investigation for LINC00173 in DDP-based drug resistance in LUAD. Our data clarify the down-regulation of LINC00173 and its chemosensitive role in DDP resistant LUAD via a newly discovered pathway and therefore indicate a potential clinical therapeutic target in LUAD, which is distinctly different from the roles of LINC00173 in SCLC and LUSC.

Cell lines and cell culture

The five human LUAD cell lines (H1299, H1650, H1975, A549, SPCA1) used in this study were obtained from the cell bank of the Chinese Academy of Sciences (Shanghai, China). The PC9 cell line was kindly provided by Sun Yat-Sen University Cancer Center (Guangzhou, China). Immortalized non-malignant human bronchial epithelial cells 16HBE were obtained from the Cancer Research Institute of Southern Medical University (Guangzhou, China). In this study, all the cells were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS, PAN, USA), 100 units/mL penicillin, and 100 mg/mL streptomycin and kept in a humidified atmosphere containing 5% CO₂at 37°C. To establish DDP-resistant A549 and PC9 cell lines, cells were treated with increasing concentrations of DDP (Sigma) from the initial concentration of 0.25μM to the final concentration of 6μM. DDP was added to the RPMI-1640 culture media for A549/DDP cells and PC9/DDP cells to maintain their DDP-resistant phenotype (with a final concentration of 6μM).

miRNA (mimics and inhibitor), siRNAs, plasmid, and lentivirus transfection

LINC00173 Smart Silencer (RiboBio, Guangzhou, China) was a mixture of 3 siRNAs with 3 antisense oligonucleotides that target different sites of the LINC00173 transcript. Compared with LINC00173 Smart Silencer, the negative control Smart Silencer did not contain domains sequences homologous to humans. The other siRNAs (including three si-ZFP36L2 fragments) and miRNAs (including miR-1275 mimics and miR-1275 inhibitor) were also designed and synthesized by RiboBio (Guangzhou, China). Transient transfections of all miRNAs and siRNAs were performed with riboFECT^TM CP reagent according to the manufacturer’s instructions. PROCA1 plasmid was established by Vigene Bioscience, Inc (Shandong, China). The human full-length LINC00173 was PCR-amplified from cDNA and cloned into the CMV-MCS-IRES-EGFP-SV40-Neomycin overexpression vector (GV146, Genechem, China). All reporter plasmids used in the luciferase reporter assay were obtained from IGE Biotechnology LTD (Guangzhou, China). Transient transfection of plasmids was conducted by Lipofectamine 3000 (Invitrogen, USA). The short hairpin RNA (shRNA) for human LINC00173 was cloned into a hU6-MCS-Ubiquitin-EGFP-IRES-puromycin lentiviral vector (GV248, Genechem, China). The sequences of smart-silencer, siRNAs or shRNA, miR-1275 mimics, miR-1275 inhibitor and their corresponding negative control were listed in Supplementary Table 1. All lentiviral particles were provided by Shanghai Genechem Co., LTD. For lentivirus infection, 2×10⁴ cells were seeded into 24 well plates and infected with the proper lentivirus or control lentivirus (as negative control) at a multiplicity of infection (MOI) of 20. Puromycin (Meilunbio, Dalian, China, 3μg/ml) was used to screen the stably transduced cells and the infection efficiency was assessed under a fluorescence microscope (Nikon, Japan).

Patients and tissue specimens

Paraffin-embedded tissue samples from 129 LUAD patients treated with platinum-based multi-drug chemotherapy were made as tissue microarray (TMA) and obtained from the Second Xiangya Hospital of Central South University (Hunan, China). The clinicopathological features of 129 LUAD patients were summarized in Supplemental Table 2. Data regarding tumor stage was determined according to the pathology Tumor-Node-Metastasis (pTNM) system (AJCC/UICC 2015). Histological types were determined according to the World Health Organization classification for LUAD. According to previous studies [13,15,16], the above LUAD patients were defined as either platinum-resistant or platinum-sensitive.

In situ hybridization (ISH)

The expression level of LINC00173 in 129 paraffin-embedded LUAD specimens was detected by in situ hybridization. The TMA sections were dewaxed in xylene, rehydrated through an ethanol gradient, and then treated with 3% H₂O₂for 10 min. Subsequently, sections were treated with pepsin dilution in 3% fresh citrate buffer at 37℃ for 30min and then washed with PBS. LINC00173 digoxygenin-labeled probes were designed and synthesized by BersinBio (Bersin Biotechnology Co. Ltd, Guangzhou, China) (Probe sequence: 5’-Dig-CGTGATCTGAGTACATGTAGGATAAATGACCCCAGGCAAGGC-3’). Further, hybridization was performed with LINC00173 probes at 75℃ for 5min and quickly transferred to 42℃ and incubated overnight. Then sections were incubated with anti- digoxygenin HRP Fab fragments at 37℃ for 1h. All slides were scanned using the iViewer scanning system (UNIC, Beijing, China) and quantified with staining index (ranging from 0 to 9), which was evaluated by multiplying the percentage of positively stained cells (0: 0-25%; 1: 26-50%; 2: 51-75%; 3: 76-100%) and staining intensity (0: negative; 1: weak; 2: moderate; 3: strong)[17,18]. The staining index of each sample was scored by two independent pathologists and averaged.

Quantitative real-time polymerase chain reaction (qRT-PCR)

Cellular RNA was extracted from LUAD cells using TRIzol reagent (Thermo Scientific, USA) and then reverse transcribed to cDNA using a Quantscript RT Kit (Takara, Japan). The qRT-PCR analysis was performed on an AriaMx Real-Time PCR (Agilent, USA) system using standard procedures. GAPDH was used as a loading control, and the primer sequence was as follows: forward: 5’-CGGAGTCAACGGATTTGGTCGTAT-3’, reverse: 5’-AGCCTTCTCCATGGTGGTGAAGAC-3’. The other primers used for the qRT-PCR analyses were listed in Supplementary Table 3.

Western blot analysis

Western blotting was performed as described previously [19]. Blotting bands were then incubated with primary antibodies overnight at 4°C. Antibodies against the following proteins were used: c-PARP (Cell Signaling Technology #5625, 1:1000), PROCA1 (Biorbyt #orb1703, 1:1000), ZFP36L2 (Santa Cruz #sc-365908, 1:1000), c-Myc (Cell Signaling Technology #9402, 1:1000), phosphor-AKT (Cell Signaling Technology #4060, 1:1000), AKT (Cell Signaling Technology #4691, 1:1000), phosphor-PI3K (Cell Signaling Technology #17366, 1:1000), and PI3K (Cell Signaling Technology #4292, 1:1000). Internal reference antibodies were used: GAPDH (Cell Signaling Technology #5174, 1:1000), β-Tubulin (Proteintech #10068-1-AP, 1:1000). Secondary antibodies used as follows: HRP-conjugated Affinipure Goat Anti-Rabbit IgG(H+L) (Proteintech #SA00001-2, 1:5000) and HRP-conjugated Affinipure Goat Anti-Mouse IgG(H+L) (Proteintech #SA00001-1, 1:5000) were purchased from Proteintech (Rosemont, IL, USA). Images were captured by chemiluminescence (Bio-rad, Hercules, California) and quantitated using a Quantity One system (Bio-Rad, Hercules, CA, USA).

Colony formation assay

Cells at a density of 200 cells/well were seeded in six-well plates. For the DDP-treated group, a medium containing DDP of 2μM or 6μM was added respectively to the parental cells (A549 and PC9) or DDP-resistant cells (A549-DDP and PC9-DDP) after cell adhesion. The generated colonies were fixed with methanol for 30 min after culturing for 10-14 days. Subsequently, colonies were stained with a crystal violet solution. The colonies composed of more than 50 cells in a well were counted under a microscope.

Cell viability and IC50 assays

For cell viability assays, 2×10⁴ LUAD cells were seeded into 96-well plates, DDP was added after cell attachment and cell viability was detected by CCK8 reagent after 72h. The absorbance at 450 nm measured in cell-free wells was used as blank.

For IC50 assays, 1-2×10⁴LUAD cells were inoculated into a 96-well plate. Medium containing an increasing concentration of DDP (0μM, 0.25μM, 0.5μM, 1μM, 2μM, 4μM, 8μM, 16μM, 32μM, 64μM) was added to the wells after cell attachment. Then, the plate was incubated for 48h in a humidified atmosphere containing 5% CO₂at 37°C. Analysis was performed according to the instructions of the CCK8 manufacturer, and the IC50 value to DDP was calculated using GraphPad Prism v5.0 software (GraphPad Software Inc., La Jolla, CA, USA).

Apoptosis

Annexin-V/propidium iodide (PI) was applied to quantify the number of apoptotic cells. Cells transfected with smart-silencer for LINC00173 depletion or negative control were exposed to 3μM DDP for 24h. Both floated and adherent cells were collected and then resuspended in binding buffer and stained with FITC-Annexin-V and PI (BestBio, Shanghai, China). Stained cells were quantified by flow cytometer (Biosciences, NJ, USA) according to the manufacturer’s directions.

Luciferase reporter assays

Online software DIANA (http://diana.imis.athena-innovation.gr/) predicted that miR-1275 binds to LINC00173 as shown in Figure 3d. The RNA sequence of LINC00173 containing the putative wild-type binding sites or mutant binding sites for miR-1275 was inserted into the psiCHECK-2 vector to construct the luciferase reporter vector psi-CHECK-2-LINC00173-WT or psi-CHECK-2-LINC00173-MUT (named respectively as LINC00173-WT or LINC00173-MUT). PROCA1 was predicted to be directly regulated by miR-1275 using prediction software (TargetScan), as shown in Fig. 3i. The predicted 3’UTR fragment of PROCA1 recognized by miR-1275 was inserted into the psiCHECK-2 vector (named as ‘PROCA1-WT’). GeneTailor system (Invitrogen) was used to perform site-directed mutagenesis of the miR-1275 binding site at the PROCA1 3’UTR (named as ‘PROCA1-MUT’). Subsequently, cells were co-transfected with WT or MUT psi-CHECK2 vector and miR-1275 or miR-inhibitor. The 2000bp upstream of LINC00173 transcriptional start site were analyzed by PROMO (http://alggen.lsi.upc.es/cgi-bin/promo_v3/promo/promoinit.cgi?dirDB=T-F_8.3) to identify the possible binding transcriptional factors. A c-Myc binding site was found in the promoter region of LINC00173 (Fig. 7a). The LINC00173 promoter sequences containing wild or mutant types of c-Myc binding sites were synthesized and constructed into the psi-CHECK-2 vector (named as LINC00173-WT or LINC00173-MUT). Then, LINC00173-WT or LINC00173-MUT were respectively co-transfected into A549 cells together with the c-Myc or control plasmid. Luciferase activity was measured at 48h after transfection using the dual-luciferase reporter assay (Promega Corporation, Madison, WI, USA) kit according to the manufacturer’s instructions. The detected relative luciferase activity was normalized to the Renilla luciferase activity.

RNA antisense purification (RAP) and RNA immunoprecipitation (RIP) assay

RAP assay was performed with the RAP Kit (Axl-bio, Guangzhou, China). We crosslinked 1×10⁸ cells to fix endogenous RNA complexes and then purified these complexes through hybrid capture with biotinylated antisense oligos. According to the number of probes (probe sequence: AGCGTGTGCAGGACTTAGCTTTG CTCTTGCACTGAGA; ATAGAAGGTCCCCCACGGGGACTTGGGAAGGCAC AGAGAACGCTCCCT; ATAAACAAGCTGTGACAGGTGATCATTCATCATAT TCCGCTGAACGTTCCA), streptavidin beads were prepared for RAP and NC groups. A high-Sensitivity DNA kit （Vazyme, Q311）was used to examine DNA fragment sizes. The extracted RNA was then verified by qRT-PCR.

RIP assays were performed using a Magna RIP™ RNA Binding Protein Immunoprecipitation Kit (Millipore, MA, USA, #MAGNARIP01). 1×10⁷cells were cultured in 75 cm²cell culture flasks and then harvested using RIP lysis buffer. ZFP36L2 antibody (Santa Cruz #sc-365908) or normal mouse lgG (Negative control) were pre-incubated with Magnetic beads to form a magnetic bead–antibody complex. Subsequently, cell lysates were incubated with the bead–antibody complex overnight at 4°C. The extracted RNA was then verified by qRT-PCR. All steps of RAP and RIP assays were performed according to the kit manufacturer’s instructions.

Chromatin immunoprecipitation (ChIP) assay

According to the manufacturer’s instructions, a ChIP assay kit (Thermo, MA, USA, #26156) was used to determine whether c-Myc binds to the promoter of LINC00173 in A549 and A549/DDP cells. Micrococcal nuclease was used to cut the cross-linked DNA to a length of 200–500 base pairs which was then subjected to an immuno-selection process, which requires the use of an anti-c-Myc antibody (Cell Signaling Technology #13987). Ultimately, the agarose gel electrophoresis results demonstrated whether the DNA fragment of the putative c-Myc binding site was present in the LINC00173 promoter.

Co-immunoprecipitation (Co-IP) assay

According to the manufacturer’s instructions, a Co-IP kit (Thermo, MA, USA, #26149) was used to detect whether PROCA1 binds to ZFP36L2. Proteins were extracted from A549 or A549/DDP cells, and their concentration was quantified. A total of 300μg of protein was incubated with 10μg of specific ZFP36L2 antibody (Santa Cruz #sc-365908) or IgG control overnight at 4°C. After elution, the proteins binding with ZFP36L2 were subjected to Western blot analysis. IgG was used as a negative control. One percent of the sample was used as input.

Immunofluorescence

For the Immunofluorescence assay, 100-200 cells were seeded on a glass-bottom dish. After 48 hours of culture, cells were washed with PBS and fixed in 4% paraformaldehyde for 15min. The cells were permeabilized using 0.1% Triton X-100 in PBS before antibody incubation. Images were captured using a Zeiss confocal fluorescence microscope (LSM 800, Oberkochen, Germany) and ZenPro software 2011 (AZoM.com Limited, UK). Antibodies used in this assay were listed in the methods for Western Blot analysis.

Animal experiments

Twenty female BALB/c nude mice (3-4 weeks old) were randomly divided into two groups and injected subcutaneously into the flanks with A549 NC control cells or A549 shLINC00173-1 cells (6×10⁶cells), respectively, in 50μl PBS mixed with 50μl matrigel matrix (Corning, USA, #354234). Subsequently, mice were monitored and recorded for xenograft development every other day. Next, the 10 mice in the A549 NC group or A549 shLINC00173-1 group were randomly divided into two subgroups when the tumors reached a diameter of 5mm in size and treated respectively with an intraperitoneal injection of DDP (3mg/kg) or an equal volume (100μl) of normal saline (NS) every 2 days for 2 weeks. The mice were sacrificed by cervical dislocation and the xenograft tumors resected from mice were weighted and then examined with routine tissue processing. All animal experiments were conducted according to standards regarding the use of laboratory animals. The protocols for animal experiments complied with the requirements of the Institutional Animal Ethical Committee, Experimental Animal Center of Guangzhou Medical University, China.

Statistical analysis

All data were analyzed using the SPSS16.0 software (IBM Corp., Armonk, NY, USA) and GraphPad Prism v5.0 software (GraphPad Software Inc., La Jolla, CA, USA). Data were presented as mean ±SD. Statistical significance was determined using the Student’s two-tailed t-test between two groups and one-way analysis of variance (ANOVA) for multiple groups. ISH analysis results were analyzed by the chi-square (χ²) test. Survival analysis was performed using the Kaplan–Meier method. P value< 0.05 indicated statistical significance (*P<0.05, **P<0.01, ***P<0.001, ****P<0.0001).

Down-regulated LINC00173 in DDP-resistant LUAD patients correlates with poor prognosis

To investigate the specific mechanism of DDP-based resistance in LUAD, we used bioinformatics analyses on the RNA-seq data (GSE43493) of the GEO database to screen the differentially expressed LncRNAs between LUAD DDP-resistant A549-DDP cells and its parental A549 cells. Eight LncRNAs were found to exhibit the most significant difference (Fig. 1a). DDP-resistant A549-DDP and PC9-DDP cell lines were established by gradually dosing A549 and PC9 cells with DDP in vitro until their IC50 value was significantly increased (Supplementary Fig. 1a and b). Subsequently, qRT-PCR detection identified that LINC00173 was the most significant down-regulated LncRNA in both A549-DDP and PC9-DDP resistant cells compared to their parental A549 and PC9 cells (Fig. 1b and 1c). To evaluate the association between LINC00173 dysregulation and the response to DDP-based chemotherapy in LUAD patients, we further examined LINC00173 expression by in situ hybridization (ISH) in a restricted cohort of locally advanced LUAD treated with DDP-based multi-drug chemotherapy. As shown in Fig. 1d, LINC00173 was mainly expressed in the cytoplasm.Of all the 129 patients, 86 were defined as platinum-resistant, whereas the other 43 patients were evaluated as platinum-sensitive. Low expression of LINC00173 was observed in 46/86 platinum-resistant cases (53.5%), whereas only in 14/43 platinum-sensitive cases (32.6%). There was a significant association between LINC00173 low expression and chemotherapeutic resistance in LUAD patients (p=0.027, Supplementary Table 4). Notably, Kaplan-Meier survival analysis showed that LUAD patients with low expression of LINC00173 had poorer overall survival (p=0.048, Fig. 1e). LINC00173 expression level was also detected in various LUAD cell lines (H1299, H1650, H1975, A549, PC9, SPCA1) and immortalized human bronchial epithelial cells 16HBE. Interestingly, by contrast with its expression level in 16HBE cells, endogenous expression of LINC00173 showed inconsistency in diverse LUAD cell lines (Supplementary Fig. 1c). Taken together, our data suggested that LINC00173 was down-regulated in DDP-resistant LUAD and contributed to the chemotherapeutic resistance and poor prognosis of LUAD patients.

Targeting LINC00173 desensitizes LUAD cells to DDP treatment in vitro and in vivo

To confirm the role of LINC00173 in DDP chemoresistance, lentivirus-mediated shRNAs specifically targeting LINC00173 were introduced to establish LINC00173 stable silenced cells A549-shLINC00173 and PC9-shLINC00173 (Supplementary Fig. 2a). Subsequently, plate cloning, cell viability, and IC50 value experiments were conducted after treatment with DDP. The results indicated that both colony formation and cell viability were enhanced in LINC00173-deleted LUAD cells in the presence of DDP (Fig. 2a and 2c). Meanwhile, LINC00173 down-regulation restrained the chemosensitivity of LUAD cells, with a significant increase in IC50 value (Fig. 2b). However, the above results were not obtained in absence of DDP (Supplementary 2b and 2c). Correspondingly, LINC00173 overexpression in DDP-resistant A549-DDP and PC9-DDP cells was implemented to ensure the effect of LINC00173 on DDP resistance. After the successful overexpression of LINC00173 (Supplementary Fig. 3a), IC50 value, cell viability, and colony formation of DDP-resistant cell lines were sharply decreased in the presence of DDP (Supplementary Fig. 3b, 3c, and 3d), but the percentage of apoptotic cells was notably ascended (Supplementary Fig.3e), implying the rescued chemosensitivity to DDP by LINC00173 transfection. These results suggested that LINC00173 is possibly involved in LUAD cell sensitization to DDP. To determine whether LINC00173 affects the sensitivity of LUAD cells to DDP, LINC00173 silenced cells (A549-sh1/2 and PC9-sh1/2) or control shRNA cells (Scramble) were labeled with GFP as a transfection indicator, while their parental A549 and PC9 cells were labeled with DsRed. An equal number of GFP-labeled LINC00173 shRNA1/2 transfected cells and DsRed-labeled parental cells were then mixed and treated with DDP for 48 hours. After the incubation with DDP, the proportion of DsRed-labeled cells was significantly reduced and the proportion of GFP-labeled cells was elevated in the LINC00173 depletion group, whereas in the control shRNA-transfected group (Scramble), neither the proportion of DsRed-labeled nor GFP-labeled cells changed (Fig. 2d). This detection further verified that LINC00173 depletion markedly augmented LUAD resistance to DDP. To confirm that the chemoresistance to DDP caused by LINC00173 depletion was due to the inactivation of apoptosis, we performed cell apoptosis assays with flow cytometry and detected hallmark proteins in the apoptotic pathway with immunoblotting. Apoptosis assays were performed with the Smart Silencer to transiently repress the expression of LINC00173 (Supplementary Fig. 2d). As shown in Fig. 2e and 2f, the apoptotic cells and apoptotic protein markers cleaved PARP (c-PARP) and cleaved Caspase-3 (c-CASP3) notably diminished in the LINC00173 knockdown group relative to the control group, whereas the critical apoptosis suppressor BCL2 was elevated after LINC00173 depletion when treated with DDP. Nevertheless, in the absence of DDP, there was no significant difference between LINC00173-depleted cells and control LUAD cells in apoptosis assays and apoptosis-related proteins detection (Supplementary Fig. 2e and 2f). An in vivo investigation was then conducted by subcutaneously inoculating LINC00173-depleted and control A549 LUAD cells into the flank of nude mice. After DDP treatment every other day for 2 weeks, tumors of A549-shLINC00173-1 were found markedly larger compared to that of A549 cells with scrambled shRNA (Fig. 2g, 2h, and 2i), which further affirmed the effect of LINC00173 on LUAD chemotherapeutic sensitivity to DDP. Besides, tumors in both LINC00173 silenced and control groups after normal saline injection didn’t show any significant difference (Fig. 2g, 2h, and 2i). The above results demonstrated that in the presence of DDP, LINC00173 depletion conspicuously triggered the chemoresistance of LUAD cells to DDP by inactivating cell apoptosis, suggesting LINC00173 might be a key factor in acquired chemoresistance in LUAD.

LINC00173 promotes PROCA1 expression by acting as a competing endogenous RNA for miR-1275

To further study the specific mechanism of action of LINC00173, weighted gene co-expression network analysis (WGCNA) was applied to screen genes closely related to LINC00173 (Fig. 3a), and fifteen candidates were found to display significant differential expression. QRT-PCR analyses verified the alteration of their expression after LINC00173 depletion in A549 and PC9 cells. Of the fifteen candidate genes, only GRIN2D and PROCA1 in both A549 and PC9 cells exhibited consistent expression variation after LINC00173 depletion, among which PROCA1 expression was positively correlated with LINC00173 expression (Fig. 3b). PROCA1 caught our attention because the correlation index between LINC00173 and PROCA1 was as high as 0.517 (Fig. 3c) when we compared the expression correlation between LINC00173 and the above candidates in the LUAD TCGA database. Besides, bioinformatics analysis in the same RNA-seq data (GSE43493) with LINC00173 screening data set showed that PROCA1 was found down-regulated in LUAD DDP-resistant A549-DDP cells, which was consistent with the down expression of LINC00173 (Supplementary Fig. 4a). The ISH assay described in Fig 1 exhibited that LINC00173 was mainly expressed in the cytoplasm of LUAD (Fig. 1d). Due to the reports that cytoplasmic LncRNAs frequently function as competing endogenous RNAs (ceRNAs) to regulate downstream mRNAs by sponging micro RNAs (miRNAs)[20,21], it raised our interest to explore the potential activity as ceRNA of LINC00173 in LUAD. DIANA database (http://carolina.imis.athenainnovation.gr/diana_tools/web/index.php) was used to screen miRNAsinteractingwith LINC00173 and miR-1275 was found as a predicted target. QRT-PCR analyses revealed that endogenous miR-1275 expression level in DDP-resistant LUAD cells could be significantly depressed by LINC00173 overexpression and restored with the addition of miR-1275 mimics (Supplementary Fig. 4b). Luciferase reporter assay revealed that miR-1275 mimics significantly inhibited the luciferase reporter activity of LINC00173, but not of mutant LINC00173 in A549-DDP cells (Fig. 3d). RNA antisense purification (RAP) assay further verified the direct binding of miR-1275 with LINC00173 in A549 LUAD cells (Fig. 3e and 3f). To further investigate the correlation between miR-1275 and PROCA1, the endogenous mRNA expression level of miR-1275 and PROCA1 was measured in DDP-resistant and their parental LUAD cells. The data showed that miR-1275 expression level was remarkably increased in DDP-resistant LUAD cells whereas PROCA1 was reduced compared to the corresponding parental cells (Supplementary Fig. 4c and 4d), implying that miR-1275 expression was negatively associated with PROCA1 and both of them may take part in the resistance of LUAD cells to DDP. Interestingly, when analyzing the target genes of miR-1275 with TargetScan, PROCA1 was found as a potential target of miR-1275. QRT-PCR and western blot assays were respectively performed to assess whether miR-1275 could suppress the expression of PROCA1 at the mRNA and protein level. The results indicated that miR-1275 mimics down-regulated PROCA1 mRNA and protein expression in A549 and PC9 cells (Supplementary Fig. 4e and Fig. 3g), while miR-1275 inhibitors up-regulated PROCA1 at both mRNA and protein level in DDP-resistant LUAD A549-DDP and PC9-DDP cells (Supplementary Fig. 4f and Fig. 3h). To further confirm that miR-1275 directly binds to the 3’UTR of PROCA1, we constructed luciferase reporters with wild-type (psiCHECK-2/PROCA1-wt-PROCA1 3´UTR) and mutant-type of PROCA1 (psiCHECK-2/PROCA1-mut-PROCA1 3´UTR). The wild-type or mutant-type of PROCA1 vector were respectively co-transfected into A549 cells with miR-1275 mimics or inhibitors. As shown in Fig. 3i, up-regulating miR-1275 by its mimics diminished the luciferase activity, while down-regulating miR-1275 by inhibitors augmented the luciferase activity compared to either mutant or empty vector controls, indicating that PROCA1 was a downstream target of miR-1275. Collectively, these findings suggested that LINC00173 functioned as a ceRNA to positively regulate PROCA1 by sponging miR-1275 in LUAD.

LINC00173 attenuates DDP-resistance in LUAD by mediating the miR-1275/PROCA1 axis

According to the aforementioned data, we preliminarily hypothesized that LINC00173 directly binds with miR-1275 to abrogate its inhibition of PROCA1. As shown in Supplementary Fig. 4c and 4d, we have verified miR-1275 and PROCA1 might be involved in the resistance of LUAD to DDP. Next, the role of PROCA1 and miR-1275 in LINC00173 mediated DDP chemoresistance was determined in LUAD. Functional detections further revealed that the IC₅₀ value to DDP was markedly elevated in miR-1275 mimics transducted LUAD cells (Supplementary Fig. 4g), while it was reduced in DDP resistant LUAD cells transducted with miR-1275 inhibitor (Supplementary Fig. 4h). Subsequently, a series of retrieval assays were designed to identify the effect of PROCA1 and miR-1275 on LINC00173 mediated DDP resistance. First, miR-1275 inhibitors were transducted into LINC00173 stably silenced cells and treated with DDP, it was found that the repression of miR-1275 abolished the promotion of IC₅₀ value, cell viability, colony formation, and apoptotic inhibition induced by LINC00173 depletion in the presence of DDP (Supplementary Fig. 5a and 5b, Fig. 4a and 4b). Moreover, with the addition of miR-1275 inhibitor, western blot analyses showed a change of apoptotic protein levels including the enhanced cleavage of Caspases 3 (c-CASP3) and PARP (c-PARP), and the concomitant reduced expression of anti-apoptotic protein BCL2 (Supplementary Fig. 5c). These findings indicated that LINC00173 accelerated apoptosis to enhance the sensitivity of LUAD cells to DDP by inhibiting miR-1275. Next, similar results were observed when PROCA1 was introduced into LINC00173 silenced LUAD cells where PROCA1 reversed the stimulative effect of LINC00173 depletion on colony formation (Fig. 4c), IC₅₀ value (Fig. 4d), cell viability (Supplementary Fig. 5d), and apoptotic inhibition (Supplementary Fig. 5e) in the presence of DDP. Furthermore, PROCA1 was co-transfected with miR-1275 mimics to identify their regulatory relationship in LUAD resistance to DDP. We discovered that the addition of PROCA1 notably abrogated the promotive role of miR-1275 in colony formation (Fig. 4e), IC₅₀ value (Fig. 4f), and cell viability in the presence of DDP (Supplementary Fig. 5f). Together, LINC00173 abrogated chemotherapeutic resistance by acting as a ceRNA to bind miR-1275 and thus abolished its transcriptional repression of PROCA1 in LUAD.

PROCA1 interacts with ZFP36L2 to reduce BCL2 mRNA stability and activate the mitochondrial apoptosis pathway

To illustrate the regulatory mechanism of PROCA1 participating in LUAD apoptosis and chemotherapeutic resistance, BioGRID (https://thebiogrid.org/) online analysis was utilized to identify PROCA1 interacting proteins. ZFP36L2 was screened as a candidate and then we preliminary identified by qRT-PCR and western blot (Fig. 5a) that ZFP36L2 expression was significantly decreased in A549-DDP and PC9-DDP cells compared with their control cells, implying a role for ZFP36L2 in LUAD chemoresistance to DDP. Endogenous Co-immunoprecipitation (Co-IP) confirmed that PROCA1 interacted with ZFP36L2 in both A549 and A549-DDP cells (Fig. 5b). Next, co-localization of PROCA1 and ZFP36L2 in A549-DDP cytoplasms was observed by immunofluorescence confocal microscopy (Fig. 5c), further visually confirming their interaction. ZFP36L2 was previously reported as a member of the ZFP36 family and is an RNA binding protein (RBP) containing CCCH zinc finger structure interacting with Au rich elements (AUUUA sequence) in the 3'UTR of mRNA to accelerate the degradation of mRNA or inhibit protein translation [22,23]. Fortunately, a previous study had demonstrated there is an AUUUA sequence in the BCL2 mRNA sequence [24]. Therefore, we hypothesized that ZFP36L2 could bind to BCL2 mRNA and then confirmed the existence of a putative binding site at the 3'UTR of BCL2 (Fig. 5d). RNA binding protein immunoprecipitation (RIP) analysis further verified the binding of endogenous ZFP36L2 protein to endogenous BCL2 mRNA (Fig. 5e). Based on these results, we then sought to identify the effect of ZFP36L2 on BCL2 mRNA stability. Three independent small interfering RNAs (siRNAs) targeting ZFP36L2 were designed to downregulate the expression of ZFP36L2, among which the two with higher interfering efficiency were chosen to perform the subsequent assays (Fig. 5f). Actinomycin D (Act-D) treatment was applied to assess the stability of BCL2 mRNA. After the inhibition of ZFP36L2, cells were incubated with Act-D and collected to detect BCL2 expression at 0, 2, 4, 6, 8, and 10 hours, respectively. BCL2 mRNA degradation was monitored by qRT-PCR analyses. As shown in Fig. 5g, the half-life of BCL2 mRNA was approximate 2 hours in control cells, while the degradation of BCL2 mRNA was significantly delayed in ZFP36L2 depleted cells, suggesting that ZFP36L2 down-regulation contributed to BCL2 stabilization. BCL2 is well known as a key anti-apoptotic gene involved in inhibiting the mitochondrial apoptosis pathway[25,26]. Therefore, we further explored the expression of several critical factors in this pathway. As expected, an increase in BCL2 and reduction in cleaved-PARP and cleaved-caspase3 were observed following ZFP36L2 depletion, indicating that the apoptotic pathway was inactivated (Fig. 5h). Taken together, these data demonstrated that PROCA1 recruited ZFP36L2 to impair the stability of BCL2 mRNA and thus activated the apoptotic pathway.

PROCA1/ZFP36L2/BCL2 axis is essential for LINC00173 mediated chemosensitivity to DDP in LUAD

In the previous experiments, we have elucidated that PROCA1 was crucial to improving the efficacy of DDP against LINC00173-depleted LUAD cells (Fig. 4c, 4d, and Supplementary Fig. 5d, and 5f). In this part, we further confirmed in DDP-resistant cells that PROCA1 was upregulated after LINC00173 overexpression (Fig. 6a). Co-IP assays were applied to identify the binding of PROCA1 with ZFP36L2 affected by LINC00173. The data showed that PROCA1 pulled down by ZFP36L2 was visibly reduced when LINC00173 was interfered in A549 cells, whereas an opposite result was achieved in A549-DDP cells when LINC00173 was over-expressed (Fig. 6b), implying the expression level of LINC00173 positively determined the recruitment of PROCA1 to ZFP36L2. Subsequently, BCL2 mRNA stability was measured by qRT-PCR at different time points after Act-D treatment. When knocking down LINC00173 in A549 cells, the half-life of BCL2 mRNA was extended (Fig. 6c). Nevertheless, the half-life of BCL2 mRNA was shortened in LINC00173 over-expressed A549-DDP cells (Fig. 6d), along with the diminished protein level of BCL2 and the augmented expression of downstream apoptotic proteins cleaved-PARP and cleaved-caspase3 (Fig. 6a). Collectively, LINC00173 sensitized LUAD cells to DDP via enhancing the binding of PROCA1 with ZFP36L2, which accelerated the degradation of BCL2 mRNA and further activated the mitochondrial apoptotic pathway.

Low expression of LINC00173 in DDP-resistant LUAD attributes to negative regulation by c-Myc

The above results have demonstrated that LINC00173 expression was down-regulated in DDP-resistant LUAD and its low expression contributed to the chemotherapeutic resistance of LUAD. To clarify the specific mechanism of LINC00173 down-regulation in the process of DDP-based resistance of LUAD, we explored the upstream transcriptional regulation of LINC00173 in LUAD cells. PROMO online algorithms were utilized to analyze the 2-kb sequence upstream from the transcription start site of LINC00173. A potential c-Myc binding site was predicted at −287 to −282 in the putative promoter of LINC00173 (Fig. 7a). Accordingly, c-Myc plasmids were introduced into A549 and PC9 cells with a gradient concentration, and their effect on LINC00173 expression was evaluated by qRT-PCR. As shown in Fig. 7b, LINC00173 expression level was negatively correlated with c-Myc concentration, suggesting that c-Myc may act as an upstream suppressor of LINC00173. Chromatin immunoprecipitation (ChIP) assay was carried out to confirm the binding of c-Myc to LINC00173 promoter in both A549 and A549-DDP resistant cells (Fig. 7c). Consistently, diminished luciferase activity of the LINC00173 promoter was observed in c-Myc overexpressed LUAD cells, whereas the luciferase activity was not significantly influenced by c-Myc when the putative binding site was mutated (Fig. 7d). Therefore, the above results demonstrated that c-Myc binds to the promoter of LINC00173 and inhibits transcription of LINC00173 in LUAD. Previous reports have fully revealed that the PI3K/AKT signal was over-activated in the process of DDP resistance [19,27] and c-Myc was positively regulated by PI3K/AKT[28]. We hypothesized that LINC00173 expression was depressed by DDP activated PI3K/AKT/c-Myc signal in LUAD. To verify our hypothesis, we detected their expression using western blot and found significant elevation of p-PI3K, p-AKT, and c-Myc protein level in DDP-resistant LUAD cells compared to the corresponding parental cells (Fig. 7e). Subsequently, LY294002, a specific PI3K inhibitor, was applied to block PI3K/AKT pathway in DDP-resistant LUAD cells. Western blot and qRT-PCR analyses exhibited that LY294002 markedly attenuated the expression of p-PI3K, p-AKT, and c-Myc, whereas restored the expression of LINC00173, as well as its downstream signal molecules PROCA1 and ZFP36L2 (Fig. 7f and 7g). In summary, these results revealed that activated PI3K/AKT/c-Myc signal in DDP-resistant LUAD cells contributed to the transcriptional inhibition of LINC00173.

Acquired drug resistance to cisplatin (DDP)-based chemotherapeutics has been proved as a considerable cause of relapse and thus poor prognosis of patients with lung adenocarcinoma (LUAD). As a member of the first-line standard chemotherapy drug, DDP plays an indispensable role in LUAD treatment [29]. The exploration of the molecular mechanism of DDP resistance in LUAD is therefore of great value to chemotherapy efficacy improvement. Previous studies have shown that LINC00173 acts as a tumor suppressor to inhibit cell proliferation, migration and induce apoptosis in non-small cell lung cancer (NSCLC, including LUSC and LUAD) [10]. However, recent researches demonstrated that its upregulation in small cell lung cancer (SCLC) and lung squamous cell carcinoma (LUSC) promotes DDP chemotherapy resistance as a candidate oncogene [13, 14]. These studies suggested that LINC00173 could play contrasting roles in different histologic types of lung cancer. Nevertheless, no research has been done on its role and molecular basis in LUAD resistance to DDP.

In this study, we downloaded firstly the high throughput mRNA expression data and screened the differentially expressed LncRNAs between A549 and its DDP resistant strain A549-DDP. Interestingly, LINC00173 was found significantly down-regulated in A549-DDP cells, which was subsequently verified by qRT-PCR in chemoresistant LUAD cell lines A549-DDP and PC9-DDP. Furthermore, clinical samples analysis indicated that LUAD patients with lower expression of LINC00173 had worse chemotherapeutic responses and poorer overall survival. These data supported that the down-regulated expression of LINC00173 is a significant event for DDP resistance in LUAD.

To further determine whether LINC00173 is involved in DDP resistance, we firstly investigated the molecular basis for DDP to suppress LINC00173 in LUAD. C-Myc was disclosed as a key oncogenic transcription factor [30, 31] binding to the promoter of LINC00173 and negatively modulating its expression in DDP resistant LUAD cells. Since PI3K/AKT signal is significantly activated during DDP resistance [32, 33] and c-Myc is a positive downstream regulator of PI3K/AKT [28], we speculated that DDP may repress LINC00173 expression by activating PI3K/AKT/c-Myc. Consistently with this hypothesis, PI3K inhibitor LY294002 utilized in DDP resistant cell lines successfully impaired the activity of PI3K/AKT/c-Myc signal and thus restored the expression of LINC00173 in LUAD.

Acquired DDP resistance likely occurs due to complex reasons, including increased drug efflux [34], increased repair of damaged DNA[35], increased activation of pro-survival pathways, or inhibition of apoptotic pathways which require the involvement of multiple genes and their products [36]. Thereinto, apoptosis inhibition is considered as one of the key mechanisms for chemotherapy resistance[37–39]. To further explore whether down-regulated LINC00173 is involved in DDP acquired resistance in LUAD, we silenced LINC00173 in LUAD cells but did not observe a change in colony formation, cell viability, or apoptosis induction in the absence of DDP. These data are in contrast with Yang’s data showing LINC00173 as a tumor suppressor in NSCLC [10]. However, the reason for this difference is unknown. Interestingly, with DDP treatment, LINC00173 depletion in LUAD cells significantly elevated IC₅₀ value, colony formation ability, cell viability, and restrained cell apoptosis. This is further verified in DDP resistant LUAD cells, where, in the presence of DDP, LINC00173 overexpression led to a dramatic reduction in IC₅₀ value, colony formation, and viability. More importantly, inhibition of LINC00173 by shRNAs markedly abrogated the therapeutic sensitivity of LUAD cells to DDP in vivo. Further, preliminary molecular experiments showed that LINC00173 suppresses the expression of anti-apoptotic key factor BCL2 [40] and induces the expression of apoptosis biomarkers c-CASP3 and c-PARP [41, 42].

These data together demonstrated that although LINC00173 has no effect on cell survival without DDP treatment, it significantly promotes DDP-induced cell apoptosis and thus results in chemosensitivity to DDP in LUAD. Our data was in marked contrast to the role of LINC00173 in SCLC and LUSC, thus leading to hypothesize a diversity in drug resistance function of LINC00173 in different histologic lung cancer types [13, 14].

In previous studies, LINC00173 had been reported to act as a tumor suppressor by inhibiting the miR-182-5p-regulated AGER/NF-κB pathway to restrain cell proliferation and migration in NSCLC [10]. Here, we used online prediction tools to hunt for the downstream ceRNA of LINC00173 and found miR-1275 as its candidate target. Subsequently, we firstly confirmed that miR-1275 was increased in DDP-resistant LUAD cells and then proved its function in LUAD chemotherapeutic resistance to DDP. Consistently with previous studies, miR-1275 played as an oncogene to promote LUAD progression [43].

Weighted gene co-expression network analysis (WGCNA) is a systematic biological method used to describe gene association patterns. It was utilized to screen the potential downstream target genes regulated by LINC00173 in the process of LUAD chemoresistance. PROCA1 was identified positively related to LINC00173. So far, it was only reported to interact with Cyclin A1-CDK2 complex and participate in the occurrence and development of germ cell carcinoma [44]. Further predictions implied that LINC00173 may bind to miR-1275, which was just predicted to target PROCA1. Subsequent investigation confirmed that LINC00173 acts as a competing endogenous RNA (ceRNA) to regulate downstream PROCA1 by sponging miR-1275 and thus to induce cell apoptosis and chemosensitivity to DDP in LUAD.

To deeply explore the mechanism of PROCA1-mediated LINC00173/miR-1275 signal in DDP chemosensitivity of LUAD, we used the BioGRID database to screen the potential interacting proteins of PROCA1 and ZFP36L2 was considered as a candidate target. ZFP36L2 is a member of the ZFP36 RNA-binding proteins (RBP) family which contains a CCCH zinc finger structure to bind to the AU-rich elements (ARE) in the 3' untranslated region (3'UTR) of mRNAs to accelerate mRNA degradation and inhibit protein translation [22, 23]. In recent studies, ZFP36L2 was reported as a target of AML1 to induce apoptosis of leukemia cells, suggesting its inhibitory role in tumor pathogenesis [45]. In this study, we first determined the decreased expression of ZFP36L2 in DDP-acquired resistant LUAD cells and confirmed the interaction between ZFP36L2 and PROCA1 in A549 and A549-DDP cells, as well as co-localization of both of them in the cytoplasm of A549-DDP cells. These data demonstrated that PROCA1 binds with ZFP36L2 in LUAD and is involved in LUAD acquired resistance to DDP.

BCL2 is widely known as a vital apoptosis suppressor which promotes tumor pathogenesis and DDP chemotherapy resistance by blocking mitochondrial apoptosis signaling pathways including suppressing c-CASP3 and c-PARP [46]. Intriguingly, the 3'UTR of BCL2 contains AU–rich elements which could be a binding site of ZFP36L2. Further study confirmed that ZFP36L2 binds to the 3'UTR of BCL2 mRNA to impair its stability and promote its degradation, ultimately inducing cell apoptosis and chemotherapeutic sensitivity to DDP via activating apoptosis signal in LUAD. Finally, LINC00173 transfection in DDP resistant LUAD cells significantly restored the sensitivity of cells to DDP by regulating miR-1275/PROCA1/ZFP36L2 signal to expedite ARE-mediated BCL2 mRNA decay.

In summary, we demonstrated for the first time that down-regulation of LINC00173 is involved in the poor survival outcome of LUAD patients with DDP treatment. Further, LINC00173 inhibition is attributed to DDP-activated PI3K/AKT/c-Myc-induced transcriptional repression in the process of DDP-acquired chemotherapeutic resistance. Down-regulated LINC00173 resulted in the reduced sponging of miR-1275 and thus suppressed the expression of PROCA1, which further diminished the recruitment of the RNA-binding protein ZFP36L2 to bind the 3'UTR of BCL2 mRNA and induce its degradation, ultimately enhancing BCL2 mRNA stability, impeding cell apoptosis and promoting chemotherapeutic resistance to DDP in LUAD. Our data uniquely demonstrated an inhibitory role of LINC00173 in acquired DDP resistance in LUAD which was inconsistent with its role in SCLC and LUSC. This research might provide an insight into understanding the diverse roles of LINC00173 in different histologic types of lung cancer and might guide a distinctive chemotherapeutic strategy for LUAD patients differing from SCLC or LUSC.

Acknowledgements

Not applicable.

Abbreviations

DDP, cisplatin; LUAD, lung adenocarcinoma; NSCLC, non-small cell lung cancer; SCLC, small cell lung cancer; LUSC, lung squamous cell carcinoma; LncRNA, Long noncoding RNA; ChIP, Chromatin immunoprecipitation; Co-IP, Co-immunoprecipitation; qRT-PCR, quantitative real-time polymerase chain reaction; WGCNA, weighted gene co-expression network analysis; RBP, RNA-binding protein; ARE, AU-rich element; ISH, in situ hybridization.

Authors’ contributions

Z. L. and W.Y.F. designed the research and supervised and instructed paper writing; X.Y.T., Y.L. and L.Y.W. wrote the paper, designed and performed the experiments; X.Y.T., Y.L., Y.S., Y.Y.H. prepared figures and tables and interpreted data; J.Y.X. conducted Bioinformatics analysis; S.Q.F. and X.Y.X. were responsible for pathological works, such as ISH and evaluation of pathological sections; R.Q.H.s performed analytical analysis and helped to draft the manuscript. All authors read and approved the final manuscript.

Funding

This study was supported by Guangdong Basic and Applied Basic Research Foundation (no. 2021A1515010849), and the Natural Science Foundation of China (NSFC) (no. 81872198).

Availability of data and materials

The datasets generated during and/or analyzed during the current study are available from the corresponding author upon reasonable request.

Ethics approval and consent to participate

This study was approved by the ethics committee of The Second Xiangya Hospital of Central South University. The informed consent was obtained from each participant. All animal experiments were approved by Animal Care and Use Committee of Guangzhou Medical University.

Consent for publication

All authors agree to submit the article for publication.

Competing interests

The author declares no competing interest exists.

Sung H, Ferlay J, Siegel RL, et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. Ca-Cancer J Clin. 2021;71(3):209–49. doi:10.3322/caac.21660.
Herbst RS, Morgensztern D, Boshoff C. The biology and management of non-small cell lung cancer. Nature. 2018;553(7689):446–54. doi:10.1038/nature25183.
Ghosh S. Cisplatin. The first metal based anticancer drug. Bioorg Chem. 2019;88. doi:10.1016/j.bioorg.2019.102925.
Zamble DB, Lippard SJ. Cisplatin and DNA repair in cancer chemotherapy. Trends Biochem Sci. 1995;20(10):435–9. doi:10.1016/S0968-0004(00)89095-7.
Qu W, Huang W, Yang F, Ju H, Zhu G. Long noncoding RNA LINC00461 mediates cisplatin resistance of rectal cancer via miR-593-5p/CCND1 axis. Biomed Pharmacother. 2020;124109740. doi:10.1016/j.biopha.2019.109740.
Li Y, Ye Y, Feng B, Qi Y. Long Noncoding RNA lncARSR Promotes Doxorubicin Resistance in Hepatocellular Carcinoma via Modulating PTEN-PI3K/Akt Pathway. J Cell Biochem. 2017;118(12):4498–507. doi:10.1002/jcb.26107.
Sarmento-Ribeiro AB, Scorilas A, Goncalves AC, Efferth T, Trougakos IP. The emergence of drug resistance to targeted cancer therapies: Clinical evidence. Drug Resist Update. 2019;47. doi:10.1016/j.drup.2019.100646.
Yang Y, Li H, Hou S, et al. The Noncoding RNA Expression Profile and the Effect of lncRNA AK126698 on Cisplatin Resistance in Non-Small-Cell Lung Cancer Cell. PLoS ONE. 2013;8(5). doi:10.1371/journal.pone.0065309.
Schwarzer A, Emmrich S, Schmidt F, et al. The non-coding RNA landscape of human hematopoiesis and leukemia. Nat Commun. 2017;8. doi:10.1038/s41467-017-00212-4.
Yang Q, Tang Y, Tang C, et al. Diminished LINC00173 expression induced miR-182-5p accumulation promotes cell proliferation, migration and apoptosis inhibition via AGER/NF-kappa B pathway in non-small-cell lung cancer. Am J Transl Res. 2019;11(7):4248.
Hu Z, Yang D, Tang Y, et al. Five-long non-coding RNA risk score system for the effective prediction of gastric cancer patient survival. Oncol Lett. 2019;17(5):4474–86. doi:10.3892/ol.2019.10124.
Fan H, Yuan J, Li X, et al. LncRNA LINC00173 enhances triple-negative breast cancer progression by suppressing miR-490-3p expression. Biomed Pharmacother. 2020;125. doi:10.1016/j.biopha.2020.109987.
Zeng F, Wang Q, Wang S, et al. Linc00173 promotes chemoresistance and progression of small cell lung cancer by sponging miR-218 to regulate Etk expression. Oncogene. 2020;39(2):293–307. doi:10.1038/s41388-019-0984-2.
Chen J, Liu A, Wang Z, et al. LINC00173.v1 promotes angiogenesis and progression of lung squamous cell carcinoma by sponging miR-511-5p to regulate VEGFA expression. Mol Cancer. 2020;19(1). doi:10.1186/s12943-020-01217-2.
Xiao F, Bai Y, Chen Z, et al. Downregulation of HOXA1 gene affects small cell lung cancer cell survival and chemoresistance under the regulation of miR-100. Eur J Cancer. 2014;50(8):1541–54. doi:10.1016/j.ejca.2014.01.024.
Jin L, Chun J, Pan C, et al. MAST1 Drives Cisplatin Resistance in Human Cancers by Rewiring cRaf-Independent MEK Activation. Cancer Cell. 2018;34(2):315. doi:10.1016/j.ccell.2018.06.012.
Friedrich T, Soehn M, Gutting T, et al. Subcellular compartmentalization of docking protein-1 contributes to progression in colorectal cancer. Ebiomedicine. 2016;8159 – 172. doi:10.1016/j.ebiom.2016.05.003.
Zemskova MY, Song JH, Cen B, et al. Regulation of prostate stromal fibroblasts by the PIM1 protein kinase. Cell Signal. 2015;27(1):135–46. doi:10.1016/j.cellsig.2014.10.010.
Zhen Y, Liu Z, Yang H, et al. Tumor suppressor PDCD4 modulates miR-184-mediated direct suppression of C-MYC and BCL2 blocking cell growth and survival in nasopharyngeal carcinoma. Cell Death Dis. 2013;4. doi:10.1038/cddis.2013.376.
Dong H, Hu J, Zou K, et al. Activation of LncRNA TINCR by H3K27 acetylation promotes Trastuzumab resistance and epithelial-mesenchymal transition by targeting MicroRNA-125b in breast Cancer. Mol Cancer. 2019;18. doi:10.1186/s12943-018-0931-9.
Xu M, Chen X, Lin K, et al. lncRNA SNHG6 regulates EZH2 expression by sponging miR-26a/b and miR-214 in colorectal cancer. J Hematol Oncol. 2019;12. doi:10.1186/s13045-018-0690-5.
Hudson BP, Martinez-Yamout MA, Dyson HJ, Wright PE. Recognition of the mRNA AU-rich element by the zinc finger domain of TIS11d. Nat Struct Mol Biol. 2004;11(3):257–64. doi:10.1038/nsmb738.
Adachi S, Homoto M, Tanaka R, et al. ZFP36L1 and ZFP36L2 control LDLR mRNA stability via the ERK-RSK pathway. Nucleic Acids Res. 2014;42(15):10037–49. doi:10.1093/nar/gku652.
Soundararajan S, Chen W, Spicer EK, Courtenay-Luck N, Fernandes DJ. The nucleolin targeting aptamer AS1411 destabilizes bcl-2 messenger RNA in human breast cancer cells. Cancer Res. 2008;68(7):2358–65. doi:10.1158/0008-5472.CAN-07-5723.
Yin XM, Oltvai ZN, Korsmeyer SJ. BH1 and BH2 domains of Bcl-2 are required for inhibition of apoptosis and heterodimerization with Bax. Nature. 1994;369(6478):321–3. doi:10.1038/369321a0.
Anderson MA, Deng J, Seymour JF, et al. The BCL2 selective inhibitor venetoclax induces rapid onset apoptosis of CLL cells in patients via a TP53-independent mechanism. Blood. 2016;127(25):3215–24. doi:10.1182/blood-2016-01-688796.
Liu C, Peng X, Li Y, et al. Positive feedback loop of FAM83A/PI3K/AKT/c-Jun induces migration, invasion and metastasis in hepatocellular carcinoma. Biomed Pharmacother. 2020;123. doi:10.1016/j.biopha.2019.109780.
Li Y, Liu X, Lin X, et al. Chemical compound cinobufotalin potently induces FOXO1-stimulated cisplatin sensitivity by antagonizing its binding partner MYH9. SIGNAL Transduct Target THERAPY. 2019;4. doi:10.1038/s41392-019-0084-3.
Li R, Liu J, Fang Z, Liang Z, Chen X. Identification of Mutations Related to Cisplatin-Resistance and Prognosis of Patients With Lung Adenocarcinoma. Front Pharmacol. 2020;11. doi:10.3389/fphar.2020.572627.
Liang Z, Liu Z, Cheng C, et al. VPS33B interacts with NESG1 to modulate EGFR/PI3K/AKT/c-Myc/P53/miR-133a-3p signaling and induce 5-fluorouracil sensitivity in nasopharyngeal carcinoma. Cell Death Dis. 2019;10. doi:10.1038/s41419-019-1457-9.
Chen Y, Liu Z, Wang H, et al. VPS33B negatively modulated by nicotine functions as a tumor suppressor in colorectal cancer. Int J Cancer. 2020;146(2):496–509. doi:10.1002/ijc.32429.
Zhang R, Sun S, Ji F, et al. CNTN-1 Enhances Chemoresistance in Human Lung Adenocarcinoma Through Induction of Epithelial-Mesenchymal Transition by Targeting the PI3K/Akt Pathway. Cell Physiol Biochem. 2017;43(2):465–80. doi:10.1159/000480473.
Zheng P, Chen L, Yuan X, et al. Exosomal transfer of tumor-associated macrophage-derived miR-21 confers cisplatin resistance in gastric cancer cells. J Exp Clin Canc Res. 2017;36. doi:10.1186/s13046-017-0528-y.
Wiese M, Stefan YM. The A-B-C of small-molecule ABC transport protein modulators: From inhibition to activation-a case study of multidrug resistance-associated protein 1 (ABCC1). Med Res Rev. 2019;39(6):2031–81. doi:10.1002/med.21573.
Reily Rocha CR, Silva MM, Quinet A, Cabral-Neto JB. & Martins Menck C F. DNA repair pathways and cisplatin resistance: an intimate relationship. Clinics. 2018;731. doi:10.6061/clinics/2018/e478s.
Shen D, Pouliot LM, Hall MD, Gottesman MM. Cisplatin Resistance: A Cellular Self-Defense Mechanism Resulting from Multiple Epigenetic and Genetic Changes. Pharmacol Rev. 2012;64(3):706–21. doi:10.1124/pr.111.005637.
Stronach EA, Chen M, Maginn EN, et al. DNA-PK Mediates AKT Activation and Apoptosis Inhibition in Clinically Acquired Platinum Resistance. Neoplasia. 2011;13(11):1069–114. doi:10.1593/neo.111032.
Smith BD, Bambach BJ, Vala MS, et al. Inhibited apoptosis and drug resistance in acute myeloid leukaemia. Brit J Haematol. 1998;102(4):1042–9. doi:10.1046/j.1365-2141.1998.00854.x.
Li M, Zhang Y, Shang J, Xu Y. LncRNA SNHG5 promotes cisplatin resistance in gastric cancer via inhibiting cell apoptosis. Eur Rev Med Pharmaco. 2019;23(10):4185–91. 10.26355/eurrev_201905_17921. doi.
Youle RJ, Strasser A. The BCL-2 protein family: opposing activities that mediate cell death. Nat Rev Mol Cell Bio. 2008;9(1):47–59. doi:10.1038/nrm2308.
Liu L, Wang Q, Mao J, et al. Salinomycin suppresses cancer cell sternness and attenuates TGF-beta-induced epithelial-mesenchymal transition of renal cell carcinoma cells. Chem-Biol Interact. 2018;296145–153. doi:10.1016/j.cbi.2018.09.018.
Shi J, Zhong X, Song Y, et al. Long non-coding RNA RUNX1-IT1 plays a tumour-suppressive role in colorectal cancer by inhibiting cell proliferation and migration. Cell Biochem Funct. 2019;37(1):11–20. doi:10.1002/cbf.3368.
Jiang N, Zou C, Zhu Y, et al. HIF-1 alpha-regulated miR-1275 maintains stem cell-like phenotypes and promotes the progression of LUAD by simultaneously activating Wnt/beta-catenin and Notch signaling. Theranostics. 2020;10(6):2553–70. doi:10.7150/thno.41120.
Diederichs S, Baumer N, Ji P, et al. Identification of interaction partners and substrates of the cyclin A1-CDK2 complex. J Biol Chem. 2004;279(32):33727–41. doi:10.1074/jbc.M401708200.
Liu J, Lu W, Liu S, et al. ZFP36L2, a novel AML1 target gene, induces AML cells apoptosis and inhibits cell proliferation. Leuk Res. 2018;6815–21. doi:10.1016/j.leukres.2018.02.017.
Chen C, Zhou H, Xu L, et al. Recombinant human PDCD5 sensitizes chondrosarcomas to cisplatin chemotherapy in vitro and in vivo. Apoptosis. 2010;15(7):805–13. doi:10.1007/s10495-010-0489-5.

SupplementaryFigure1.tif
Supplementary Fig. 1 Establishment of DDP-resistant LUAD cell lines. a. Microscopic pictures of parental LUAD cells (A549 and PC9) and DDP-resistant cells (A549-DDP and PC9-DDP) (Scale bars, 100μm). b. CCK8 assay for IC50 value in parental LUAD cells (A549 and PC9) and cisplatin-resistant cells (A549-DDP and PC9-DDP) after gradient concentration of cisplatin treatment. c. Endogenous expression level of LINC00173 in LUAD cell lines and immortalized human bronchial epithelial cells 16HBE were confirmed by RT-qPCR. Error bars, mean ±SD.
SupplementaryFigure2.tif
Supplementary Fig. 2 Biological functions of LINC00173 in LUAD without cisplatin treatment. a. After shLINC00173 transfection, the expression of LINC00173 was significantly decreased in A549 and PC9 cells. b-c. Colony formation ability (b) and cell viability (c) were not significantly changed by LINC00173 knockdown in A549 and PC9 cells which cultured with non-cisplatin medium. d. After LINC00173 smart silencer was introduced to A549 and PC9 cells, RT-qPCR was used to detect the efficiency of RNA interference. e and f. Flow cytometry (e) and western blot (f) were used to detect the cell apoptosis rate and alteration of apoptosis-related proteins in LINC00173 interfered A549 and PC9 cells in the absence of cisplatin. β-Tubulin was used as a loading control. The grey values of all bands were obtained by Image J software (USA). Student’s two-tailed t-test, ***P<0.001; ****P<0.0001; ns, no significance. Error bars, mean ±SD.
SupplementaryFigure3.tif
Supplementary Fig. 3 LINC00173 overexpression sensitizes DDP-resistant LUAD cells to DDP treatment. a. The expression of LINC00173 was detected in A549-DDP and PC9-DDP cells after LINC00173 plasmids transfection by RT-qPCR. b. After LINC00173 plasmids transfection in A549-DDP and PC9-DDP cells, CCK8 assay was used to detect the IC50 value to cisplatin. c and d. Cell viability (c) and colony formation ability (d) were inhibited in LINC00173 transfected A549-DDP and PC9-DDP cells with cisplatin treatment. e. Flow cytometry was used to detect the cell apoptosis rate in LINC00173 overexpressed A549-DDP and PC9-DDP cells in the presence of cisplatin. Student’s two-tailed t-test, *P<0.05; **P<0.01; ***P<0.001; ****P<0.0001. Error bars, mean ±SD.
SupplementaryFigure4.tif
Supplementary Fig. 4 The expression of LINC00173 and PROCA1 are negatively associated with miR-1275 which promotes the chemoresistance of LUAD cells to cisplatin. a. GEO dataset (GSE43493) was utilized to screen the differential expression genes in A549 and A549-DDP cells, and PROCA1 was found down-regulated in LUAD DDP-resistant A549-DDP cells. b. RT-qPCR tested the expression level of miR-1275 after LINC00173 transfection and LINC00173 co-transfected with miR-1275 mimics in DDP-resistant LUAD cells. c-d. Endogenous expression level of miR-1275 (c) and PROCA1 (d) was confirmed by RT-qPCR in parental LUAD cells and cisplatin-resistant A549-DDP and PC9-DDP cells. e and f. MiR-1275 mimics (e) or inhibitor (f) were transfected respectively into parental LUAD cells or DDP-resistant cells. After 72 hours, PROCA1 expression level was detected by RT-qPCR. g and h. The IC50 value of parental LUAD cells to cisplatin was obviously elevated by miR-1275 mimics transfection (g), while IC50 value was declined in DDP-resistant LUAD cells after miR-1275 inhibitor transfection (h). Student’s two-tailed t-test, **P<0.01; ***P<0.001; ****P<0.0001. Error bars, mean ±SD.
SupplementaryFigure5.tif
Supplementary Fig. 5 MiR-1275/PROCA1 axis is crucial for LINC00173 mediated chemosensitivity to DDP in LUAD. a. Compared to shLINC00173 transfected cells, the IC50 value of parental LUAD cells to cisplatin was restored partially by miR-1275 inhibitor. b. Compared to shLINC00173 transfected cells, cell viability was restrained partly by miR-1275 inhibitor in the presence of cisplatin. c. Western blot analyzed the expression level of apoptosis-related proteins, containing cleaved-PARP (c-PARP), cleaved-Caspase3 (c-CASP3), and BCL2 in cisplatin treated LUAD cells which were introduced with shLINC00173 and miR-1275 inhibitor. β-Tubulin was used as a loading control. The grey values of all bands were obtained by Image J software (USA). d. Cell viability was partially antagonized by PROCA1 in shLINC00173 transfected LUAD cells with cisplatin treatment. e. Western blot analyzed the expression level of apoptosis-related proteins, containing cleaved-PARP (c-PARP), cleaved-caspase3 (c-CASP3), and BCL2 in cisplatin treated LUAD cells which were introduced with shLINC00173 and PROCA1. f. Cell viability was partially antagonized by PROCA1 in miR-1275 mimics transfected LUAD cells in the presence of cisplatin. Student’s two-tailed t-test, *P<0.05; **P<0.01; ***P<0.001; ****P<0.0001. Error bars, mean ±SD.

Download PDF

Journal Publication

published 10 Jan, 2023

Read the published version in Journal of Experimental & Clinical Cancer Research →

Editorial decision: Major revision
20 Apr, 2022
Reviews received at journal
13 Apr, 2022
Reviewers invited by journal
08 Apr, 2022
Editor assigned by journal
07 Apr, 2022
First submitted to journal
03 Apr, 2022

You are reading this latest preprint version

Downregulation of Linc00173 increases BCL2 mRNA stability via the miR-1275/PROCA1/ZFP36L2 axis and induces acquired cisplatin resistance of lung adenocarcinoma

Status:

Journal Publication

Version 1

Abstract

Background

Methods

Results

Conclusion

Figures

Background

Materials And Methods

Results

Discussion

Conclusion

Declarations

References

Supplementary Files

Status:

Journal Publication

Version 1